CN111139257B - Pear PMEI protein in-vitro expression method and application thereof - Google Patents
Pear PMEI protein in-vitro expression method and application thereof Download PDFInfo
- Publication number
- CN111139257B CN111139257B CN202010041241.6A CN202010041241A CN111139257B CN 111139257 B CN111139257 B CN 111139257B CN 202010041241 A CN202010041241 A CN 202010041241A CN 111139257 B CN111139257 B CN 111139257B
- Authority
- CN
- China
- Prior art keywords
- pear
- pmei
- protein
- recombinant
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N47/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom not being member of a ring and having no bond to a carbon or hydrogen atom, e.g. derivatives of carbonic acid
- A01N47/40—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom not being member of a ring and having no bond to a carbon or hydrogen atom, e.g. derivatives of carbonic acid the carbon atom having a double or triple bond to nitrogen, e.g. cyanates, cyanamides
- A01N47/42—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom not being member of a ring and having no bond to a carbon or hydrogen atom, e.g. derivatives of carbonic acid the carbon atom having a double or triple bond to nitrogen, e.g. cyanates, cyanamides containing —N=CX2 groups, e.g. isothiourea
- A01N47/44—Guanidine; Derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/0018—Culture media for cell or tissue culture
- C12N5/0025—Culture media for plant cell or plant tissue culture
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/04—Plant cells or tissues
Abstract
The invention discloses an in vitro expression and purification method of pear PMEI protein and application thereof. Cloning a pear PMEI gene by designing a primer; constructing an escherichia coli recombinant expression plasmid PMEI-pCold-TF; transforming the constructed recombinant expression plasmid PMEI-pCold-TF into escherichia coli Rosetta (DE 3) to construct a pear PMEI protein recombinant expression strain; carrying out protein induction expression on the recombinant strain, and purifying the recombinant pear PMEI protein by using a nickel column affinity chromatography; thereafter, pear pollen tubes and arabidopsis thaliana roots were treated with the obtained recombinant pear PMEI protein. By the method, the first in-vitro expression and purification of the pear PMEI protein are realized, the expression efficiency is high, the purified protein stably exists, and the purity can completely meet the requirements of related experiments; the growth of the pear pollen tube and the root of the arabidopsis is promoted by treating the pear PMEI protein on the pear pollen tube and the root of the arabidopsis.
Description
Technical Field
The invention belongs to the technical field of bioengineering, relates to a pear PMEI protein in-vitro expression method and application thereof, and particularly relates to a pear PMEI protein cloned and purified from pear pollen, wherein the pear PMEI protein is used for treating pear pollen tubes and arabidopsis roots respectively, so that the growth of the pear pollen tubes and the arabidopsis roots is promoted.
Background
Pectin is a major constituent of the primary cell wall of dicotyledonous and monocotyledonous plants other than the family Gramineae, as well as of the pollen wall and pollen tube wall. During the growth and development of plants, the degradation and modification of pectin require the participation of a series of enzymes, wherein Pectin Methyl Esterase (PMEs) is an important hydrolytic enzyme in the degradation and metabolism process of pectin, so that methyl esterified pectin is subjected to methyl esterification, and the hardness and elasticity of a cell wall are adjusted. Pectin methylesterase inhibitors (PMEIs) are proteins that regulate PME activity and form a reversible 1. The inhibition of PMEI on PME regulates the methyl esterification degree of pectin, thereby affecting the cell wall mechanics. Research shows that PMEI plays an indispensable role in seed germination, hypocotyl elongation, pollen germination and pollen tube growth, fruit ripening, and coping with various biotic and abiotic stresses. The separation and purification of PMEI protein will facilitate the further study of its biological function and mechanism of action. PMEI is widely present in various tissues and growth stages of plants, but the difficulty of isolating and purifying natural PMEI protein is large, and the cost of chemically synthesizing PMEI is high. Therefore, the preparation of recombinant PMEI proteins by genetic engineering techniques is an effective way to solve the above problems.
The method for preparing recombinant protein by gene engineering technology is widely applied. To date, various protein expression systems have been constructed, such as prokaryotic expression systems, eukaryotic expression systems, cell-free expression systems, and the like. The colibacillus expression system is the most common prokaryotic expression system and has the advantages of simple genetic background, clear biochemical characteristics, high growth speed, low economic cost, high expression level, easy separation and purification of products, convenient industrial production and the like. Since the construction, numerous recombinant proteins have been produced by E.coli expression systems. The PMEI protein purified by the genetic engineering technology is used for treating the root parts of the pear pollen tube and the arabidopsis thaliana, and the promotion effect of the PMEI protein on the root growth of the pear pollen tube and the root growth of the arabidopsis thaliana can be observed.
Disclosure of Invention
The invention aims to provide a preparation method for pear PMEI protein in vitro expression, which has low cost, high yield and easy purification.
The invention also aims to provide application of the pear PMEI protein in promoting growth of pear pollen tubes and roots of arabidopsis thaliana.
The purpose of the invention can be realized by adopting the following technical scheme:
a method for in vitro expression of pear PMEI protein comprises the following steps:
(1) Extracting total RNA of pear pollen, performing reverse transcription to obtain cDNA, and designing a primer to perform PCR amplification on pear PMEI gene by taking the cDNA generated by the reverse transcription as a template;
(2) Constructing escherichia coli prokaryotic expression recombinant plasmid of pear PMEI protein;
(3) Transforming the recombinant plasmid constructed in the step (2) into an escherichia coli strain Rosetta (DE 3) by a heat shock method, and constructing a prokaryotic expression recombinant strain of pear PMEI protein;
(4) Culturing the recombinant Escherichia coli strain constructed in the step (3) to OD 600 0.4-0.6, adding IPTG to induce the expression of pear PMEI protein after low-temperature treatment;
(5) Purifying the pear PMEI protein subjected to induced expression;
(6) And (3) identifying the recombinant pear PMEI protein.
As a preferred technical scheme, the forward primer used for PCR amplification of the pear PMEI gene in the step (1) is as follows: 5 'ATGGAGCTCGGTACCTCCGAGAGAGCGTCTCAATTAGTTAGGAGTGTTTG-3', and the reverse primer is as follows: 5 'AGCAGAGATTACCATCTATCTAGACTAGATATTTAATAACTGGGAAGTAAC-3'.
Further preferably, in the step (1), the reaction system for PCR amplification of the pear PMEI gene is as follows: ddH 2 O19. Mu.l, 2.5. Mu.l each of the upstream and downstream primers, 1. Mu.l of cDNA, 25. Mu.l of 2 XSuper Pfx MasterMix; the PCR reaction conditions were: pre-denaturation at 98 ℃ for 3min, then at 98 ℃ for 10s,60 ℃ for 30s, and 72 ℃ for 1min for 30 cycles, and finally extension at 72 ℃ for 10min.
Preferably, in the step (2), the escherichia coli prokaryotic expression vector used in constructing the prokaryotic expression recombinant plasmid of the pear PMEI protein is pCold-TF, and the enzyme cutting sites of the pear PMEI gene insertion are Xho I and Xba I sites. As a detailed technical scheme, in the step (2), products of PCR amplification pear PMEI genes are detected by 1% agarose gel electrophoresis and cut into gel for recycling, and the recycled products are connected to an Escherichia coli prokaryotic expression vector pCold-TF which is subjected to double enzyme digestion by Xho I and Xba I restriction enzymes by using homologous recombinase.
Further preferably, in the step (4), the low-temperature treatment is performed by standing on ice for 5min and then standing at 15 ℃ for 40 min, the final concentration of the inducer IPTG is 0.5mmol/L, and the condition of induced expression is 15 ℃ and the time is 24 hours. The detailed process for inducing the expression of pear PMEI protein comprises the following steps: inoculating the Escherichia coli prokaryotic expression recombinant vector of the pear PMEI protein into 100ml of LB liquid culture medium according to the proportion of 1 600 0.4-0.6, rapidly standing on ice for 5min, and standing at 15 deg.C for 40 min; adding inducer IPTG with final concentration of 0.5mmol/L, shake culturing at 15 deg.C and 220rpm, and inducing expression for 24 hr; wherein the LB liquid medium contains 100. Mu.g/ml ampicillin.
Further preferably, in the step (5), the detailed process for purifying the pear PMEI protein for inducing expression is as follows: after the induction expression is finished, centrifuging at 4 ℃ and 10000rpm for 10 minutes, then discarding the supernatant, collecting thalli sediment, and adding 20ml of lysate into the sediment for resuspension; crushing the heavy suspension by using ultrasonic waves until the heavy suspension is clarified, centrifuging the suspension for 10 minutes at 4 ℃ and 10000rpm, collecting supernatant, filtering the supernatant by using a 0.45-micron filter membrane, and purifying the pear PMEI protein by using a nickel column affinity chromatography; before purifying the protein, balancing the nickel column affinity chromatography medium by using a 10-time column volume of balancing buffer solution; collecting purified protein, concentrating and desalting with ultrafiltration tube with cut-off amount of 30kDa at 4 deg.C and 6000rpm, and storing at-80 deg.C;
wherein the ultrasonic power of the ultrasonic crushing method is 240w, and the conditions are that the ultrasonic crushing method is started for 3s and stopped for 7s for 27 minutes;
the formula of the lysis solution is as follows: 140mM sodium chloride, 2.7mM potassium chloride, 10mM disodium hydrogen phosphate, 1.8mM potassium dihydrogen phosphate, 50 × EDTA-free protease inhibitor cocktail III, pH 7.3;
the formula of the equilibrium buffer solution is as follows: 500mM sodium chloride, 20mM tris (hydroxymethyl) aminomethane, 5mM imidazole, pH 7.3.
The N end of the pear PMEI protein is provided with 6 histidine tags (His-Tag).
Further preferably, in the step (6), the recombinant pear PMEI protein is identified by SDS-PAGE electrophoretic analysis. The specific process for identifying the recombinant pear PMEI protein by the SDS-PAGE electrophoretic analysis method comprises the following steps: taking 50 mu l of purified sample, adding 25 mu l of 2 xSDS-PAGE sample buffer, taking 10 mu l of mixed solution to perform SDS-PAGE electrophoresis, and identifying pear PMEI protein after Coomassie brilliant blue staining.
Application of pear PMEI protein in promoting growth of pear pollen tube and root of Arabidopsis thaliana is provided.
In the application, the recombinant pear PMEI protein expressed by the method is used for treating pear pollen tubes or arabidopsis roots. And measuring and counting the change of the length of the pear pollen tube and the length of the root of the arabidopsis thaliana, and verifying the promotion effect of the recombinant pear PMEI protein on the growth of the pear pollen tube and the root of the arabidopsis thaliana. In order to evaluate the effect of pear PMEI protein on the growth of pear pollen tubes and root parts of arabidopsis thaliana, pear pollen tubes cultured in a pear culture medium without pear PMEI protein and arabidopsis thaliana grown on an MS culture medium without the pear PMEI protein are taken as negative controls at the same time, and the changes of the lengths of the pear pollen tubes and the root parts are measured and counted.
As a preferred technical scheme, the process for treating the pear pollen tube by using the recombinant pear PMEI protein comprises the following steps: taking a proper amount of pear pollen to be placed in a pollen culture medium, and carrying out dark culture for 1 hour in an incubator at 25 ℃ and 120 rpm; adding recombinant pear PMEI protein with the final concentration of 10mmol, and continuously culturing in a dark culture box at 25 ℃ and 120rpm for 3 hours; the length of the pear pollen tube was measured and counted at 2, 3, and 4 hours.
The pear pollen culture medium comprises the following components in percentage by weight: 10% sucrose, 0.01% boric acid, 0.03% calcium diphosphate tetrahydrate, 0.58% MES,10% PEG, adjusted to pH 6.3 with Tris.
As a preferred technical scheme, the process for treating the root of arabidopsis by using the recombinant pear PMEI protein comprises the following steps: coating 30 mu l of 0.1mg/ml recombinant pear PMEI protein on a nonreactive MS culture medium; transferring an arabidopsis thaliana seedling with the seedling age of 10 days to a nonreactive MS culture medium coated with pear PMEI protein, and vertically placing a plate; further culturing the Arabidopsis seedlings in a greenhouse with an average temperature of 25 ℃ and an average humidity of 65% and a light/dark treatment of 16/8 hours, and measuring and counting the length of Arabidopsis roots on days 2, 4, 6, and 8 after the transfer.
Wherein the formula of the MS culture medium is as follows: 2% sucrose, 0.43% MS,0.75% agar, adjusted to pH 5.8 with KOH.
The method for expressing pear PMEI protein in vitro and the application experiment process comprise the following steps:
(1) Sequence analysis and cloning of pear PMEI gene
(1.1) a pear PMEI (Pbr003471.1) gene, the nucleotide sequence of which is SEQ ID NO:1, and the protein sequence of which is SEQ ID NO:2. The signal peptide sequence SEQ ID NO 3 was analyzed and removed using the sequence analysis website SignalP 4.1 Server (http:// www. Cbs. Dtu. Dk/services/SignalP /).
(1.2) extracting the total RNA of the pollen of the Dangshan pear according to the instruction of the total plant RNA extraction kit, and carrying out reverse transcription on the total RNA of the pollen into cDNA by using a reverse transcription kit.
(1.3) primer design and PCR reaction: design forward primer (PMEI-pCold-Xho I-F) as 5' -ATGGAGCTCGGTACCCTCGAGAGAGCGTCTCAATTAGTTAGGAGTGTTTG-3 '(preceding homology arm of pCold-TF vector in italics, xho I cleavage site underlined) and 5' -AGCAGAGATTACC as reverse primer (PMEI-pCold-XbaI-R)TATCTAGACTAGATATTTAATAACTGGGAAGTAAC-3’
(the rear homology arm of the Pcoled-TF vector is in italics, and the Xba I restriction site is underlined); the PCR reaction system is as follows: ddH 2 O19. Mu.l, 2.5. Mu.l each of the upstream and downstream primers, 1. Mu.l of cDNA, 25. Mu.l of 2 Xsuper Pfx MasterMix; the PCR reaction conditions are as follows: pre-denaturation at 98 ℃ for 3min, then at 98 ℃ for 10s,60 ℃ for 30s, and 72 ℃ for 1min for 30 cycles, and finally extension at 72 ℃ for 10min.
(1.4) PCR amplification of pear PMEI gene product by 1% agarose gel electrophoresis detection and gel cutting recovery. The recovered product was ligated to the Escherichia coli prokaryotic expression vector pCold-TF which had been digested with Xho I and Xba I restriction enzymes by the homologous recombinase (see TAKARA's vector map).
(1.5) the accuracy of the recombinant expression vector PMEI-pCold-TF was verified by DNA sequencing of Jinzhi Biotechnology Ltd, suzhou.
(2) Construction of recombinant expression E.coli Strain
The recombinant expression vector PMEI-pCold-TF with correct sequencing is transformed into an Escherichia coli strain Rosetta (DE 3) by a heat shock method, coated on an LB solid plate (containing 100 mu g/ml ampicillin), cultured overnight in an incubator at 37 ℃, single colonies are picked up to 500 mu l of LB liquid medium (containing 100 mu g/ml ampicillin), and cultured for 4 hours at 37 ℃ and 220rpm with shaking. After the bacterial liquid is verified to be correct by PCR, the ratio of 7:3 (bacteria liquid: glycerol) and 50% (v/v) of sterilized glycerol are added, and after being uniformly mixed, the mixture is frozen and stored in a refrigerator at minus 80 ℃ by liquid nitrogen.
(3) Inducible expression and purification of pear PMEI protein
(3.1) inducible expression of Pear PMEI protein
Inoculating the recombinant expression strain stored in the step (2) into 100ml of LB liquid culture medium according to the volume ratio of 1 600 Rapidly placing on ice for 5 minutes when the concentration reaches 0.4-0.6, standing at 15 deg.C for 40 minutes, adding IPTG with final concentration of 0.5mmol/L, culturing at 15 deg.C and 220rpm with shaking, and inducing expression for 24 hours. Wherein the LB liquid medium contains 100. Mu.g/ml ampicillin.
(3.2) purification of Pear PMEI protein
After the induction expression of the pear PMEI protein is finished, centrifuging the pear PMEI protein at 4 ℃ and 10000rpm for 10 minutes, discarding supernatant, collecting bacterial precipitates, adding 20ml of lysis solution (140 mM sodium chloride, 2.7mM potassium chloride, 10mM disodium hydrogen phosphate, 1.8mM potassium dihydrogen phosphate, 50X EDTA-free protease inhibitor cocktail III (Merck Mich, germany) into the precipitates, and re-suspending the precipitates at the pH of 7.3); the resuspension solution is subjected to ultrasonication (the ultrasonic power is 240w, the conditions are that the opening is carried out for 3s, the stopping is carried out for 7s, and the total time is 27 minutes) until the resuspension solution is clarified, the centrifugation is carried out for 10 minutes at 4 ℃ and 10000rpm, the supernatant is collected, and the PMpear EI protein is purified by using a nickel column affinity chromatography after being filtered by a 0.45 mu m filter membrane. Prior to protein purification, the nickel column affinity chromatography medium was equilibrated with 10 column volumes of equilibration buffer (500 mM sodium chloride, 20mM tris (hydroxymethyl) aminomethane, 5mM imidazole, pH 7.3); the purified protein was collected, concentrated and desalted at 6000rpm at 4 ℃ using an ultrafiltration tube (cut-off: 30 kDa). Taking 50 mu l of purified sample, adding 25 mu l of 2 xSDS-PAGE sample buffer, taking 10 mu l of mixed solution to perform SDS-PAGE electrophoresis, identifying pear PMEI protein after Coomassie brilliant blue staining, and storing at-80 ℃ for later use.
(4) Application of recombinant pear PMEI protein
And (3) determining the protein concentration of the PMEI protein of the purified recombinant pear according to a BCA protein concentration determination kit of Shanghai Biotech company. And (3) treating the roots of the Dangshan pear pollen tube and the Columbia-0 wild type Arabidopsis by using the purified recombinant pear PMEI protein, and measuring and counting the length changes of the pollen tube and the roots. Taking a proper amount of pear pollen in 200 mul pollen culture medium, carrying out dark culture in an incubator at 25 ℃ and 120rpm for 1 hour, adding recombinant pear PMEI protein with the final concentration of 10mmol, and continuing the dark culture in the incubator at 25 ℃ and 120rpm for 3 hours. At 2, 3 and 4 hours, the growth of the pollen tube is observed by using a microscope Nikon TE100, and the length of the pear pollen tube is measured and counted by using software Image-Pro Plus 6.0. Three biological replicates were set for each treatment, and 100 pollen tube lengths were measured and the average calculated. The formula of the pear pollen culture medium is as follows: 10% sucrose, 0.01% boric acid, 0.03% calcium diphosphate tetrahydrate, 0.58% MES,10% PEG, adjusted to pH 6.3 with Tris.
Coating 30 mu l of 0.1mg/ml recombinant pear PMEI protein on a nonreactive MS culture medium; arabidopsis seedlings grown on the nonreactive MS medium and having a seedling age of 10 days were transferred to the nonreactive MS medium coated with pear PMEI protein, the plates were placed vertically, and then the Arabidopsis seedlings were further cultured in a greenhouse at an average temperature of 25 ℃ and an average humidity of 65% for 16/8 hours of light/dark treatment, and the length of Arabidopsis roots was measured and counted on days 2, 4, 6, and 8 after the transfer. Three biological replicates were set for each treatment, and the length of 50 Arabidopsis roots was measured and averaged. Wherein, the formula of the MS culture medium is as follows: 2% sucrose, 0.43% MS,0.75% agar, adjusted to pH 5.8 with KOH.
In order to evaluate the effect of pear PMEI protein on the growth of pear pollen tubes and root parts of arabidopsis thaliana, pear pollen tubes cultured in a pear culture medium without pear PMEI protein and arabidopsis thaliana grown on an MS culture medium without the pear PMEI protein are taken as negative controls at the same time, and the changes of the lengths of the pear pollen tubes and the root parts are measured and counted.
The invention has the beneficial effects that:
(1) The invention adopts the genetic engineering technology, expresses and purifies the pear PMEI protein in vitro for the first time, and has high expression efficiency and good purification effect.
(2) The methods of the invention for in vitro expression and purification of proteins are applicable to all PMEI proteins in pear.
(3) The pear PMEI protein expressed and purified by the invention stably exists under the in vitro condition and has protein activity, thereby providing a research basis for further researching the biological functions exerted in the pear growth and development process.
(4) The pear PMEI protein expressed by the invention can directly promote the growth of the Dangshan pear pollen tube and the root of Columbia-0 wild type Arabidopsis under in vitro conditions, and provides reference for the functional research of the pear PMEI protein.
Drawings
FIG. 1 is a diagram of the prediction of the signal peptide of the pear PMEI protein sequence.
FIG. 2 is a diagram of agarose gel electrophoresis of PCR amplified pear PMEI gene;
wherein M is the mass of the DNA standard molecule; 1 is PCR amplification product.
FIG. 3 is a SDS-PAGE representation of the induced expression and purification of recombinant pear PMEI proteins;
wherein M is a protein standard molecular weight; 1 is total protein of thallus induced by 0.5mmol/L IPTG; 2, the purified recombinant pear PMEI protein; 3 is total protein of induced thallus without IPTG.
FIG. 4 is the effect of the recombinant pear PMEI protein on the growth of the Dangshan pear pollen tube;
wherein, FIG. 4a is the pear pollen tube after 3 hours of untreated pear pollen tube and recombinant pear PMEI protein treatment; FIG. 4b is a graph of the change in length of untreated pear pollen tubes and of pear pollen tubes after treatment with recombinant pear PMEI protein over 1-3 hours.
FIG. 5 is a graph of the effect of recombinant pear PMEI protein on Columbia-0 wild type Arabidopsis root growth;
wherein FIG. 5a is a plot of untreated Arabidopsis roots and recombinant Pear PMEI protein treated Arabidopsis roots at day eight; FIG. 5b is the change in length of untreated Arabidopsis roots and after recombinant pear PMEI protein treatment in 0-8 days.
Detailed Description
The following describes embodiments of the present invention in detail. The embodiments described below with reference to the accompanying drawings are illustrative only for the purpose of explaining the present invention, and are not to be construed as limiting the present invention.
Example 1: construction and identification of PMEI-pCold-TF recombinant plasmid
Taking fresh Dangshan pear pollen, and extracting total RNA of the pollen by using a plant total RNA extraction kit; using total RNA of pollen as a template, and carrying out reverse transcription by using a reverse transcription kit to obtain pollen cDNA; as shown in figure 1, analyzing and removing the signal peptide sequence of pear PMEI gene, designing primers, adding homologous arms of vector pCold-TF and enzyme cutting sites of Xba I and Xho I at two ends of the primers, and carrying out PCR amplification on the PMEI gene by taking pollen cDNA as a template, wherein the PCR reaction system is as follows: ddH 2 O19. Mu.l, 2.5. Mu.l each of the upstream and downstream primers, 1. Mu.l of cDNA, 25. Mu.l of 2 Xsuper Pfx MasterMix; the PCR reaction conditions are as follows: pre-denaturation at 98 deg.C for 3min, then at 98 deg.C for 10s and 60 deg.C for 30 mins,72 ℃ 1min, 30 cycles, and finally 72 ℃ extension 10min. The PCR product was identified by electrophoresis on a 1% agarose gel. As shown in FIG. 2, there is a clear bright band at 500-750bp, which coincides with the length of PMEI gene.
Recovering the PCR product by using a Gel extraction kit rapid agarose Gel DNA recovery kit of Kangji century company to obtain a recovered PMEI gene; the recovered PMEI gene is connected to a pCold-TF expression vector which is also subjected to double enzyme digestion by Xba I and Xho I through a homologous recombinase, and the reaction is carried out for 30 minutes at 37 ℃ to construct a recombinant plasmid PMEI-pCold-TF; the recombinant plasmid was transformed into E.coli strain DH 5. Alpha. By heat shock method, spread on LB solid plate (containing 100. Mu.g/ml ampicillin), cultured at 37 ℃ for 16 hours, picked up as a single colony into 500. Mu.l of LB liquid medium (containing 100. Mu.g/ml ampicillin), shake-cultured at 37 ℃ and 220rpm for 4 hours, and subjected to PCR identification. Identification of the correct monoclonal strains sent to Suzhou Jinwei Zhi Biotechnology Ltd DNA sequencing to verify the sequence correctness. The sequencing result shows that the obtained pear PMEI gene coding region sequence is consistent with the reference series. The recombinant plasmid was named PMEI-pCold-TF. The sequence of the coding region of the pear PMEI gene is connected with pCold-TF, the cloning and sequencing result is SEQ ID NO. 1, and the amino acid sequence is SEQ ID NO. 2.
Example 2: expression of pear PMEI gene in Escherichia coli
1. Obtaining recombinant expression strain for expressing pear PMEI
The correctly sequenced monoclonal strains were inoculated into 4ml of LB liquid medium (containing 100. Mu.g/ml ampicillin) and cultured overnight with shaking at 220rpm at 37 ℃. The next day, the recombinant Plasmid PMEI-pCold-TF was extracted according to the instructions of the Quickpure Plasmid Mini kit Rapid Small extraction kit, kangji Shiji corporation. 1ng of recombinant plasmid PMEI-pCold-TF was transformed into Escherichia coli strain Rosetta (DE 3) by heat shock method, spread on LB plate (containing 100. Mu.g/ml ampicillin) to screen recombinants, and cultured overnight at 37 ℃ to obtain genetically engineered bacteria expressing pear PMEI. Taking single colony of the obtained genetically engineered bacteria, streaking on LB plate (containing 100. Mu.g/ml ampicillin), inoculating a small amount of streaked bacteria into 1ml LB (containing 100. Mu.g/ml ampicillin) liquid medium, shaking-culturing at 37 ℃ and 220rpm for 4 hours, and performing 7:3 (bacterial liquid: glycerol) is added with 50% (v/v) of sterilized glycerol, and after being uniformly mixed, the mixture is frozen and stored in a refrigerator at minus 80 ℃ by liquid nitrogen, thus obtaining the recombinant expression strain for expressing the pear PMEI protein.
2. Expression of pear PMEI recombinant protein
The stored recombinant expression strain of pear PMEI protein was inoculated into 100ml LB (containing 100. Mu.g/ml ampicillin) liquid medium at a volume ratio of 1. The activated recombinant expression strain was inoculated into 300ml of LB liquid medium (containing 100. Mu.g/ml ampicillin) and cultured at 37 ℃ and 220rpm in a shaking manner to OD 600 Is 0.4-0.6. Taking 5ml of bacterial liquid as a negative control, rapidly placing the rest bacterial liquid on ice for 5 minutes, standing for 40 minutes at 15 ℃, finally adding IPTG with the final concentration of 0.5mmol/L, performing shake culture at 15 ℃ and 220rpm, and performing induced expression for 24 hours. 5ml of the expressed bacterial solution was centrifuged at 4 ℃ and 10000rpm for 4 minutes, and the bacterial pellet was collected. 200. Mu.l of 10% SDS (10 g/100 ml) was added to each of the pellet and the negative control, mixed well and boiled in a water bath for 10 minutes, ice-cooled for two minutes, and then centrifuged at 10000rpm for 10 minutes at 4 ℃ to obtain 50. Mu.l of each supernatant, and 25. Mu.l of 2 Xprotein loading buffer was added thereto. 15 μ l of each of the samples was subjected to 12% conventional SDS-PAGE, stained with Coomassie blue, destained and then examined for recombinant protein expression, the results are shown in lanes 1 and 2 of FIG. 3.
Example 3: separation, purification and identification of recombinant pear PMEI protein
Subjecting the residual recombinant expression bacteria liquid to induced expression for 24 hours and detecting the correctness by SDS-PAGE electrophoresis to centrifuge at 4 ℃ and 10000rpm for 10 minutes, discarding the supernatant and collecting the bacterial pellet, adding 20ml of lysis solution (140 mM sodium chloride, 2.7mM potassium chloride, 10mM disodium hydrogen phosphate, 1.8mM potassium dihydrogen phosphate, 50 × EDTA-free protease inhibitor cocktail III (Merck Mich, germany) into the pellet to resuspend the pellet at pH 7.3); the resuspension was sonicated (sonication power 240w, conditions 3s on, 7s off, 27 min total) to clear, centrifuged at 10000rpm for 10min at 4 ℃, the supernatant was collected and filtered through a 0.45 μm filter to remove impurities, and the pear PMEI protein was purified using Ni-NTA Sepharose affinity chromatography packing from Mercury, germany.
Before purifying the protein, the nickel column affinity chromatography medium was equilibrated with 10 column volumes of equilibration buffer (500 mM sodium chloride, 20mM tris (hydroxymethyl) aminomethane, 5mM imidazole, pH 7.3) at a flow rate of 1ml/min; purifying 20ml of protein supernatant sample filtered by the filter membrane by a column, and controlling the flow rate to be 1ml/min; washing the column with 20 column volumes of a wash solution containing 40mM imidazole (500 mM sodium chloride, 20mM tris (hydroxymethyl) aminomethane, 30mM imidazole, pH 7.3) at a flow rate of 1ml/min; eluting the purified protein in a 10-fold column volume elution buffer (500 mM sodium chloride, 20mM tris (hydroxymethyl) aminomethane, 80mM imidazole, pH 7.3) containing 60mM imidazole at a flow rate of 1ml/min, collecting the eluate to obtain the purified protein, concentrating at 6000rpm at 4 ℃ using an ultrafiltration tube (cut-off of 30 kDa), desalting, and storing at-80 ℃. A small amount of the protein was analyzed for SDS-PAGE purity, and the results are shown in lane 3 of FIG. 3.
Example 4: application of recombinant pear PMEI protein
And (3) determining the protein concentration of the PMEI protein of the purified recombinant pear according to a BCA protein concentration determination kit of Shanghai Biotech company. And (3) treating the roots of the Dangshan pear pollen tube and the Columbia-0 wild type Arabidopsis by using the purified recombinant pear PMEI protein, and measuring and counting the length changes of the pollen tube and the roots. Taking a proper amount of pear pollen in 200 mul pollen culture medium, carrying out dark culture in an incubator at 25 ℃ and 120rpm for 1 hour, adding recombinant pear PMEI protein with the final concentration of 10mmol, and continuing to carry out dark culture in the incubator at 25 ℃ and 120rpm for 3 hours. At 2, 3 and 4 hours, the growth of the pollen tube was observed with a microscope Nikon TE100, and the length of the pear pollen tube was measured and counted with the software Image-Pro Plus 6.0. Three biological replicates were set for each treatment, and 100 pollen tube lengths were measured and the average calculated. The formula of the pear pollen culture medium is as follows: 10% sucrose (g/100 ml), 0.01% boric acid (g/100 ml), 0.03% calcium diphosphate tetrahydrate (g/100 ml), 0.58% MES (g/100 ml), 10% PEG (g/100 ml), adjusted to pH 6.3 with Tris.
Coating 30 mu l of 0.1mg/ml recombinant pear PMEI protein on a nonreactive MS culture medium; arabidopsis seedlings grown on the nonreactive MS medium and having a seedling age of 10 days were transferred to the nonreactive MS medium coated with pear PMEI protein, the plates were placed vertically, and then the Arabidopsis seedlings were further cultured in a greenhouse at an average temperature of 25 ℃ and an average humidity of 65% for 16/8 hours of light/dark treatment, and the length of Arabidopsis roots was measured and counted on days 2, 4, 6, and 8 after the transfer. Three biological replicates were set for each treatment, and the length of 50 arabidopsis roots was measured and averaged. Wherein the formula of the MS culture medium is as follows: 2% sucrose (g/100 ml), 0.43% MS (g/100 ml), 0.75% agar (g/100 ml), adjusted to pH 5.8 with KOH.
In order to evaluate the effect of pear PMEI protein on the growth of pear pollen tubes and root parts of arabidopsis thaliana, pear pollen tubes cultured in a pear culture medium without pear PMEI protein and arabidopsis thaliana grown on an MS culture medium without the pear PMEI protein are taken as negative controls at the same time, and the changes of the lengths of the pear pollen tubes and the root parts are measured and counted.
Sequence listing
<110> Nanjing university of agriculture
<120> pear PMEI protein in-vitro expression method and application thereof
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 567
<212> DNA
<213> Pear (Pyrus spp)
<400> 1
atggcctcct caatcagtta tgcaatgttc attgcttcct tgctcttatg tctctcgtcg 60
tctccagcac catttgcaaa tgcaagagcg tctcaattag ttaggagtgt ttgcaagcaa 120
acccacgaag aattcggcta cagctatagg cagtgcgtaa aatctctttg gaaagatatt 180
ccaattagat cggcaactaa tctcaaagat cttgatatag ccattcttaa attagcagca 240
gcaaatgcag cacaaaccaa agctacgttt gaaaaagctt tcaacgccac caacaagaac 300
actaatggca cggcagctat aaagcagtgt gtagattcgt atgattttgc gttaggggct 360
ttcgtttttg cagtgcgagg ggtcaatgac ggtgacaaat cggtcaccaa aatcctcaca 420
cagacccaag atgaccttgt tcgttgccaa agagcattgg cctctgttga agttcagctt 480
cctatgccag tatcgacgac aaacttttgg gtcatgttat atagggatgt tgcattcctt 540
gttacttccc agttattaaa tatctag 567
<210> 2
<211> 188
<212> PRT
<213> Pear (Pyrus spp)
<400> 2
Met Ala Ser Ser Ile Ser Tyr Ala Met Phe Ile Ala Ser Leu Leu Leu
1 5 10 15
Cys Leu Ser Ser Ser Pro Ala Pro Phe Ala Asn Ala Arg Ala Ser Gln
20 25 30
Leu Val Arg Ser Val Cys Lys Gln Thr His Glu Glu Phe Gly Tyr Ser
35 40 45
Tyr Arg Gln Cys Val Lys Ser Leu Trp Lys Asp Ile Pro Ile Arg Ser
50 55 60
Ala Thr Asn Leu Lys Asp Leu Asp Ile Ala Ile Leu Lys Leu Ala Ala
65 70 75 80
Ala Asn Ala Ala Gln Thr Lys Ala Thr Phe Glu Lys Ala Phe Asn Ala
85 90 95
Thr Asn Lys Asn Thr Asn Gly Thr Ala Ala Ile Lys Gln Cys Val Asp
100 105 110
Ser Tyr Asp Phe Ala Leu Gly Ala Phe Val Phe Ala Val Arg Gly Val
115 120 125
Asn Asp Gly Asp Lys Ser Val Thr Lys Ile Leu Thr Gln Thr Gln Asp
130 135 140
Asp Leu Val Arg Cys Gln Arg Ala Leu Ala Ser Val Glu Val Gln Leu
145 150 155 160
Pro Met Pro Val Ser Thr Thr Asn Phe Trp Val Met Leu Tyr Arg Asp
165 170 175
Val Ala Phe Leu Val Thr Ser Gln Leu Leu Asn Ile
180 185
<210> 3
<211> 84
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
atggcctcct caatcagtta tgcaatgttc attgcttcct tgctcttatg tctctcgtcg 60
tctccagcac catttgcaaa tgca 84
<210> 6
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
atggagctcg gtaccctcga gagagcgtct caattagtta ggagtgtttg 50
<210> 7
<211> 48
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
agcagagatt acctatctag actagatatt taataactgg gaagtaac 48
Claims (9)
1. The application of pear PMEI protein with an amino acid sequence shown as SEQ ID No.2 in promoting growth of pear pollen tube and root of Arabidopsis thaliana is provided.
2. The use of claim 1, wherein the pear PMEI protein is a recombinant pear PMEI protein prepared by treating pear pollen tube or Arabidopsis thaliana root by:
(1) Extracting total RNA of pear pollen, reverse transcribing to cDNA, designing primer, and PCR amplifying pear with the cDNA generated by reverse transcription as templatePMEIA gene;
(2) Constructing escherichia coli prokaryotic expression recombinant plasmid of pear PMEI protein;
(3) Transforming the recombinant plasmid constructed in the step (2) into an escherichia coli strain Rosetta (DE 3) by a heat shock method, and constructing a prokaryotic expression recombinant strain of pear PMEI protein;
(4) Culturing the recombinant Escherichia coli strain constructed in the step (3) to OD 600 0.4-0.6, adding IPTG to induce the expression of pear PMEI protein after low-temperature treatment;
(5) Purifying the pear PMEI protein subjected to induced expression;
(6) And (3) identifying the recombinant pear PMEI protein.
3. The use of claim 2, wherein in step (1), the PCR amplification is performed on the pearPMEIThe forward primers for the genes were: 5 'ATGGAGCTCGGTACCTCCAAGAGCGTCTCAATTAGTTAGGAGTGTTTG-3', and a reverse primer is as follows: 5 'AGCAGAGATTACCATCTATCTAGACTAGATATTTAATAACTGGGAAGTAAC-3'.
4. The use of claim 2, wherein in step (1), the PCR amplification of the pear is performedPMEIThe reaction system of the gene is as follows: ddH 2 O19. Mu.l, 2.5. Mu.l each of the upstream and downstream primers, 1. Mu.l of cDNA, 25. Mu.l of 2 Xsuper Pfx MasterMix; the PCR reaction conditions are as follows: 98. pre-denaturation at 98 deg.C for 3min, then at 60 deg.C for 30s, at 72 deg.C for 1min for 30 cycles, and finally extension at 72 deg.C for 10min.
5. The use of claim 2, wherein in step (2), the prokaryotic expression of the pear PMEI protein is constructedThe prokaryotic expression vector of the escherichia coli used in the recombinant plasmid is pCold-TF or pearPMEIThe restriction enzyme site of the gene insertion isXho IAndXba Ia site.
6. The use of claim 2, wherein in step (4), the low temperature treatment is performed by standing on ice for 5min and then at 15 ℃ for 40 min, the final concentration of the inducer IPTG is 0.5mmol/L, and the expression inducing condition is at 15 ℃ for 24 hours.
7. The use of claim 2 or 6, wherein in step (4), the detailed process of inducing expression of the pear PMEI protein is as follows: inoculating the Escherichia coli prokaryotic expression recombinant vector of the pear PMEI protein into 100ml of LB liquid culture medium according to the proportion of 1 600 0.4-0.6, rapidly standing on ice for 5min, and standing at 15 deg.C for 40 min; adding inducer IPTG with final concentration of 0.5mmol/L, shake culturing at 15 deg.C and 220rpm, and inducing expression for 24 hr;
wherein the LB liquid medium contains 100. Mu.g/ml ampicillin.
8. The use of claim 2, wherein in step (5), the detailed process for purifying the expression-inducing pear PMEI protein is as follows: after the induction expression is finished, centrifuging at 4 ℃ and 10000rpm for 10 minutes, then discarding the supernatant, collecting thalli sediment, and adding 20ml of lysate into the sediment for resuspension; crushing the heavy suspension by using ultrasonic waves until the heavy suspension is clarified, centrifuging the suspension for 10 minutes at 4 ℃ and 10000rpm, collecting supernatant, filtering the supernatant by using a 0.45-micron filter membrane, and purifying the pear PMEI protein by using a nickel column affinity chromatography; before purifying the protein, balancing the nickel column affinity chromatography medium by using a 10-time column volume of balancing buffer solution; collecting purified protein, concentrating and desalting with 30kDa ultrafiltration tube at 4 deg.C and 6000rpm, and storing at-80 deg.C;
wherein the ultrasonic power of the ultrasonic crushing method is 240w, and the conditions are that the ultrasonic crushing method is started for 3s and stopped for 7s for 27 minutes;
the formula of the lysis solution is as follows: 140mM sodium chloride, 2.7mM potassium chloride, 10mM disodium hydrogen phosphate, 1.8mM potassium dihydrogen phosphate, 50 × EDTA-free protease inhibitor cocktail III, pH 7.3;
the formula of the equilibrium buffer solution is as follows: 500mM sodium chloride, 20mM tris (hydroxymethyl) aminomethane, 5mM imidazole, pH 7.3.
9. The use of claim 2, wherein in step (6), the recombinant pear PMEI protein is identified by SDS-PAGE analysis, and the specific process of the SDS-PAGE analysis for identifying the recombinant pear PMEI protein is as follows: taking 50 mu l of purified sample, adding 25 mu l of 2 xSDS-PAGE sample buffer, taking 10 mu l of mixed solution to perform SDS-PAGE electrophoresis, and identifying pear PMEI protein after Coomassie brilliant blue staining.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010041241.6A CN111139257B (en) | 2020-01-15 | 2020-01-15 | Pear PMEI protein in-vitro expression method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010041241.6A CN111139257B (en) | 2020-01-15 | 2020-01-15 | Pear PMEI protein in-vitro expression method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111139257A CN111139257A (en) | 2020-05-12 |
| CN111139257B true CN111139257B (en) | 2022-10-14 |
Family
ID=70525100
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010041241.6A Active CN111139257B (en) | 2020-01-15 | 2020-01-15 | Pear PMEI protein in-vitro expression method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111139257B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113481211B (en) * | 2021-08-02 | 2023-03-10 | 中国农业科学院棉花研究所 | Pectin methylesterase inhibitory factor gene GhPMEI39 and application of encoded protein thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2166103A1 (en) * | 2004-08-02 | 2010-03-24 | BASF Plant Science GmbH | Method for isolation of transcription termination sequences |
| CN102286520A (en) * | 2010-09-13 | 2011-12-21 | 天津大学 | Recombinant vector and recombinant bacterium containing tomato LeEXP2 gene, and expression of LeEXP2 gene in recombinant bacterium |
| CN103146710A (en) * | 2013-03-18 | 2013-06-12 | 昆明理工大学 | Yunnan red pear PybMYB gene as well as prokaryotic expression vector and application thereof |
| CN106434589A (en) * | 2016-12-13 | 2017-02-22 | 山西农业大学 | Chicken glutathione S-transferase A3 (GSTA3), prokaryotic expression and purification method thereof |
| CN108642073A (en) * | 2018-05-18 | 2018-10-12 | 南京农业大学 | A kind of vivoexpression of pears PbrRALF2 protein and its preparation method of polyclonal antibody |
| CN109310061A (en) * | 2016-03-31 | 2019-02-05 | 日本烟草产业株式会社 | The method that substance is imported into plant |
| WO2019198075A1 (en) * | 2018-04-12 | 2019-10-17 | Evogene Ltd. | Polynucleotides and polypeptides of plant and bacterial origin for protecting plants from pathogenic fungi |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1301300A (en) * | 1998-02-20 | 2001-06-27 | 曾尼卡有限公司 | Pollen specific promoter |
| BR9908126A (en) * | 1998-02-20 | 2000-10-24 | Zeneca Ltd | Hybrid seed production |
| AU2005219533B2 (en) * | 2004-03-01 | 2010-03-04 | Basf Plant Science Gmbh | Transgenic expression constructs for vegetative plant tissue specific expression of nucleic acids |
| US20100212050A1 (en) * | 2007-03-29 | 2010-08-19 | Cbd Technologies Ltd. | Plants over-expressing pme |
| WO2018131037A1 (en) * | 2017-01-16 | 2018-07-19 | Evogene Ltd. | Isolated polynucleotides and polypeptides associated with plants resistance to pathogenic fungi |
| CN112899105B (en) * | 2021-02-25 | 2022-10-14 | 中国农业科学院郑州果树研究所 | Pectin methylesterase inhibitor and application thereof in brewing fruit wine |
-
2020
- 2020-01-15 CN CN202010041241.6A patent/CN111139257B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2166103A1 (en) * | 2004-08-02 | 2010-03-24 | BASF Plant Science GmbH | Method for isolation of transcription termination sequences |
| CN102286520A (en) * | 2010-09-13 | 2011-12-21 | 天津大学 | Recombinant vector and recombinant bacterium containing tomato LeEXP2 gene, and expression of LeEXP2 gene in recombinant bacterium |
| CN103146710A (en) * | 2013-03-18 | 2013-06-12 | 昆明理工大学 | Yunnan red pear PybMYB gene as well as prokaryotic expression vector and application thereof |
| CN109310061A (en) * | 2016-03-31 | 2019-02-05 | 日本烟草产业株式会社 | The method that substance is imported into plant |
| CN106434589A (en) * | 2016-12-13 | 2017-02-22 | 山西农业大学 | Chicken glutathione S-transferase A3 (GSTA3), prokaryotic expression and purification method thereof |
| WO2019198075A1 (en) * | 2018-04-12 | 2019-10-17 | Evogene Ltd. | Polynucleotides and polypeptides of plant and bacterial origin for protecting plants from pathogenic fungi |
| CN108642073A (en) * | 2018-05-18 | 2018-10-12 | 南京农业大学 | A kind of vivoexpression of pears PbrRALF2 protein and its preparation method of polyclonal antibody |
Non-Patent Citations (1)
| Title |
|---|
| 北方果树果实细胞壁降解相关酶基因研究进展;刘琦等;《烟台果树》;20201015(第04期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111139257A (en) | 2020-05-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109369790A (en) | The white blight resistance-associated protein OsBBR1 of rice and its encoding gene and application | |
| CN104946665B (en) | GmMYB62Application in cultivating transgenic plant with improved stress resistance | |
| CN109400688A (en) | The application of OsHAP2C and its encoding gene in adjusting and controlling rice bacterial leaf spot resistance | |
| CN113563442B (en) | Drought-resistant related protein IbSPB1, and coding gene and application thereof | |
| CA2935104C (en) | Transformed plant and method for producing exudate containing sugar using transformed plant | |
| CN110066325B (en) | Application of Os01g0144100 and coding gene thereof in regulating and controlling plant disease resistance | |
| CN111139257B (en) | Pear PMEI protein in-vitro expression method and application thereof | |
| CN109913469B (en) | Transcription factor PpNAC1 involved in synthesis and regulation of peach ester aromatic substances and application thereof | |
| CN1821395B (en) | Rice mitogen-activated protein kinase and its coded gene and use | |
| CN112342221A (en) | Prokaryotic expression and protein purification method for negative regulation of NtARF6 protein in tobacco alkaloid synthesis | |
| CN110551697A (en) | Application of ergothioneine synthetase PEGT1 and PEGT2 of Pleurotus ostreatus in synthesis of ergothioneine | |
| CN111574604B (en) | Wheat disease-resistant protein TaAFRK and related biological material and application thereof | |
| CN110819649A (en) | In-vitro expression method of recombinant pectin methylesterase PbrPME, coding gene and application thereof | |
| CN113817758A (en) | Chitosan enzyme gene for encoding Bacillus belgii, chitosanase, preparation method and application thereof | |
| CN103254298B (en) | Plant-biological-yield related protein BrSTON1, and coding gene and applications thereof | |
| CN112391367A (en) | Preparation method of Cas9 protein for gene editing of human primary cells | |
| CN111217899A (en) | Transcription factor PpbHLH1 involved in synthesis and regulation of linalool from peach trees and application thereof | |
| CN115029355B (en) | Peanut C2 structural domain protein coding gene AhSRC2 and application thereof | |
| CN116970621B (en) | Salvia miltiorrhizae stress-resistance related protein SmDREB2A and encoding gene and application thereof | |
| CN110257361A (en) | A kind of algin catenase and its gene and application | |
| CN112048490B (en) | Cotton silk/threonine protein phosphatase GhTPOPP 6 and coding gene and application thereof | |
| CN116064463B (en) | Tomato gene SlPKG and application of encoding protein thereof in disease resistance | |
| CN114805520B (en) | Stress resistance related protein IbGT1, encoding gene and application thereof | |
| CN113061172B (en) | Plant salt tolerance related LIP1 protein and related biological material and application thereof | |
| CN106967727B (en) | Rape photosynthetic efficiency related gene perg, preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |