CN111304291B

CN111304291B - DNA extraction reagent, kit and extraction method

Info

Publication number: CN111304291B
Application number: CN202010235846.9A
Authority: CN
Inventors: 郑乔松; 王曼; 张凯华; 王思振
Original assignee: Genetron Health Beijing Co ltd
Current assignee: Genetron Health Beijing Co ltd
Priority date: 2020-03-30
Filing date: 2020-03-30
Publication date: 2022-04-19
Anticipated expiration: 2040-03-30
Also published as: CN111304291A

Abstract

The invention discloses a DNA extraction reagent, a kit and an extraction method. The invention firstly provides a DNA extraction reagent, which comprises lysis solution, rinsing solution 1, rinsing solution 2 and eluent, wherein the lysis solution comprises guanidine isothiocyanate, Tris-HCl, EDTA, NaCl, SDS and protease inhibitor. The invention further provides a kit containing the DNA extraction reagent and a method for extracting DNA by using the DNA extraction reagent or the kit. The DNA extraction method is rapid, simple and convenient, is beneficial to the crushing of fresh tissues or frozen tissues, is particularly suitable for rapid operation in operations, has low relative extraction cost and high quality of extracted nucleic acid, and can meet the requirements of detection such as qPCR, NGS, SNP typing and the like.

Description

DNA extraction reagent, kit and extraction method

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a DNA extraction reagent, a kit and an extraction method.

Background

Nucleic acid amplification and detection techniques are widely used, particularly in the fields of disease diagnosis, detection of microorganisms and pathogenic agents, and the like. In the field of disease diagnosis, with the advent of the era of precision medicine, genetic testing technology is a necessary technological means in the aspects of genetic disease diagnosis, prenatal testing, molecular typing, personalized medicine application and the like. In diagnostic procedures, nucleic acid analysis has many advantages over traditional methods, such as enzymatic or antibody analysis, with high sensitivity, flexibility and short time.

In the diagnostic process, nucleic acid extraction and purification are the basis of nucleic acid detection, and the quality of the extracted and purified nucleic acid has important influence on the accuracy of the detection result. At present, the commonly used extraction method for releasing biological nucleic acid comprises: alkaline lysis, phenol extraction, silica gel membrane centrifugation column, magnetic bead method, etc. Wherein, the alkaline cracking method generally adopts corrosive sodium hydroxide for modification and then uses acid for neutralization and precipitation; the phenol extraction method has complex steps, and adopts organic solvents such as phenol, chloroform and the like for extraction, so that the chemical toxicity is high; the magnetic bead method adopts a magnetic bead adsorption and solvent elution method to extract DNA, a magnetic sleeve and a magnet are required to be used for adsorption in the operation process, the operation flux is limited, and the operation is usually completed by means of a full-automatic magnetic bead extraction instrument; the silica gel membrane centrifugal column adopts a macromolecule resin membrane to intercept and purify DNA, and the whole process needs to be repeatedly centrifuged at high speed and the tube is replaced, so that the time is long.

The major bottleneck in the widespread adoption of molecular diagnostics in medical laboratories today is the requirement to purify nucleic acids from samples: the commercial biological nucleic acid DNA release extraction kit generally adopts a silica gel membrane centrifugal column and a magnetic bead method, has complex operation process and long time consumption, needs at least 1.5 hours, is not beneficial to rapid detection, and particularly detection in disease (cancer) treatment operations, so that a nucleic acid extraction method which is simple, convenient, rapid and high in quality is urgently needed to be developed.

Disclosure of Invention

The technical problem to be solved by the invention is how to find a method for simply, conveniently and quickly extracting high-quality DNA.

In order to solve the technical problems, the invention firstly provides a DNA extraction reagent.

The DNA extraction reagent comprises a lysis solution, wherein the lysis solution comprises guanidinium isothiocyanate with the concentration of 4-6mol/L, Tris-HCl with the concentration of 40-60mmol/L, EDTA with the concentration of 5-20mmol/L, NaCl with the concentration of 120-160mmol/L, Triton X-100 with the volume percentage of 1-1.3%, SDS with the mass percentage of 0.05-0.15% and a protease inhibitor with the concentration of 3-8 mu g/ml.

The volume percentage content is the volume percentage content of solute in the solution, namely the volume percentage content of TritonX-100 in the lysis solution is 1-1.3%; the mass percentage is the mass content of the solute in the solution, namely the mass content of SDS in the lysate is 0.05-0.15%.

Optionally, the concentration of guanidinium isothiocyanate is 4mol/L, 5mol/L or 6mol/L, the concentration of Tris-HCl is 40mmol/L, 45mmol/L, 50mmol/L, 55mmol/L or 60mmol/L, the concentration of EDTA is 5mmol/L, 8mmol/L, 10mmol/L, 12mmol/L, 15mmol/L, 17mmol/L or 20mmol/L, the concentration of NaCl is 120mmol/L, 130mmol/L, 140mmol/L, 150mmol/L or 160mmol/L, the volume percentage of triton x-100 is 1%, 1.1%, 1.2% or 1.3%, and the mass percentage of SDS is 0.05%, 0.1% or 0.15%; the concentration of the protease inhibitor is 3 mug/ml, 5 mug/ml or 8 mug/ml.

Wherein, optionally, the protease inhibitor is Aprotinin (Aprotinin).

The lysis solution also comprises a solvent, wherein the solvent is water.

The DNA extraction reagent also comprises a rinsing liquid 1 and a rinsing liquid 2;

wherein the content of the first and second substances,

the pH values of the rinsing liquid 1 and the rinsing liquid 2 are both 6-8,

the rinsing liquid 1 comprises guanidine hydrochloride with the concentration of 6-8mol/L, Tris-HCl with the concentration of 20-30mmol/L and ethanol with the volume percentage content of 45-55%;

the rinsing liquid 2 comprises NaCl with the concentration of 100-200mmol/L, Tris-HCl with the concentration of 15-25mmol/L and ethanol with the volume percentage of 70-80%.

In particular, it is possible, alternatively,

in the rinsing liquid 1, the concentration of the guanidine hydrochloride is 6mol/L, 7mol/L or 8mol/L, the concentration of the Tris-HCl is 20mmol/L, 25mmol/L or 30mmol/L, and the volume percentage of the ethanol is 45%, 50% or 55%;

in the rinsing liquid 2, the concentration of NaCl is 100mmol/L, 150mmol/L or 200mmol/L, the concentration of Tris-HCl is 15mmol/L, 20mmol/L or 25mmol/L, and the volume percentage content of ethanol is 70%, 75% or 80%.

The DNA extraction reagent also comprises an eluent which is water without nuclease.

The invention also provides a DNA extraction reagent which consists of the lysate, the rinsing solution 1, the rinsing solution 2 and the eluent.

The invention further provides a DNA extraction kit containing the DNA extraction reagent.

The kit of the invention comprises the DNA extraction reagent and a centrifugal column.

Specifically, the centrifugal column is a silica gel adsorption membrane centrifugal column.

The application of the DNA extraction reagent or the DNA extraction kit in DNA extraction is also within the protection scope of the invention.

The invention further provides a method for extracting DNA.

The method for extracting the DNA comprises the following steps:

adding the lysis solution into an extracted sample for crushing, centrifuging after crushing, and taking supernatant;

transferring the supernatant to a centrifugal column and then centrifuging;

adding the rinsing liquid 1 into a centrifugal column, centrifuging, and removing filtrate;

adding the rinsing liquid 2 into a centrifugal column, centrifuging, and removing the filtrate;

and adding the eluent into a centrifugal column, centrifuging, and collecting filtrate to obtain the DNA.

In the above extraction method, the centrifugation after the disruption is a centrifugation immediately after the disruption.

In the above extraction method, the sample may be tissue, saliva, urine or blood (such as leukocyte).

In particular, the tissue may be frozen tissue or fresh tissue.

In the extraction method, the mass-volume ratio of the extracted sample to the lysate is 1mg:20-50 muL.

Optionally, the extraction method specifically includes:

adding the lysis solution and glass beads into the extracted sample, crushing for 1min, centrifuging, and collecting supernatant; the centrifugation conditions were: the rotating speed is 14000rpm and the time is 1 min;

transferring the supernatant to a centrifugal column, centrifuging, and replacing a new collecting pipe; the centrifugation conditions were: the rotating speed is 14000rpm and the time is 15 s;

adding the rinsing liquid 1 into a centrifugal column, centrifuging, and replacing a new collecting pipe; the centrifugation conditions were: the rotating speed is 14000rpm and the time is 15 s;

adding the rinsing liquid 2 into a centrifugal column, centrifuging, and replacing a new collecting pipe; the centrifugation conditions were: the rotating speed is 14000rpm and the time is 15 s;

adding the eluent into a centrifugal column, centrifuging, and collecting filtrate to obtain DNA; the centrifugation conditions were: the rotation speed was 14000rpm and the time was 30 seconds.

The DNA extraction method is rapid, simple and convenient, is beneficial to the crushing of fresh tissues or frozen tissues, is particularly suitable for rapid operation in operations, has low relative extraction cost and high quality of extracted nucleic acid, and can meet the requirements of detection such as qPCR, NGS, SNP typing and the like.

Drawings

FIG. 1 shows the qPCR detection results of DNA obtained by Qiagen kit extraction method.

FIG. 2 shows the qPCR detection results of DNA obtained by the rapid extraction method.

FIG. 3 shows the qPCR detection results of DNA obtained by crude extraction method.

Fig. 4 shows the minimum detection limit of IDH 1.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 DNA extraction and qPCR detection of fresh brain tumor tissue

First, the rapid extraction method of DNA of the present application

1. Adding 600 μ L of lysis solution into 25mg of brain tumor tissue, adding glass beads, placing in a crusher, grinding and crushing for 1min, centrifuging at 14000rpm for 1min after crushing, transferring 500 μ L of supernatant into a centrifugal column, and centrifuging at 14000rpm for 15 s; this step required 3 min;

wherein the lysate comprises the following components in percentage by weight:

5mmol/L guanidinium isothiocyanate;

50mmol/L Tris-HCl；

10mmol/L EDTA；

150mmol/L NaCl；

0.1% (mass percent) SDS;

5 μ g/ml Aprotinin (Aprotinin);

1-1.3 percent of TritonX-100 by volume percentage.

2. Transferring the silica gel adsorption membrane centrifugal column into a new collecting tube, adding 500 mul of rinsing liquid 1, centrifuging at 14000rpm for 15s, and replacing the collecting tube; this step requires 30 s;

wherein, the rinsing liquid 1 (with pH of 6) comprises the following components in percentage by weight:

the concentration of guanidine hydrochloride is 6M;

20mmol/L Tris-HCl；

55 percent (volume percentage) of ethanol.

3. Adding 500 mul of rinsing liquid 2 into a silica gel adsorption film centrifugal column, centrifuging at 14000rpm for 15 s; this step requires 30 s;

wherein, the rinsing liquid 2 (with pH of 6) comprises the following components in percentage by weight:

200mmol/L NaCl；

20mmol/L Tris-HCl；

70% (volume percentage content) ethanol.

4. Transferring the column into a 1.5mL centrifugal tube, adding 50-100 μ l of nuclease-free water, centrifuging at 14000rpm for 30s, and collecting filtrate to obtain DNA for subsequent qPCR detection. This step required 1 min.

The total time required for this DNA extraction method was 5 minutes.

Second, general method for crude extraction of DNA

Grinding 25mg brain tumor tissue, adding 200 μ l Chelex extract, boiling for 1min, centrifuging at 12000rpm for 1min, collecting supernatant to obtain crude extract of DNA, and using for subsequent qPCR detection.

The time required for this crude DNA extraction method was 5 minutes.

Third, DNA extraction method using kit (Qiagen organism Co., Ltd., Cat. No. 69504)

1. Taking 25mg brain tumor tissue, cutting, adding 180. mu.l Buffer ATL, shaking thoroughly, mixing well, adding 20. mu.l Protein K, incubating at 56 deg.C until the tissue is completely digested, and clarifying the liquid, wherein the step needs 30 min.

2. Vortex for 15s, add 200. mu.l buffer AL, mix well, then add 200. mu.l absolute ethanol, mix well again to obtain a mixture, which takes 2 min.

3. The mixture was transferred to an adsorption column and centrifuged at 8000rpm for 1min, and the filtrate was discarded, which required 1.5min for this step.

4. The adsorption column was placed in a new collection tube, 500. mu.l Buffer AW1 was added, 14000rpm was centrifuged for 1min, and the filtrate was discarded, which required 1.5min for this step.

5. The adsorption column was placed in a new collection tube, 500. mu.l Buffer AW2 was added, the centrifugation was carried out at 14000rpm for 3min, and the filtrate was discarded, which required 3.5min for this step.

6. And (3) putting the adsorption column into a 1.5mL centrifuge tube, adding 200 mul of Buffer AE, incubating at room temperature for 1min, centrifuging at 8000rpm for 1min, and collecting filtrate to obtain DNA for subsequent qPCR detection, wherein the step needs 2.5 min.

The DNA extraction method requires at least 41 min.

Four, qPCR detection of IDH1 mutation

The DNA samples extracted in the first, second and third steps are all diluted to 10 ng/ul, 2 ul is added into 18 ul IDH 1R 132H PCR reaction mixed liquid to obtain 20 ul of reaction system for qPCR detection.

Wherein, in the mixed solution of IDH 1R 132H PCR reaction, the primer sequence of IDH 1R 132H is as follows: f: CTTACTTGATCCCCATAAGCATGCT (SEQ ID NO. 1); r: TTATTGCCAACATGACTTACTTGA (SEQ ID NO. 2); the IDH 1R 132H probe sequence is: FAM-ACATGACTTACTTGATCC-BHQ1, wherein the sequence of the internal reference upstream primer is as follows: GATAGGCACTGACTCTCTCTG, respectively; the sequence of the internal reference downstream primer is as follows: AGCATCAGGAGTGGACAGAT, respectively; the reference probe sequence is as follows: ROX-CTACCCTTGGACCCAGAGGTTCTTTGAG-BHQ 2.

The reaction mixture for IDH 1R 132H PCR was prepared by adding various substances to the reaction premix in the concentrations shown in Table 1. Wherein, the reaction PCR premix comprises: DNA polymerase, Mg²⁺dNTPs and stabilizers. Such as: takara Premix Ex Taq (Probe qPCR).

TABLE 1 concentrations of the respective substances in the qPCR reaction mixture

The PCR reaction conditions are shown in Table 2.

TABLE 2 PCR reaction conditions

And (4) judging a result:

BIO-Rad: setting the signal baseline as 200RFU, if the difference between the Ct values of the FAM signal and the ROX signal is less than or equal to 10, the detected sample is positive, otherwise, the detected sample is negative.

The detection results are shown in fig. 1, 2 and 3, and the results show that the qPCR detection results of the DNA obtained by the rapid extraction method of the invention and the DNA kit extraction method are consistent, and the crude extraction method results show that the internal reference amplification is normal, but the IDH1 mutation cannot be detected.

Example 2 DNA extraction and IDH 1R 132H mutation Point detection of frozen brain tumor tissue

The genomic DNA of 38 cases of frozen brain tumor tissues was extracted by the rapid DNA extraction method and DNA kit (Qiagen organism Co., Ltd., cat number 69504) extraction method of example 1 of the present invention, and IDH 1R 132H mutation point detection was performed.

The extracted sample was diluted to 10 ng/. mu.l, and 2. mu.l was taken for detection. The detection system and reaction conditions are shown in example 1.

And (4) judging a result:

The detection results are shown in fig. 4 and table 3, the lowest detection limit of IDH1 can reach 1%, and the rapid extraction method of the invention is consistent with the detection result of the mutation point of IDH 1R 132H of the DNA obtained by the extraction method of the DNA kit.

TABLE 3 IDH 1R 132H mutation Point test results

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

SEQUENCE LISTING

<110> Beijing Panshengzi Gene science and technology Co., Ltd

<120> GNCFY200071

<130> DNA extraction reagent, kit and extraction method

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cttacttgat ccccataagc atgct 25

<210> 2

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ttattgccaa catgacttac ttga 24

Claims

1. A DNA extraction reagent, characterized in that: the DNA extraction reagent consists of lysis solution, rinsing solution 1, rinsing solution 2 and eluent,

the lysis solution consists of guanidinium isothiocyanate with the concentration of 4-6mol/L, Tris-HCl with the concentration of 40-60mmol/L, EDTA with the concentration of 5-20mmol/L, NaCl with the concentration of 120-160mmol/L, TritonX-100 with the volume percentage content of 1-1.3%, SDS with the mass percentage of 0.05-0.15% and protease inhibitor with the concentration of 3-8 mu g/ml;

the pH values of the rinsing liquid 1 and the rinsing liquid 2 are both 6-8, and the rinsing liquid 1 consists of guanidine hydrochloride with the concentration of 6-8mol/L, Tris-HCl with the concentration of 20-30mmol/L and ethanol with the volume percentage content of 45-55%;

the rinsing liquid 2 consists of NaCl with the concentration of 100-200mmol/L, Tris-HCl with the concentration of 15-25mmol/L and ethanol with the volume percentage of 70-80%.

2. A DNA extraction kit, which is characterized in that: the DNA extraction kit comprises the DNA extraction reagent according to claim 1.

3. The DNA extraction kit according to claim 2, characterized in that: the DNA extraction kit further comprises a centrifugal column.

4. Use of the DNA extraction reagent of claim 1 or the DNA extraction kit of claim 2 or 3 for extracting DNA.

5. A method for extracting DNA, comprising the steps of:

adding the lysis solution in claim 1 into an extracted sample, adding glass beads, crushing the sample on a crusher, centrifuging the crushed sample, and taking supernatant;

transferring the supernatant to a centrifugal column and then centrifuging;

adding the rinsing liquid 1 in the claim 1 into a centrifugal column, centrifuging, and discarding the filtrate;

adding the rinsing liquid 2 in the claim 1 into a centrifugal column, centrifuging, and discarding the filtrate;

adding the eluent of claim 1 into a centrifugal column, centrifuging, and collecting the filtrate to obtain DNA.

6. The extraction method according to claim 5, characterized in that: centrifuging after crushing, namely centrifuging immediately after crushing;

or the mass volume ratio of the extracted sample to the lysate is 1mg:20-50 μ L.

7. The extraction method according to claim 5, characterized in that: the extracted sample is tissue, saliva, urine or blood.

8. The extraction method according to claim 7, characterized in that: the tissue is frozen tissue or fresh tissue.