CN111729083B - Novel use of endothelin C receptor - Google Patents

Abstract

The invention discloses an application of an Endothelial Protein C Receptor (EPCR) as a target spot in preparing a medicament for treating endothelial cell injury induced by medicaments such as limus, paclitaxel and the like; the method of the invention uses virus as a vector to over-express EPCR or uses APC (activated protein C), polypeptide TR47, compound Parmodulin2 and the like to activate EPCR, and the like, can effectively exert protective intervention on the damage of endothelial cells induced by drugs such as limus, paclitaxel and the like, but does not affect smooth muscle cells.

Description

Novel use of endothelin C receptor

Technical Field

The invention relates to a medicine for treating cell injury, in particular to an application of an endothelial protein C receptor as a target spot in preparing endothelial cell injury induced by medicines such as anti-limus and paclitaxel.

Background

The limus and the paclitaxel are the most widely applied elution (coating) medicines on the current heart coronary artery stent, wherein the most common are rapamycin, everolimus, zotarolimus and paclitaxel. Coronary artery stent implantation achieves the purposes of reconstructing blood vessels and further improving myocardial ischemia by implanting a heart stent, and becomes the most important treatment means for coronary heart disease. The coating medicine can effectively inhibit the proliferation of human vascular smooth muscle so as to prevent the occurrence of restenosis. However, with the continuous and intensive clinical application and related research, it is found that the drug eluting stent may cause complications such as thrombus in the stent, especially late thrombus. Intrastent thrombosis is one of the most serious complications after stent implantation, and can lead to serious consequences of myocardial infarction and even sudden death.

A great deal of previous researches believe that the coating drugs of the limus and the paclitaxel induce endothelial cell injury, cause endothelialization delay, further cause vascular endothelial dysfunction and damage of self-repair capability, and are the main reasons of late thrombosis in the stent.

At present, no effective means for protective intervention on the damage of the endothelial cells induced by the limus and the paclitaxel exists clinically. At present, no specific prevention and treatment method is provided for thrombus in a stent clinically except for systemic anticoagulation prevention. However, anticoagulant therapy does not improve endothelial function and does not fundamentally solve this problem. Moreover, systemic anticoagulation has adverse reactions (such as gastrointestinal bleeding), poor compliance (long time) and risk of re-thrombosis after drug withdrawal. Therefore, a method for protectively intervening in the damage of the endothelial cells induced by the limus and the paclitaxel is found to promote the re-endothelialization and further effectively prevent and treat the thrombus in the stent, which is a problem to be solved urgently at present. Is also a hotspot for the research and development of novel brackets at home and abroad at present.

The search for new coating drugs that effectively inhibit vascular smooth muscle without affecting, or even promoting, endothelial cells is a leading direction of research. The exploration strategy is divided into two categories. One is to find new compounds as coating drugs. Such as a series of rapamycin derivatives, statins, arsenic trioxide and other new coating drugs. It is hoped that the effect of the coating drug on inhibiting the proliferation of smooth muscle is not weakened, and the damage effect of coronary endothelial cells can be protectively interfered. But the actual effect is not as expected: either the effect of inhibiting smooth muscle is not as good as that of the limus, or the effect of damaging endothelial cells is more obvious. Secondly, the medicine for promoting endothelial cells is combined and applied on the basis of the original limus (inhibiting smooth muscle). This is a relatively feasible, realistic strategy, but the effect is not ideal at present. Some of the coating drugs used in combination in the prior report do not start from the perspective of cell-specific molecular targets, so that great blindness exists. I.e., acting mechanistically not only on endothelial cells, but not on smooth muscle cells. Such as a rapamycin + VEGF (vascular endothelial growth factor) combination. Although VEGF can greatly improve endothelial cell function, VEGF also promotes proliferation and migration of smooth muscle cells and impairs the action of rapamycin.

Disclosure of Invention

Based on the above problems, the present invention aims to overcome the disadvantages of the prior art and provide a method for increasing the expression of EPCR or activating EPCR as a specific agent for promoting endothelial cell function without affecting the effect of heart coating drugs, namely, limus and paclitaxel, on inhibiting smooth muscle cells.

In order to achieve the purpose, the technical scheme adopted by the invention comprises the following aspects:

in a first aspect, the present invention provides the use of an Endothelial Protein C Receptor (EPCR) as a target for the preparation of a medicament for the treatment of endothelial cell injury.

Preferably, the endothelial cell injury is induced by a drug, and the drug inducing the endothelial cell injury is a limus or/and paclitaxel.

In another aspect, the invention provides the use of an agent that overexpresses EPCR or an activator of EPCR in the manufacture of a medicament for treating endothelial cell injury.

Preferably, the endothelial cell injury is induced by a drug, and the drug inducing the endothelial cell injury is a limus or/and paclitaxel.

Preferably, the agent overexpressing EPCR is an adenoviral vector. Thus, overexpression of EPCR protectively interferes with drug-induced endothelial cell injury such as limus and paclitaxel, and does not affect smooth muscle cells.

Preferably, the activator of EPCR is APC (activated protein C), TR47 or Parmodulin 2. Thus, polypeptide TR47, compound Parmodulin2, can activate EPCR; APC (activated protein C), TR47 and Parmodulin2 can be used for protective intervention in drug-induced endothelial cell injury such as limus and paclitaxel, and do not affect smooth muscle cells.

In a third aspect, the present invention provides a cardiac stent coating comprising an activator of EPCR.

Preferably, the activator of EPCR is APC, TR47 or Parmodulin 2.

In a fourth aspect, the present invention provides the use of an activator of EPCR in combination with a limus or paclitaxel for the preparation of a medicament for the coating of cardiac stents.

Preferably, the activator of EPCR is APC, TR47 or Parmodulin 2.

In conclusion, the beneficial effects of the invention are as follows:

the invention uses virus as carrier to over-express EPCR or uses APC (activated protein C), polypeptide TR47, compound Parmodulin2 and other methods to activate EPCR, which can effectively exert protective intervention on the damage of endothelial cells induced by drugs such as limus and paclitaxel, but does not affect smooth muscle cells.

Drawings

FIG. 1 is a graph of the results of proteomics studies of rapamycin damaging human coronary endothelial cells; wherein, (a) a differential protein heatmap; (B) GO classification analysis result graph;

FIG. 2 is a graph showing the results of the interaction between limus drug and paclitaxel and endothelial cells, which shows that the limus drug and paclitaxel induce the decrease of EPCR expression in human coronary endothelial cells, wherein (A) the concentration-dependent inhibition of EPCR expression in human coronary endothelial cells is performed on rapamycin, paclitaxel, zotarolimus (zotarolimus), and everolimus (everolimus); (B) pimecrolimus (pimecrolimus), tacrolimus (tacrolimus), reprolimus (deforolimus, also called ridaforolimus), and bairolimus (biolimus a9, also called umirolimus) and the like, inhibit the expression of EPCR;

FIG. 3 is a graph showing the effect of downregulation of EPCR expression on endothelial cells, demonstrating the inhibition of human coronary endothelial cell function, wherein: (A) downregulation of EPCR expression reduces p-eNOS (phosphorylated nitric oxide synthase) levels in human coronary endothelial cells; (B) downregulation of EPCR expression reduces NO (nitric oxide) release from human coronary endothelial cells; (C) the EPCR expression is down-regulated to inhibit the cell activity of human coronary endothelial cells; (D) the EPCR expression is down-regulated to inhibit the migration capacity of human coronary endothelial cells; (E) the EPCR expression is down-regulated to inhibit the tubule forming ability of human coronary endothelial cells; comparison with the control group: p <0.05, statistically different; p <0.01, statistically significant differences; p <0.001, with statistically very significant differences;

FIG. 4 is a graph showing the effect of the downregulation of EPCR expression on endothelial cells and endothelium, showing that the downregulation of EPCR expression promotes the adhesion of inflammatory cells to human coronary endothelial cells, impairing endothelial barrier function, wherein: (A) the EPCR expression is down-regulated to promote the expression of human coronary endothelial cell adhesion molecules ICAM-1 (intercellular adhesion molecule-1) and VCAM-1 (vascular cell adhesion molecule-1); (B) the expression of EPCR is down-regulated to promote the adhesion of neutrophils to human coronary endothelial cells; (C) the EPCR expression is down-regulated to damage the barrier function of human coronary endothelial cells; comparison with the control group: p <0.01, statistically significant differences; p <0.001, with statistically very significant differences;

FIG. 5 is a graph of the results of the effects of over-expression of EPCR on endothelial cells, showing that over-expression of EPCR can protect against damage of human coronary endothelial cell function induced by both limus and paclitaxel drugs, wherein: (A) EPCR-1-RAC1-PAK/Akt-eNOS pathway diagram; (B) the adenovirus is used as a vector to over-express EPCR; (C) overexpression of EPCR protects and activates RAC1-PAK/Akt-eNOS pathway inhibited by limus and paclitaxel drugs; (D) over-expression of EPCR protectively promotes NO release from damaged human coronary endothelial cells; (E) over-expression of EPCR protectively promotes viability of damaged human coronary endothelial cells; (F) over-expression of EPCR protectively promotes inhibited human coronary endothelial cell barrier function; drug treatment compared to untreated group: p <0.05, statistically different; p <0.01, statistically significant differences; p <0.001, with statistically very significant differences. Comparison of over-expressed EPCR with over-expressed GFP (green fluorescent protein) control group: # P <0.05, statistically different; # P <0.01, statistically significant difference; # P <0.001, with significant difference in statistics;

FIG. 6 is a graph of the effect of over-expressed EPCR on the proliferation, migration and tubule formation ability of endothelial cells, showing that over-expressed EPCR can protectively interfere with the proliferation, migration and tubule formation ability of human coronary endothelial cells damaged by limus and paclitaxel drugs, wherein: (A) the over-expression EPCR protectively intervenes in the proliferation of human coronary endothelial cells damaged by the limus and the paclitaxel medicaments; (B) overexpresses the migratory capacity of EPCR protective interventions in damaged human coronary endothelial cells; (C) overexpression of EPCR protectively interferes with the tubule forming ability of damaged human coronary endothelial cells; drug treatment compared to untreated group: p <0.05, statistically different; p <0.01, statistically significant differences; p <0.001, with statistically very significant differences; comparison of over-expressed EPCR with over-expressed GFP (green fluorescent protein) control group: # P <0.05, statistically different; # P <0.01, statistically significant difference; # P <0.001, with significant difference in statistics;

FIG. 7 is a graph of the results of the effects of over-expression of EPCR on inflammatory cell, platelet adhesion, showing that over-expression of EPCR can protectively interfere with the drug-induced inflammatory cell, platelet adhesion of both limus and paclitaxel, wherein: (A) overexpression of EPCR (epirubicin receptor) for protective intervention of limus and paclitaxel drug-induced release increase of adhesion molecules sICAM-1 (secretory ICAM-1) and sVCMA-1 (secretory ICAM-1); (B) over-expression of EPCR protectively inhibits platelet adhesion to human coronary endothelial cells; (C) over-expression of EPCR protectively inhibits neutrophil adhesion to human coronary endothelial cells; drug treatment compared to untreated group: p <0.05, statistically different; p <0.01, statistically significant differences; p <0.001, with statistically very significant differences; comparison of over-expressed EPCR with over-expressed GFP (green fluorescent protein) control group: # P <0.05, statistically different; # P <0.01, statistically significant difference; # P <0.001, with significant difference in statistics;

FIG. 8 is a graph showing the effect of APC, TR47, Parmodulin2 on the EPCR-biased PAR1-RAC1-PAK/Akt-eNOS pathway, showing that APC, TR47, Parmodulin2 can protectively activate the EPCR-biased PAR1-RAC1-PAK/Akt-eNOS pathway, in which: (A) APC, TR47, Parmodulin2 activate the EPCR-biased PAR1-RAC1-PAK/Akt-eNOS pathway; (B) APC, TR47, Parmodulin2 protectively upregulate EPCR expression inhibited by limus and paclitaxel drugs;

FIG. 9 is a graph of the effect of over-expression or activation of EPCR on rapamycin inhibiting human smooth muscle cells, wherein: (A) EPCR is specifically expressed in endothelial cells, and is hardly expressed in smooth muscle cells; (B) APC does not affect rapamycin inhibits smooth muscle cell viability; (C) APC does not affect the ability of rapamycin to inhibit smooth muscle cell proliferation; (D) APC does not affect the ability of rapamycin to inhibit smooth muscle cell migration; significant differences in statistics, # #, P < 0.01; p <0.001, with statistically very significant differences; n.s., no statistical difference.

Detailed Description

The inventors of the present application believe that an accurate and specific molecular target is an inherent requirement for finding a novel method for the protective intervention of the limus and paclitaxel-induced endothelial cell injury. Therefore, a new and smart strategy is adopted: the molecular mechanism is to search for a new agonistic target which is specifically expressed in endothelial cells but not expressed in smooth muscle cells. The new specific endothelial target is expected to be excited, and the protective intervention is performed on the endothelial cells induced by the limus and the paclitaxel, so that the re-endothelialization process is promoted, and the purpose of intervening the thrombus in the stent is achieved. Therefore, in the previous work, the inventors used proteomics to screen, and found that EPCR (endothelial protein C receptor) is one of the potential agonist targets for the first time. The receptor EPCR is a protein that is widely and specifically expressed in endothelial cells, but is hardly expressed in smooth muscle cells.

It has been widely demonstrated that the receptor EPCR is a key loop in the "APC-EPCR-RAC 1-PAK/Akt-eNOS pathway". EPCR plays both an important role in the anticoagulant system and is a key effector molecule for maintaining endothelial function, including proliferative migration of endothelial cells, tubule formation, barrier function. Therefore, it is expected that the ability of the coated drug to inhibit smooth muscle can not be affected by increasing the expression of EPCR or activating EPCR, but three effects of anticoagulation and improvement of endothelial cell function can be exerted. The effect of 'one stone three birds' is achieved. Meanwhile, because EPCR is a receptor protein on cell membranes, drug intervention is convenient and feasible. The invention therefore proposes a method of: increasing EPCR expression or activating EPCR serves as a means of specifically promoting endothelial cell function without affecting the effect of the stent coating drugs, limus and paclitaxel, on smooth muscle cell inhibition.

To better illustrate the objects, aspects and advantages of the present invention, the present invention will be further described with reference to the accompanying drawings and specific embodiments. Unless otherwise specified, the experimental methods in this application are all conventional methods. Unless otherwise specified, the reagents, media, cells or materials in the present application are publicly available in the market or the like.

Example 1 inhibition of human coronary endothelial cell EPCR expression by Riolimus drugs and paclitaxel

In order to comprehensively and systematically explore a specific molecular mechanism of rapamycin (rapamyin, also called sirolimus) damaging human coronary endothelial cells and to seek a method for interfering in adverse reaction of a rapamycin stent, the inventor carries out proteomics research based on an iTRAQ (isotope labeling relative and absolute quantification) technology.

Human coronary endothelial cells (HCAECs) were treated with rapamycin at 100nM for 48 hours, and a batch of rapamycin-regulated protein molecules (see FIG. 1) in which one receptor protein, EPCR, was downregulated by rapamycin by 3.7-fold (see FIG. 1) was found compared to the control group. It was further found that, in addition to rapamycin, HCAECs treated with paclitaxel (paclitaxel), zotarolimus (zotarolimus), and everolimus (everolimus) at concentrations ranging from 0.1nM to 1000nM for 48 hours were all able to exhibit concentration-dependent inhibition of human coronary endothelial cell EPCR protein expression (see FIG. 2A). Other limus drugs, including 100nM tacrolimus (tacrolimus), 100nM temsirolimus (deforolimus, also called ridaforolimus), 20. mu.M pimecrolimus (pimecrolimus), 10. mu.M bairolimus (biolimus A9, also called umilimus), and the like, also inhibit EPCR expression (see FIG. 2B). Therefore, the invention discovers for the first time that the limus and the paclitaxel can inhibit the expression of EPCR.

Experimental example 2 adenovirus overexpression EPCR protective intervention in Riolimus and paclitaxel drug-induced damage to human coronary endothelial cell function and barrier function, inflammatory cell and platelet adhesion

A method of transfecting 100nM si-EPCR 1#, si-EPCR 2# (small molecule interference 1# and 2# of EPCR) with liposomes for 48 hours, respectively, was used as a means for down-regulating EPCR, and the effect on human coronary endothelial cells was examined. p-eNOS was detected by immunoblotting, the activity of eNOS was detected by detecting the concentration of NO in the cell supernatant, the cell viability was detected by CCK-8, the cell proliferation was detected by EdU, the cell migration ability was detected by transwell method, and the tubule formation ability was observed. Immunoblotting was used to detect the expression of the adhesion molecules ICAM-1, VCMA-1 or ELISA was used to detect the release of the secreted adhesion molecules sICAM-1, sVCMA-1. Evans blue staining examined endothelial cell permeability. Adhesion experiment to observe the ability of neutrophil to adhere to endothelial cell, and Richter-Giemsa staining to observe platelet adhesion. The base sequence of si-RNA related to this example is as follows:

si-EPCR 1#：TGGCCTCCAAAGACTTCATAT(SEQ ID NO.1)；

si-EPCR 2#：GCACTCGGTATGAACTGCGGGAATT(SEQ ID NO.2)。

as shown in fig. 3 and 4, the downregulation of EPCR expression decreased p-eNOS levels (see fig. 3A), NO release (see fig. 3B), cell viability (see fig. 3C), migration (see fig. 3D), tubule forming ability (see fig. 3E) of endothelial cells. Meanwhile, the downregulation of EPCR expression promoted the expression of endothelial cell adhesion molecules ICAM-1, VCAM-1 (see FIG. 4A), neutrophil adhesion (see FIG. 4B), impaired barrier function (see FIG. 4C). Therefore, the EPCR expression is down-regulated to inhibit the function of human coronary artery endothelial cells, promote inflammatory cell adhesion and damage the function of endothelial barrier.

In accordance with this, EPCR (see fig. 5B) was overexpressed using adenovirus as a vector (MOI ═ 10 was selected) to activate RAC1-PAK/Akt-eNOS pathway (see fig. 5C), which was inhibited by drugs of limus (both 100nM) and paclitaxel (10nM), to promote NO release (see fig. 5D), cell viability (see fig. 5E), and to inhibit barrier function impairment (see fig. 5F). Overexpression of EPCR (MOI ═ 10) protectively intervenes in the proliferation (see fig. 6A), migration (see fig. 6B) and tubule forming ability (see fig. 6C) of human coronary endothelial cells injured by both the limus (both 100nM) and paclitaxel (10nM) drugs. Overexpression of EPCR protected intervention increased release of adhesion molecules sICAM-1 and sVCMA-1 induced by the limus and paclitaxel drugs (see FIG. 7A), platelet adhesion (see FIG. 7B), neutrophil adhesion (see FIG. 7C).

In conclusion, the results of the assay of this example show that the downregulation of EPCR expression inhibits the function of human coronary endothelial cells. The over-expression EPCR protectively intervenes in the damage of human coronary endothelial cell function and barrier function, inflammatory cells and platelet adhesion induced by the limus and paclitaxel medicaments.

Experimental example 3 APC, TR47, Parmodulin2 protective activation of EPCR-biased PAR1-RAC1-PAK/Akt-eNOS pathway impaired by limus and paclitaxel drugs

APC (activated protein C) is a natural ligand for the receptor EPCR. In addition to activating EPCR, immunoblotting demonstrated that 40nM APC was able to induce EPCR expression (see FIG. 8A), consistent with literature reports ^[1] . TR47 is a polypeptide from the PAR1 protein itself ^[2] Both the polypeptide TR47 and the compound PM2(Parmodulin 2) activate the biased PAR1 pathway (PAR1 alternative) and exert endothelial cell protecting effects ^[2-3] 。

This example was preceded by immunoblotting experiments to find that 40. mu.M TR47 and 10. mu.M Parmodulin2 also increased EPCR expression (see FIG. 8A), so that APC, TR47, Parmodulin2 activated the EPCR-biased PAR1-RAC1-PAK/Akt-eNOS pathway (see FIG. 8A). Furthermore, APC, TR47 and Parmodulin2 were able to protectively increase the expression of EPCR inhibited by both limus and paclitaxel drugs (see fig. 8B). Therefore, APC, TR47, Parmodulin2 have the function of activating EPCR to exert protective intervention on human coronary endothelial cells induced by the limus and paclitaxel drugs.

Experimental example 4 overexpression of EPCR or activation of EPCR did not affect the proliferative migration of human smooth muscle cells

Immunoblot assays indicated that EPCR was predominantly expressed in endothelial cells, such as HCAEC, HAEC (human aortic endothelial cells), HUVEC (human umbilical vein endothelial cells), while smooth muscle cells, such as HASMC (human aortic smooth muscle cells), MASMC (mouse aortic smooth muscle cells), were hardly expressed (see fig. 9A). Adenovirus-mediated EPCR (MOI ═ 10) overexpression inhibited smooth muscle cell proliferation (see fig. 9C), migration (see fig. 9D). Whereas 40nM APC treatment did not affect the ability of 100nM rapamycin to inhibit smooth muscle cell viability, proliferation and migration (see FIGS. 9B-D).

Reference:

1.Seol JW,Lee YJ,Jackson CJ,Sambrook PN,Park SY.Activated protein C inhibits bisphosphonate-induced endothelial cell death via the endothelial protein C receptor and nuclear factor-κB pathways.Int J Mol Med.2011Jun；27(6):835-40.doi:10.3892/ijmm.2011.649.

2.Mosnier LO,Sinha RK,Burnier L,Bouwens EA,Griffin JH.Biased agonism of protease-activated receptor 1by activated protein C caused by noncanonical cleavage at Arg46.Blood.2012Dec 20；120(26):5237-46.doi:10.1182/blood-2012-08-452169.

3.De Ceunynck K,Peters CG,Jain A,Higgins SJ,Aisiku O,Fitch-Tewfik JL,Chaudhry SA,Dockendorff C,Parikh SM,Ingber DE,Flaumenhaft R.PAR1 agonists stimulate APC-like endothelial cytoprotection and confer resistance to thromboinflammatory injury.Proc Natl Acad Sci U S A.2018Jan 30；115(5):E982-E991.doi:10.1073/pnas.1718600115.

finally, it should be noted that the above embodiments are only used for illustrating the technical solutions of the present invention and not for limiting the protection scope of the present invention, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

SEQUENCE LISTING

<110> Guangzhou medical university affiliated second hospital

New application of <120> endothelial protein C receptor

<130> 2020

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 21

<212> DNA

<213> Artificial Synthesis

<400> 1

tggcctccaa agacttcata t 21

<210> 2

<211> 25

<212> DNA

<213> Artificial Synthesis

<400> 2

gcactcggta tgaactgcgg gaatt 25

Claims (2)

1. Use of an agent that overexpresses EPCR or an activator of EPCR in the manufacture of a medicament for treating endothelial cell injury induced by limus or/and paclitaxel without affecting the ability of limus or/and paclitaxel to inhibit smooth muscle;

the reagent for over-expressing EPCR is an adenovirus vector;

the activator of EPCR is APC (activated protein C), TR47 or Parmodulin 2.

The application of the combined use of the EPCR activating agent and the limus or the paclitaxel in preparing the heart stent coating medicine;

the activator of EPCR is APC (activated protein C), TR47 or Parmodulin 2.

Images