CN111607604B - Application of cotton GHPSAT2 gene in promoting flowering of plants - Google Patents

Abstract

The invention discloses cottonGHPSAT2The application of gene in promoting plant blooming belongs to the field of plant gene engineering technology.GHPSAT2The gene has a nucleotide sequence shown in SEQ ID No.3 and can encode an amino acid sequence shown in SEQ ID No. 4. The invention relates to a transgene obtained by transgenic technologyGHPSAT2The gene arabidopsis thaliana plant can remarkably advance the flowering time of arabidopsis thaliana, and shows thatGHPSAT2The gene plays a key role in promoting cotton blossoming. The invention provides favorable gene resources for the cultivation of short-season cotton.

Description

Application of cotton GHPSAT2 gene in promoting flowering of plants

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to application of a GHPSAT2 gene in promoting plant flowering.

Background

Cotton is an important economic crop and textile raw material in China, and has no substitutable effect on the development of the national economy. However, the population of China is large, the cultivated land area is relatively small, and the contradiction of land competition of grains and cotton is prominent. The premature cotton is a cotton type suitable for relieving the current situation that land competition and vegetation area of grain and cotton are gradually reduced. By utilizing the characteristics of short growth period, late sowing and the like, the method can realize that grain and cotton are ripe twice a year, improve the land multiple cropping index, enlarge the cotton planting area, avoid seedling-stage plant diseases and insect pests caused by early spring drought, low temperature and other factors, reduce pesticide pollution and field management labor, realize coordinated development and joint improvement of economic benefit and ecological benefit, and greatly research on the character of flowering as a plant in cotton and other species.

The PSAT2 gene belongs to the aspartate aminotransferase family and is currently rarely studied in plants. However, AST is known in short in human body and is mainly found in tissues such as cardiac muscle, liver and kidney of human beings. The AST is normally present in low levels in serum, which can be altered when the associated tissue is damaged. Therefore, most studies are conducted to determine whether or not the liver is damaged or not and the degree of damage based on the AST concentration in the serum.

In plants, in 1995, Gregory j.wadsworth cloned PSAT2 in soybean and demonstrated that it was able to encode the mitochondrial isozyme AAT4, which was first reported in dicotyledonous plants. AAT can catalyze reversible transfer of aspartate amino groups in oxaloacetate and glutamate, plants contain multiple AATs, the AATs in soybeans can be divided into five types according to different migration rates of the AATs in gel electrophoresis, and the five types are named from slow to fast as AAT1 to AAT5, and the AATs in the plants are proved to be capable of participating in metabolism.

Disclosure of Invention

The inventor clones cotton GHPSAT2 gene from upland cotton, constructs the over-expression vector of the gene, and transforms Arabidopsis thaliana and T by dipping method₃Transgenic Arabidopsis thaliana developed a phenotype of early flowering. Therefore, GHPSAT2 is considered to have a key role in promoting cotton flowering and can be used as a favorable gene resource for short-season cotton cultivation. Thus, the present invention has been completed.

The invention provides application of a GHPSAT2 gene in improving and promoting plant flowering, wherein the GHPSAT2 gene has a nucleotide sequence shown in SEQ ID No. 3. The open reading frame of the gene is 1263 bp.

In some embodiments of the invention, the nucleotide sequence shown as SEQ ID No.3 is capable of encoding the amino acid sequence shown as SEQ ID No. 4. The amino acid sequence comprises 420 amino acids, the relative molecular weight of the protein is 46.26kDa, and the isoelectric point is 8.52.

In some embodiments of the invention, the expression level of the GHPSAT2 gene is increased in a plant to promote flowering in the plant.

In some embodiments of the present invention, the increasing of the expression level of the GHPSAT2 gene in the plant is achieved by: increasing the expression of a plant endogenous GHPSAT2 gene, or overexpressing an exogenous GHPSAT2 gene in a plant.

In a specific embodiment of the present invention, the overexpression of the exogenous GHPSAT2 gene refers to the expression of the GHPSAT2 gene in a plant through agrobacterium-mediated transformation using a plant expression vector.

Further, the GHPSAT2 gene is introduced into a plant cell, tissue or organ via a plant expression vector.

Further, the plant expression vector drives expression of the GHPSAT2 gene through a constitutive or inducible promoter.

Still further, the constitutive promoter is a 35S promoter.

In the present invention, the promotion of flowering refers to promotion of the flowering phase of plants to be advanced.

In the present invention, the plant is cotton, corn, rice, wheat or Arabidopsis.

The invention has the advantages of

The arabidopsis thaliana plant with the GHPSAT2 gene transferred, which is obtained by a transgenic technology, enables the flowering time of arabidopsis thaliana to be remarkably advanced, and shows that the GHPSAT2 gene possibly has a key effect on promoting cotton flowering. The invention provides favorable gene resources for the cultivation of short-season cotton.

Drawings

FIG. 1 shows the PCR detection of the expression of the GHPSAT2 gene in transgenic Arabidopsis lines. WT was a non-transgenic Arabidopsis, 16, 18 and 55 were three transgenic Arabidopsis lines.

FIG. 2 shows the expression of GHPSAT2 gene in transgenic Arabidopsis lines by fluorescent quantitative PCR. WT was a non-transgenic Arabidopsis, 16, 18 and 55 were three transgenic Arabidopsis lines.

FIG. 3 shows the flowering phenotype of a transgenic Arabidopsis line. WT was a non-transgenic Arabidopsis, 16, 18 and 55 were three transgenic Arabidopsis lines.

Detailed Description

In order to make the technical problems, technical solutions and advantageous effects solved by the present invention more apparent, the present invention is further described in detail below with reference to the following embodiments.

Examples

The following examples are used herein to demonstrate preferred embodiments of the invention. It will be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function in the invention, and thus can be considered to constitute preferred modes for its practice. Those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit or scope of the invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and the disclosures and references cited herein and the materials to which they refer are incorporated by reference.

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

The reagent solutions mentioned but not listed here were prepared according to the method of the third edition of the molecular cloning instructions, and the biochemical reagents were analytically pure or of higher grade.

The materials, reagents and consumables, medicines, culture media and the like used by the invention are as follows:

1. cotton material

The cotton material selected in this example is Zhongmiao 50, and the Arabidopsis material is Columbia Wild Type (WT). All planted in the greenhouse, and the management measures are normal laboratory management.

2. Reagent and consumable

2.1 enzymes and kits: restriction enzyme, enzyme related to a PCR reaction system, a gel recovery kit (purchased from Beijing Quanji Biotechnology, Inc.), a plasmid miniextraction kit (purchased from Meiji Biotechnology Inc.), and a CTAB method DNA extraction related reagent.

2.2 other drugs: agarose is a Spanish original product, peptone, yeast extract, chloroform, isoamylol, ethanol, isopropanol, sodium chloride and the like are domestic analytical purities, kanamycin and the like are purchased from Bao bioengineering Dalian Co., Ltd, and Escherichia coli competent cell DH5 alpha is purchased from Beijing Tiangen Biochemical technology company.

2.3 culture Medium: LB liquid medium: 10g/L Tryptone (Tryptone), 5g/L Yeast extract (Yeast extract), and 10g/L sodium chloride (NaCl); LB solid medium: 10g/L of Tryptone (Tryptone), 5g/L of Yeast extract (Yeast extract), 10g/L of sodium chloride (NaCl) and 15g/L of Agar powder (Agar), and the volume is fixed to 1L; LB selective medium: before LB plate, adding antibiotic with corresponding concentration when the culture medium is sterilized under high pressure and cooled to 55 deg.C, shaking up and plating. 1/2MS solid culture medium: 1/2MS 22g/L, agar powder (agar powder)8g/L, sucrose (sucrose)30 g/L.

2.4 Main instruments: : PCR amplification apparatus (BIO-RAD), high speed centrifuge (Hettich MIKRO 200R), electrophoresis apparatus (BIO-RAD), gel imaging system (BIO-RAD), fluorescence quantitative PCR apparatus (ABI7500), electric heating constant temperature incubator (Shanghai Sensin), constant temperature culture oscillator (Shanghai Zhicheng), artificial climate test chamber (Saifu), and artificial climate chamber.

Example construction of the PBI121-GhPSAT2 expression vector

1 obtaining GhPSAT2(Gh _ D07G1721) gene sequence from CottonFGD, designing primer by Oligo7 software, amplifying from Gossypium hirsutum No. 50 by PCR method, wherein the CDS sequence is 1263bp long, codes 420 amino acids, the relative molecular weight of protein is 46.26213kDa, and the isoelectric point is 8.52.

The amplification primers were as follows:

upstream primer F (SEQ ID No. 1): 5'-ATGGCAGCAACATCTCTAAAT-3'

Downstream primer R (SEQ ID No. 2): 5'-TCAAGCATGCTTTGCCTGGAA-3'

The open reading frame sequence is (SEQ ID No. 3):

ATGGCAGCAACATCTCTAAATGCCCCTAACGCTCCTCTCCTTCAAAAGACCCATCAAACTCATGTCTTTCTCAAACCCATCTCCACCATTCCTTGTCAAACCTCTGCCAAGCGCTTCTCCATCTCTTGTTCCGCAACTACCCAAGATCGCCTCTCCGTCCAATCCCAATCTCAAGATCGGGTCTTTAACTTCGCCGCCGGTCCCGCCACCTTACCCGAGAACGTCCTCCTCAAAGCCCAATCCGAGCTTTACAACTGGCACGGATCTGGCATGAGCGTTATGGAAATGAGCCACCGTGGTAAGGATTTCCGTTCTATTATCGAAAAAGCCGAGGCCGATCTCCGTTCTCTTCTCAACATCCCTGAAAACTACGCCGTTTTGTTCCTCCAAGGTGGAGCCACCACCCAGTTCGCTGCTGTCCCTTTGAATCTCTGTGCCCCAGGTGACTCCGTTGATTATCTTGTTACTGGATCTTGGGGAGACAAGGCTTTCAAAGAAGCTAAGAAATACTGCAACCCCAAAGTCATTTGGAGTGGGAAATCGGAGAACTACGTCAGGGTTCCCTCGTTCGATGGTTTAGAACTGAACCCGAATGCCAAGTATTTGCATATATGCGCCAATGAGACCATTTACGGGGTTGAGTTCAAGGACTACCCAGTTCCCCGCAATCCAAATGGGGTTCTTGTTGCTGATATGTCTTCCAATTTTTGTTCCAAACCTGTTGATGTAACCAAGTTTGGGTTGATTTATGCTGGTGCGCAGAAGAATGTGGGGCCATCCGGGGTTTGCATCGTGATCGTGAGGAAGGATCTTCTAGGAAATGCACAAGAGAGTACCCCTGTGATGCTTGATTACAAGATCCACGCCGACAACAACTCTTTGTACAACACACCTCCATGTTATGGGATTTATATGTGCGGGCTGGTGTTTGAAGACCTTTTGAAGCAGGGAGGACTGGAAGAGGTTGAGAAGAAGAACCAAAAGAAAGCTGGTATATTGTACAATGCCATCGATGAAAGCAAAGGATTCTACAGGTGCCCTGTTGAGAAATCTGTAAGGTCGCTGATGAATGTTCCATTCACATTGGAGAAGTCAGAGTTGGGTGCTGAGTTTTTAAAGGAAGCCGAGAAGGAGAAGATGGTGCAGCTCAAGGGACATAGGTCGGTGGGAGGCATGCGAGCTTCCATTTATAATGCTATGCCTTTGGCTGGAGTTGAGAAGTTGGTTGCTTTCATGAAGGATTTCCAGGCAAAGCATGCTTGA

the encoded amino acid sequence is (SEQ ID No. 4):

MAATSLNAPNAPLLQKTHQTHVFLKPISTIPCQTSAKRFSISCSATTQDRLSVQSQSQDRVFNFAAGPATLPENVLLKAQSELYNWHGSGMSVMEMSHRGKDFRSIIEKAEADLRSLLNIPENYAVLFLQGGATTQFAAVPLNLCAPGDSVDYLVTGSWGDKAFKEAKKYCNPKVIWSGKSENYVRVPSFDGLELNPNAKYLHICANETIYGVEFKDYPVPRNPNGVLVADMSSNFCSKPVDVTKFGLIYAGAQKNVGPSGVCIVIVRKDLLGNAQESTPVMLDYKIHADNNSLYNTPPCYGIYMCGLVFEDLLKQGGLEEVEKKNQKKAGILYNAIDESKGFYRCPVEKSVRSLMNVPFTLEKSELGAEFLKEAEKEKMVQLKGHRSVGGMRASIYNAMPLAGVEKLVAFMKDFQAKHA

2 the process of cloning genes specifically is as follows:

2.1 sampling method

In the full-bloom stage of cotton, mature cotton leaves are taken, quickly frozen in liquid nitrogen and stored in a refrigerator at minus 80 ℃ for later use.

2.2 extraction of RNA

All centrifugation steps below were performed at room temperature.

1) And (3) homogenizing treatment: 100mg of plant leaves were rapidly ground to a powder in liquid nitrogen, 700. mu.L SL (beta-mercaptoethanol added before use) was added and the sample was mixed by shaking vigorously immediately.

2) Centrifuge at 12,000rpm for 2 min.

3) The supernatant was transferred to the filtration column CS and centrifuged at 12,000rpm for 2min, and the supernatant from the collection tube was carefully pipetted into a new RNase-Free centrifuge tube, the tip being kept from touching the cell debris in the collection tube.

4) Adding 0.4 times volume of anhydrous ethanol, mixing, transferring the mixture into adsorption column CR3, centrifuging at 12,000rpm for 15sec, discarding the waste liquid in the collection tube, and returning the adsorption column CR3 to the collection tube.

5) 350. mu.L of deproteinizing solution RW1 was added to the adsorption column CR3, and centrifuged at 12,000rpm for 15sec, thereby discarding the waste liquid in the collection tube and returning the adsorption column CR3 to the collection tube.

6) DNaseI working solution: mix gently 10. mu.l DNaseI stock and 70. mu.L RDD solution.

7) 80. mu.L of DNaseI working solution was added to CR3 and allowed to stand at room temperature for 15 min.

8) After standing, 350. mu.l of deproteinizing solution RW1 was added to CR3, centrifuged at 12,000rpm for 15sec, the waste liquid in the collection tube was discarded, and the adsorption column CR3 was returned to the collection tube.

9) To the adsorption column CR3, 500. mu.L of rinsing solution RW (ethanol was added before use), centrifuged at 12,000rpm for 15sec, the waste liquid in the collection tube was discarded, and the adsorption column CR3 was returned to the collection tube.

10) Step 9 is repeated.

11) Centrifuging at 12,000rpm (13,400 Xg) for 2min, placing adsorption column CR3 into a new RNase-Free centrifuge tube, and dripping 30-50 μ L of RNase-Free H into the middle part of the adsorption membrane₂O, left at room temperature for 2min, and centrifuged at 12,000rpm (. about.13,400 Xg) for 1min to obtain an RNA solution.

Note that: the volume of elution buffer should not be less than 30. mu.L, and too small a volume affects the recovery efficiency. The RNA samples were stored at-70 ℃. If the expected RNA yield is more than 30. mu.g, the RNA solution obtained by centrifugation in step 11 may be added to an adsorption column CR3, and left at room temperature for 2min and centrifuged at 12,000rpm (. about.13,400 Xg) for 1min to obtain an RNA solution.

To prevent RNase contamination, precautions:

1) the gloves are often replaced with new ones. Because the skin is often bacteria-bearing, RNase contamination may result;

2) the RNase-free plastic product and the gun head are used to avoid cross contamination;

3) RNA is not degraded by RNase while in lysate SL. However, after extraction, plastics and glassware without RNase should be used in the further processing.

4) The preparation solution should use RNase-Free ddH₂O。

2.3 reverse transcription

The reverse transcription method of RNA is carried out according to the instruction of a reverse transcription kit 6210A adopting TaKaRa, and the system is configured on ice, and the specific operation is as follows:

keeping the temperature at 65 ℃ for 5min, rapidly cooling on ice, and preparing the following system:

slowly mixing the mixture evenly.

45min at 45 ℃ (reverse transcription);

15min at 70 ℃ (inactivation reaction of reverse transcriptase);

4℃∞。

the reverse transcription product cDNA solution was diluted 8-fold as a template for PCR reaction.

2.4 PCR reaction System, procedure and product detection for Gene cloning

The enzyme cutting sites used were BamH I (GGATCC) and Sac I (GAGCTC).

The sequence of the adaptor-added primers (containing the restriction sites BamH I and Sac I) was synthesized as follows:

upstream primer F (SEQ ID No. 5):

5'-CACGGGGGACTCTAGAGGATCCATGGCAGCAACATCTCTAAAT-3'

downstream primer R (SEQ ID No. 6):

5'-GATCGGGGAAATTCGAGCTCTCAAGCATGCTTTGCCTGGAA-3'

1) PCR reaction system

According to the PrimeSTAR GXL DNA polymerase instructions, the PCR reaction system is as follows:

2) PCR reaction procedure

3) Detection of PCR products

And (3) taking 2 mu L of PCR product, adding 2 mu L of 6 Xloading Buffer, mixing uniformly, spotting on 1% agarose gel, and carrying out electrophoresis detection.

2.5 gel recovery of PCR products

1) Cutting the band to be recovered from the electrophoresis gel under an ultraviolet lamp, paying attention to the fact that the blade needs to be disinfected, and enabling the gel block to be small as much as possible and to be easy to melt completely;

2) weighing an Eppendorf tube in advance, then putting the rubber block in the tube, and weighing again to obtain the weight of the rubber block;

3) adding Binding Buffer in an amount of 300 mu L per 100mg of the rubber block, and checking whether the rubber block is soaked in the liquid;

4) water bath at 55 deg.C for 10min to melt the gel block and release DNA, and taking out every 2-3min during the period and shaking;

5) after the rubber blocks are completely melted, adding isopropanol in an amount of 150 mu L per 100mg of rubber blocks, and fully shaking and uniformly mixing;

6) mounting a High Pure Filter Tube on a Collection Tube;

7) transferring all the liquid in the Eppendorf tubes into a High Pure Filter Tube, taking care that the volume does not exceed 700 mu L, and if the volume exceeds the volume, centrifuging twice;

8) centrifuging at 12,000rpm for 1min, and pouring out liquid in the collecting pipe;

9) adding 500 μ L of Wash Buffer, and centrifuging for 1min again;

10) pouring out the liquid in the collecting pipe, adding 200 mu L of Wash Buffer again, and centrifuging at 12,000rpm for 1 min;

11) carefully taking down the Filter Tube and then loading the Tube into a new Effendorf Tube;

12) mu.L of Elution Buffer was added to the center of the filter element, and the mixture was left at room temperature for 1min and centrifuged at 12,000rpm for 1 min.

2.6 double digestion of PBI121 vector

The following system was configured as per the instructions:

incubating at 37 deg.C for 30min, adding 10 μ L of 6 × Loading Buffer, mixing, spotting in 1% agarose gel electrophoresis for detection, recovering gel, and measuring concentration.

2.7 connection

Ligation of the gel recovery product with a linearized expression vector according to Vazyme, using a method of homologous recombination

II One Step Cloning KitC112, the following reaction system was set up on ice:

incubate at 37 ℃ for 30min and cool rapidly on ice for 5 min.

2.8 transformation of Escherichia coli

Melting 100. mu.L of Escherichia coli DH 5. alpha. on ice, adding 10. mu.L of the ligation product, and ice-cooling for 30 min;

heat shock is carried out on the water bath at 42 ℃ for 45 sec;

immediately carrying out ice bath for 2 min; adding 900 μ L LB liquid culture medium, incubating at 37 deg.C and 150rpm for 1 h;

centrifuging to collect bacteria, centrifuging at4,000 rpm for 3min, discarding the supernatant, leaving about 100 μ L, mixing, and spreading on a Carna-resistant LB plate;

culturing at 37 deg.C overnight;

detection and sequencing of positive clones:

1) picking white colonies from the transformation plate, putting the white colonies into a liquid LB culture medium containing Kan, and carrying out shake culture at the constant temperature of 37 ℃ for 8 hours;

2) the colony PCR verifies positive clone, and the single clone which is verified to be correct is sent to Jinweizhi biological technology limited company for sequencing, and each sequence is sequenced for 3 times.

2.9 preservation of Positive bacterial liquid

And adding a certain amount of glycerol into the bacterial liquid which is subjected to PCR verification and sequencing to ensure that the final concentration of the glycerol is about 20 percent and storing the glycerol at-80 ℃.

2.10 extracting positive bacteria plasmid according to the kit instruction, the steps are as follows:

1) inoculating the strain containing the plasmid into a 10-20mL culture tube containing 1-5 mL LB/antibiotic culture solution, and performing shake culture at 37 ℃ for 12-16 h.

2) Centrifuging at 10,000 Xg for 1min, and collecting 1-5 mL of the thallus.

3) The medium was discarded and the residue was removed by gently tapping on absorbent paper. Add 250. mu.L of Buffer P1/RNaseA mixture and resuspend the bacteria by vortexing at high speed.

RNase A was guaranteed to have been added to Buffer P1 before use. Thorough resuspension of the bacteria is critical to yield and no clumping of bacteria should be visible after resuspension.

4) 250 mu.L of Buffer P2 was added to the resuspension solution, and the mixture was inverted and mixed 8-10 times. Mix by gentle inversion. Vortex can cause genomic DNA contamination. The solution became viscous and clear indicating that the bacteria had lysed sufficiently. If necessary, the mixture was left at room temperature for 2min, and mixed by inversion several times. When processing multiple samples, the operation time of this step is not more than 4 min.

5) 350 μ L of Buffer P3 was added and the solution was neutralized thoroughly by immediately inverting 8-10 times. The mixture should be inverted immediately after the Buffer P3 is added to prevent the precipitate from agglomerating and affecting the neutralization effect.

6) Centrifuge at 13,000 Xg for 10 min.

7) HiPure DNA Mini Column II was loaded into collection tubes. Carefully transfer the supernatant to the column. Centrifuging at 13,000 Xg for 30-60 sec.

8) The filtrate was decanted and the column was returned to the collection tube. Add 500. mu.L of Buffer PW1 to the column. Centrifuging at 13,000 Xg for 30-60 sec.

9) The filtrate was decanted and the column was returned to the collection tube. 600 μ L of Buffer PW2 (diluted with absolute ethanol) was added to the column. Centrifuging at 13,000 Xg for 30-60 sec.

10) The filtrate was decanted and the column was returned to the collection tube. 600 μ L of Buffer PW2 (diluted with absolute ethanol) was added to the column. Centrifuging at 13,000 Xg for 30-60 sec.

11) The filtrate was decanted and the column was returned to the collection tube. The column was dried by centrifugation at 13,000 Xg for 1 min.

12) The column was fitted into a sterile 1.5mL centrifuge tube. Add 30-100. mu.L of Elution Buffer to the center of the membrane of the column. The mixture was left standing for 1min and centrifuged at 13,000 Xg for 1min to elute the DNA.

The lowest elution volume of the column was 30. mu.L. Less than 30. mu.L results in a decrease in elution efficiency. 30 μ L eluted 60-70% of plasmid DNA. 80-85% of the plasmid DNA can be eluted at 50. mu.L. If it is desired to obtain the highest yield, step 12 may be repeated for the second elution.

13) The column was discarded and the plasmid was stored at-20 ℃.

2.11 plasmid transformation of LBA4404 Agrobacterium competence

1) The agrobacterium tumefaciens stored at the temperature of minus 80 ℃ is taken to be in a sensitive state at room temperature or palm for a moment until part of the agrobacterium tumefaciens is melted, and the agrobacterium tumefaciens is inserted into ice when the agrobacterium tumefaciens is in an ice-water mixed state.

2) 0.01-1 mu g of plasmid DNA (the transformation efficiency is high, the amount of the added plasmid is preferably determined by a preliminary experiment before the first use) is added into each 100 mu L of competence, the mixture is stirred uniformly by hands at the bottom of a tube, and is kept stand on ice for 5min, liquid nitrogen for 5min, water bath at 37 ℃ for 5min and ice bath for 5min in sequence.

3) Adding 700 mu L of LB or YEB liquid culture medium without antibiotics, and carrying out shake culture at 28 ℃ for 2-3 h.

4) Centrifuging at 6,000rpm for 1min to collect bacteria, collecting supernatant of about 100 μ L, lightly blowing to remove heavy suspended bacteria, spreading on LB or YEB plate containing corresponding antibiotics, and culturing in 28 deg.C incubator for 2-3 days (when the plate only contains 50 μ g/mL Kan, culturing at 28 deg.C for 48 hr); adding Kan 50 μ g/mL and Rif 20 μ g/μ L into the plate at the same time, culturing at 28 deg.C for 60 h; if the plate used contains 50. mu.g/mL Rif it requires incubation at 28 ℃ for 72-90 h).

5) Selecting clone, culturing on LB liquid culture medium containing kanamycin, streptomycin and rifampicin at 28 deg.C for 48h, performing colony PCR, and storing glycerol at-20 deg.C to obtain final product with concentration of 15%.

EXAMPLE 2 Agrobacterium-mediated transformation of Arabidopsis

Transformation of Arabidopsis thaliana by inflorescence dip-dyeing

1) Inoculating 20 μ L of Agrobacterium liquid stored at-20 deg.C into 1mL LB liquid culture medium, performing shaking culture at 28 deg.C and 180rpm overnight, adding 200 μ L of activated bacteria liquid into 50mL LB liquid culture medium, performing shaking culture at 28 deg.C and 180 rpm.

2) OD of bacterial liquid to be treated₆₀₀When the value was about 1.2, the cells were centrifuged at5,000 rpm for 5min to collect the cells.

3) Discarding the supernatant, and reselecting the bacterial liquid with 50-70ml of transformation medium to make OD₆₀₀The infection starts after the value is 0.8-1.0 (the formula of the transformation medium is 0.217g 1/2MS, 5g sucrose, 100mL water is dissolved and 20 mu Lsilwet L-77 is added).

4) Selecting non-flowering Arabidopsis, horizontally placing Arabidopsis inflorescence in a transformation medium for 30-50s, culturing in dark for one day, and culturing under normal conditions.

5) After the seeds are mature, the seeds are harvested and are T₀And (5) seed generation.

Example 3 phenotypic characterization of transgenic Arabidopsis plants

1. The harvested seeds are sterilized and planted on 1/2MS containing kanamycin, then low-temperature treatment is carried out for 3 days at4 ℃, the seeds are transferred to a climatic test box, positive plants grow normally in about 10 days, and negative plants become yellow in leaves and do not grow any more.

2. And transplanting the positive arabidopsis thaliana plant into a small flowerpot for planting, extracting DNA after the plant grows for one month, and detecting by using PCR (polymerase chain reaction), wherein primers used in detection are SEQ ID No.5 and SEQ ID No. 6. The results show (FIG. 1) that significant bands could be amplified in transgenic Arabidopsis lines, whereas wild type Arabidopsis lines could not.

3. The plants of each generation are tested for positive lines until they are propagated to T₃And generating a homozygous transgenic arabidopsis line. T is₃qRT-PCR detection is carried out on the strain generation, and the process of fluorescent quantitative verification is as follows:

extracting RNA, performing reverse transcription to form cDNA, and respectively designing primers for performing fluorescence quantification on GhPSAT2 and an Arabidopsis thaliana internal reference gene AtUBQ 1:

GhPSAT2

upstream primer (SEQ ID No. 7): 5'-GACTACCCAGTTCCCCGCAATC-3'

Downstream primer (SEQ ID No. 8): 5'-AAAGAGTTGTTGTCGGCGTGGA-3'

AtUBQ1

Upstream primer (SEQ ID No. 9): 5'-TGAGCCTTCCTTGATGATGCT-3'

Downstream primer (SEQ ID No. 10): 5'-GCACTTGCGGCAAATCATCT-3'

And (3) preparing a qRT-PCR reaction system on ice, and carrying out fluorescent quantitative PCR reaction.

The PCR reaction system is as follows:

PCR reaction procedure:

analysis of melting curves

The fluorescent quantitative verification result proves that the GhPSAT2 gene has very low expression in WT and higher expression level in transgenic plants, which is obviously higher than that of non-transgenic Arabidopsis thaliana, as shown in figure 2.

Transgenic T₃The generation plants and the non-transgenic plants are planted and cultivated under the same conditions, and the transgenic arabidopsis flowers in advance as shown in figure 3. As can be seen, the arabidopsis line grafted with the GhPSAT2 gene obviously blooms earlier than the wild arabidopsis, which indicates that the GhPSAT2 gene can promote arabidopsis to bloom earlier.

The results also prove that the GhPSAT2 gene may play a key role in promoting cotton flowering and can be used as a favorable gene resource for short-season cotton cultivation.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Cotton research institute of Chinese academy of agricultural sciences, Shandong Zhongli Cotton science and technology Co., Ltd

Application of <120> cotton GHPSAT2 gene in promoting flowering of plants

<130> XY-2019-1-W-086

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggcagcaa catctctaaa t 21

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tcaagcatgc tttgcctgga a 21

<210> 3

<211> 1263

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggcagcaa catctctaaa tgcccctaac gctcctctcc ttcaaaagac ccatcaaact 60

catgtctttc tcaaacccat ctccaccatt ccttgtcaaa cctctgccaa gcgcttctcc 120

atctcttgtt ccgcaactac ccaagatcgc ctctccgtcc aatcccaatc tcaagatcgg 180

gtctttaact tcgccgccgg tcccgccacc ttacccgaga acgtcctcct caaagcccaa 240

tccgagcttt acaactggca cggatctggc atgagcgtta tggaaatgag ccaccgtggt 300

aaggatttcc gttctattat cgaaaaagcc gaggccgatc tccgttctct tctcaacatc 360

cctgaaaact acgccgtttt gttcctccaa ggtggagcca ccacccagtt cgctgctgtc 420

cctttgaatc tctgtgcccc aggtgactcc gttgattatc ttgttactgg atcttgggga 480

gacaaggctt tcaaagaagc taagaaatac tgcaacccca aagtcatttg gagtgggaaa 540

tcggagaact acgtcagggt tccctcgttc gatggtttag aactgaaccc gaatgccaag 600

tatttgcata tatgcgccaa tgagaccatt tacggggttg agttcaagga ctacccagtt 660

ccccgcaatc caaatggggt tcttgttgct gatatgtctt ccaatttttg ttccaaacct 720

gttgatgtaa ccaagtttgg gttgatttat gctggtgcgc agaagaatgt ggggccatcc 780

ggggtttgca tcgtgatcgt gaggaaggat cttctaggaa atgcacaaga gagtacccct 840

gtgatgcttg attacaagat ccacgccgac aacaactctt tgtacaacac acctccatgt 900

tatgggattt atatgtgcgg gctggtgttt gaagaccttt tgaagcaggg aggactggaa 960

gaggttgaga agaagaacca aaagaaagct ggtatattgt acaatgccat cgatgaaagc 1020

aaaggattct acaggtgccc tgttgagaaa tctgtaaggt cgctgatgaa tgttccattc 1080

acattggaga agtcagagtt gggtgctgag tttttaaagg aagccgagaa ggagaagatg 1140

gtgcagctca agggacatag gtcggtggga ggcatgcgag cttccattta taatgctatg 1200

cctttggctg gagttgagaa gttggttgct ttcatgaagg atttccaggc aaagcatgct 1260

tga 1263

<210> 4

<211> 420

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Met Ala Ala Thr Ser Leu Asn Ala Pro Asn Ala Pro Leu Leu Gln Lys

1 5 10 15

Thr His Gln Thr His Val Phe Leu Lys Pro Ile Ser Thr Ile Pro Cys

20 25 30

Gln Thr Ser Ala Lys Arg Phe Ser Ile Ser Cys Ser Ala Thr Thr Gln

35 40 45

Asp Arg Leu Ser Val Gln Ser Gln Ser Gln Asp Arg Val Phe Asn Phe

50 55 60

Ala Ala Gly Pro Ala Thr Leu Pro Glu Asn Val Leu Leu Lys Ala Gln

65 70 75 80

Ser Glu Leu Tyr Asn Trp His Gly Ser Gly Met Ser Val Met Glu Met

85 90 95

Ser His Arg Gly Lys Asp Phe Arg Ser Ile Ile Glu Lys Ala Glu Ala

100 105 110

Asp Leu Arg Ser Leu Leu Asn Ile Pro Glu Asn Tyr Ala Val Leu Phe

115 120 125

Leu Gln Gly Gly Ala Thr Thr Gln Phe Ala Ala Val Pro Leu Asn Leu

130 135 140

Cys Ala Pro Gly Asp Ser Val Asp Tyr Leu Val Thr Gly Ser Trp Gly

145 150 155 160

Asp Lys Ala Phe Lys Glu Ala Lys Lys Tyr Cys Asn Pro Lys Val Ile

165 170 175

Trp Ser Gly Lys Ser Glu Asn Tyr Val Arg Val Pro Ser Phe Asp Gly

180 185 190

Leu Glu Leu Asn Pro Asn Ala Lys Tyr Leu His Ile Cys Ala Asn Glu

195 200 205

Thr Ile Tyr Gly Val Glu Phe Lys Asp Tyr Pro Val Pro Arg Asn Pro

210 215 220

Asn Gly Val Leu Val Ala Asp Met Ser Ser Asn Phe Cys Ser Lys Pro

225 230 235 240

Val Asp Val Thr Lys Phe Gly Leu Ile Tyr Ala Gly Ala Gln Lys Asn

245 250 255

Val Gly Pro Ser Gly Val Cys Ile Val Ile Val Arg Lys Asp Leu Leu

260 265 270

Gly Asn Ala Gln Glu Ser Thr Pro Val Met Leu Asp Tyr Lys Ile His

275 280 285

Ala Asp Asn Asn Ser Leu Tyr Asn Thr Pro Pro Cys Tyr Gly Ile Tyr

290 295 300

Met Cys Gly Leu Val Phe Glu Asp Leu Leu Lys Gln Gly Gly Leu Glu

305 310 315 320

Glu Val Glu Lys Lys Asn Gln Lys Lys Ala Gly Ile Leu Tyr Asn Ala

325 330 335

Ile Asp Glu Ser Lys Gly Phe Tyr Arg Cys Pro Val Glu Lys Ser Val

340 345 350

Arg Ser Leu Met Asn Val Pro Phe Thr Leu Glu Lys Ser Glu Leu Gly

355 360 365

Ala Glu Phe Leu Lys Glu Ala Glu Lys Glu Lys Met Val Gln Leu Lys

370 375 380

Gly His Arg Ser Val Gly Gly Met Arg Ala Ser Ile Tyr Asn Ala Met

385 390 395 400

Pro Leu Ala Gly Val Glu Lys Leu Val Ala Phe Met Lys Asp Phe Gln

405 410 415

Ala Lys His Ala

420

<210> 6

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cacgggggac tctagaggat ccatggcagc aacatctcta aat 43

<210> 6

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gatcggggaa attcgagctc tcaagcatgc tttgcctgga a 41

<210> 7

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gactacccag ttccccgcaa tc 22

<210> 8

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aaagagttgt tgtcggcgtg ga 22

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tgagccttcc ttgatgatgc t 21

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gcacttgcgg caaatcatct 20

Claims (8)

1. The application of the GHPSAT2 gene in promoting plant flowering is characterized in that the nucleotide sequence of the GHPSAT2 gene is shown as SEQ ID No.3, and the plant is cotton or arabidopsis thaliana.
2. 2. The use according to claim 1, wherein the nucleotide sequence shown as SEQ ID No.3 is capable of encoding the amino acid sequence shown as SEQ ID No. 4.
3. 3. Use according to any one of claims 1 or 2, characterized in that: the expression level of the GHPSAT2 gene is increased in the plant so as to promote the plant to bloom.
4. 4. The use according to claim 3, wherein the increase in the expression level of the GHPSAT2 gene in the plant is achieved by: increasing the expression of a plant endogenous GHPSAT2 gene, or overexpressing an exogenous GHPSAT2 gene in a plant.
5. 5. The use as claimed in claim 4, wherein the overexpression of exogenous GHPSAT2 gene is achieved by Agrobacterium-mediated transformation of GHPSAT2 gene into plant using plant expression vector.
6. 6. The use as claimed in claim 5 wherein the GHPSAT2 gene is introduced into a plant cell, tissue or organ via a plant expression vector.
7. 7. The use according to claim 6, wherein said plant expression vector drives expression of said GHPSAT2 gene through a constitutive or inducible promoter.
8. 8. Use according to claim 7, wherein the constitutive promoter is the 35S promoter.

Images