CN110878341A - Primer group, kit and method for detecting blood exosome miRNA - Google Patents
Primer group, kit and method for detecting blood exosome miRNA Download PDFInfo
- Publication number
- CN110878341A CN110878341A CN201911305363.5A CN201911305363A CN110878341A CN 110878341 A CN110878341 A CN 110878341A CN 201911305363 A CN201911305363 A CN 201911305363A CN 110878341 A CN110878341 A CN 110878341A
- Authority
- CN
- China
- Prior art keywords
- mirna
- probe
- sequence
- primer
- primer set
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 108091070501 miRNA Proteins 0.000 title claims abstract description 39
- 239000002679 microRNA Substances 0.000 title claims abstract description 38
- 210000001808 exosome Anatomy 0.000 title claims abstract description 31
- 239000008280 blood Substances 0.000 title claims abstract description 21
- 210000004369 blood Anatomy 0.000 title claims abstract description 21
- 238000000034 method Methods 0.000 title claims abstract description 19
- 239000000523 sample Substances 0.000 claims description 34
- 238000006243 chemical reaction Methods 0.000 claims description 18
- 230000003321 amplification Effects 0.000 claims description 15
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 15
- 108091028049 Mir-221 microRNA Proteins 0.000 claims description 10
- 238000001514 detection method Methods 0.000 claims description 10
- 239000007788 liquid Substances 0.000 claims description 9
- 108091086416 miR-192 stem-loop Proteins 0.000 claims description 5
- 108091062762 miR-21 stem-loop Proteins 0.000 claims description 5
- 108091041631 miR-21-1 stem-loop Proteins 0.000 claims description 5
- 108091044442 miR-21-2 stem-loop Proteins 0.000 claims description 5
- 108091061917 miR-221 stem-loop Proteins 0.000 claims description 5
- 108091063489 miR-221-1 stem-loop Proteins 0.000 claims description 5
- 108091055391 miR-221-2 stem-loop Proteins 0.000 claims description 5
- 108091031076 miR-221-3 stem-loop Proteins 0.000 claims description 5
- 108091080321 miR-222 stem-loop Proteins 0.000 claims description 5
- 150000007523 nucleic acids Chemical group 0.000 claims description 5
- 108091028695 MiR-224 Proteins 0.000 claims description 3
- 239000012295 chemical reaction liquid Substances 0.000 claims description 2
- 238000012408 PCR amplification Methods 0.000 abstract description 5
- 108090000623 proteins and genes Proteins 0.000 abstract description 4
- 230000035945 sensitivity Effects 0.000 abstract description 4
- 230000008901 benefit Effects 0.000 abstract description 3
- 238000007847 digital PCR Methods 0.000 abstract description 2
- 238000005516 engineering process Methods 0.000 abstract description 2
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 7
- 239000000203 mixture Substances 0.000 description 5
- 239000006228 supernatant Substances 0.000 description 5
- 238000000605 extraction Methods 0.000 description 4
- 239000004005 microsphere Substances 0.000 description 4
- 238000001179 sorption measurement Methods 0.000 description 4
- 238000004458 analytical method Methods 0.000 description 3
- 238000005119 centrifugation Methods 0.000 description 3
- 239000012154 double-distilled water Substances 0.000 description 3
- 230000006870 function Effects 0.000 description 3
- 230000014509 gene expression Effects 0.000 description 3
- 201000007270 liver cancer Diseases 0.000 description 3
- 208000014018 liver neoplasm Diseases 0.000 description 3
- 238000002156 mixing Methods 0.000 description 3
- 108020004707 nucleic acids Proteins 0.000 description 3
- 102000039446 nucleic acids Human genes 0.000 description 3
- 238000011160 research Methods 0.000 description 3
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 2
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 2
- 238000000018 DNA microarray Methods 0.000 description 2
- 102000004190 Enzymes Human genes 0.000 description 2
- 108090000790 Enzymes Proteins 0.000 description 2
- PEDCQBHIVMGVHV-UHFFFAOYSA-N Glycerine Chemical compound OCC(O)CO PEDCQBHIVMGVHV-UHFFFAOYSA-N 0.000 description 2
- TWRXJAOTZQYOKJ-UHFFFAOYSA-L Magnesium chloride Chemical compound [Mg+2].[Cl-].[Cl-] TWRXJAOTZQYOKJ-UHFFFAOYSA-L 0.000 description 2
- 206010028980 Neoplasm Diseases 0.000 description 2
- 238000000636 Northern blotting Methods 0.000 description 2
- 238000011529 RT qPCR Methods 0.000 description 2
- 230000009471 action Effects 0.000 description 2
- 210000004027 cell Anatomy 0.000 description 2
- 239000002299 complementary DNA Substances 0.000 description 2
- 230000004907 flux Effects 0.000 description 2
- 108091030938 miR-424 stem-loop Proteins 0.000 description 2
- 238000005497 microtitration Methods 0.000 description 2
- 239000002244 precipitate Substances 0.000 description 2
- 238000010839 reverse transcription Methods 0.000 description 2
- 210000001519 tissue Anatomy 0.000 description 2
- 239000002699 waste material Substances 0.000 description 2
- QKNYBSVHEMOAJP-UHFFFAOYSA-N 2-amino-2-(hydroxymethyl)propane-1,3-diol;hydron;chloride Chemical compound Cl.OCC(N)(CO)CO QKNYBSVHEMOAJP-UHFFFAOYSA-N 0.000 description 1
- 108020004414 DNA Proteins 0.000 description 1
- 108091092584 GDNA Proteins 0.000 description 1
- 102100034343 Integrase Human genes 0.000 description 1
- 238000010802 RNA extraction kit Methods 0.000 description 1
- 108010092799 RNA-directed DNA polymerase Proteins 0.000 description 1
- 206010064390 Tumour invasion Diseases 0.000 description 1
- 230000002159 abnormal effect Effects 0.000 description 1
- 230000030741 antigen processing and presentation Effects 0.000 description 1
- 239000008346 aqueous phase Substances 0.000 description 1
- 210000000270 basal cell Anatomy 0.000 description 1
- 238000010009 beating Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 210000004204 blood vessel Anatomy 0.000 description 1
- 238000007664 blowing Methods 0.000 description 1
- 210000001124 body fluid Anatomy 0.000 description 1
- 239000010839 body fluid Substances 0.000 description 1
- 238000010804 cDNA synthesis Methods 0.000 description 1
- 230000009400 cancer invasion Effects 0.000 description 1
- 230000024245 cell differentiation Effects 0.000 description 1
- 230000012292 cell migration Effects 0.000 description 1
- 230000003247 decreasing effect Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 230000018109 developmental process Effects 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 238000001976 enzyme digestion Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 235000011187 glycerol Nutrition 0.000 description 1
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 1
- 239000010931 gold Substances 0.000 description 1
- 229910052737 gold Inorganic materials 0.000 description 1
- 230000028993 immune response Effects 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 230000035992 intercellular communication Effects 0.000 description 1
- 230000009545 invasion Effects 0.000 description 1
- 238000011068 loading method Methods 0.000 description 1
- 230000033001 locomotion Effects 0.000 description 1
- 229910001629 magnesium chloride Inorganic materials 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 239000012528 membrane Substances 0.000 description 1
- 238000002493 microarray Methods 0.000 description 1
- 238000010208 microarray analysis Methods 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 239000012071 phase Substances 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 239000000047 product Substances 0.000 description 1
- 238000011002 quantification Methods 0.000 description 1
- 238000011084 recovery Methods 0.000 description 1
- 125000006853 reporter group Chemical group 0.000 description 1
- 230000000717 retained effect Effects 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 238000012546 transfer Methods 0.000 description 1
- 210000004881 tumor cell Anatomy 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention aims to provide a primer group, a kit and a method for detecting blood exosome miRNA, wherein miRNA is detected by adopting a droplet type digital PCR technology, samples are subjected to micro-droplet processing before traditional PCR amplification, each droplet is detected one by one after the PCR amplification, whether a target molecule to be detected is contained or not is judged according to the existence or nonexistence of fluorescence, the copy number of an initial template can be directly calculated without an internal reference gene, and the primer group, the kit and the method have the technical advantages of high sensitivity, high accuracy and high efficiency.
Description
Technical Field
The invention relates to the technical field of molecular biology, in particular to a primer group, a kit and a method for detecting blood exosome miRNA.
Background
With the extensive research on the biological origin of exosomes, their substance composition and transport, the conduction of intercellular signals and distribution in body fluids, exosomes were found to have a wide variety of functions. The function of exosomes depends on the cell type from which they are derived, and they can participate in aspects such as immune response, antigen presentation, cell migration, cell differentiation, tumor invasion, etc. Research shows that tumor-derived exosomes participate in the exchange of genetic information between tumor cells and basal cells, so that a large amount of new blood vessels are generated, and the growth and invasion of tumors are promoted. Exosomes, considered as specifically secreted membrane vesicles, are involved in intercellular communication, both to study their function and to understand how they are used in the development of minimally invasive diagnostics, leading to an increasing interest in exosomes from the research community.
miRNAs in exosomes can stably exist in blood, and the current methods for detecting miRNAs mainly comprise Northern blot analysis, microarray analysis and quantitative real-time PCR. Northern blot analysis requires a large amount of samples, involves a large amount of manual operations, is not suitable for large-scale screening experiments, and has weak repeatability, long time consumption and low flux. The microarray requires a large initial sample of RNA and it is not possible to clearly distinguish mirnas with small sequence differences. Although the sensitivity of quantitative real-time PCR detection is improved, the actual requirements cannot be met, and the initial copy number cannot be obtained by absolute quantification due to the lack of an internal reference gene.
Disclosure of Invention
The invention aims to provide a primer group, a kit and a method for detecting blood exosome miRNA, which have the technical advantages of high sensitivity, high accuracy and high efficiency.
In order to achieve the purpose, the invention adopts the following technical scheme:
the invention provides a primer group for detecting blood exosome miRNA, which comprises the following primer pairs:
primer pair 2 upstream primer: GATGCCATCAGAGACCCAGT the flow of the air in the air conditioner,
a downstream primer: TGATCCAAAGAAAATGTGCAA, respectively;
preferably, the primer set further comprises the following probes:
probe 1, sequence: AGAACATGTTTCCAGGTAGCCTGAA, respectively;
probe 2, sequence: TACACTGGCTACTGAGCCATTGAGG, respectively;
probe 3, sequence: AGACTGATGTTGACTGTTGAATCTC, respectively;
probe 4, sequence: AGTCACTAGGGCACCATTTTGAAAC, respectively;
probe 5, sequence: AACATACCTGTGACCTATGGAATTG are provided.
Preferably, the miRNA comprises:
miR-221, sequence: AAATCTACATTGTATGCCAGGT, respectively;
miR-222, sequence: AGGATCTACACTGGCTACTGAG, respectively;
miR-21, sequence: TAGCTTATCAGACTGATGTTGA, respectively;
miR-224, sequence: CTAAACGGAACCACTAGTGACTTGAAAGCCC, respectively;
miR-192, sequence: GGCTGTCAATTCATAGGTCAG are provided.
The invention also provides a kit for detecting the blood exosome miRNA, which comprises the primer group.
The invention also provides a method for detecting blood exosome miRNA, which comprises the following steps:
1) extracting exosome miRNA of blood to be detected;
2) preparing an amplification reaction system of miRNA;
3) generating reaction liquid drops, and wrapping an amplification reaction system in the liquid drops;
4) amplifying the nucleic acid fragment to be detected in the liquid drop according to a reaction program;
5) the detection results were analyzed using a droplet analyzer.
Preferably, the amplification reaction system employs the following primer sets:
1, probe 1: AGAACATGTTTCCAGGTAGCCTGAA, respectively;
and (3) probe 2: TACACTGGCTACTGAGCCATTGAGG, respectively;
and 3, probe 3: AGACTGATGTTGACTGTTGAATCTC, respectively;
and 4, probe 4: AGTCACTAGGGCACCATTTTGAAAC, respectively;
and 5, probe: AACATACCTGTGACCTATGGAATTG are provided.
Preferably, in step 2), each 25. mu.L of the amplification reaction system comprises:
preferably, in step 3), the volume ratio of the amplification reaction system to the droplet-forming oil is 1: 1.0-2.0.
Preferably, in step 4), the reaction procedure is:
95℃，5min；
40 cycles of 95 deg.C, 30min, 60 deg.C, 30 min;
72℃，10min；
keeping at 4 ℃.
The miRNA is detected by adopting a micro-drop digital PCR technology, and a sample is subjected to micro-titration treatment before traditional PCR amplification, namely a reaction system containing nucleic acid molecules is divided into micro-drops with tens of thousands of nano-scale, wherein each micro-drop does not contain the nucleic acid target molecules to be detected or contains one or more nucleic acid target molecules to be detected. After PCR amplification, each microdroplet is detected one by one, whether the microdroplet contains the target molecule to be detected is judged according to the existence or nonexistence of fluorescence, and the copy number of the initial template can be directly calculated without internal reference genes.
The invention has the following beneficial effects:
1. the used sample is a blood exosome, and noninvasive detection is realized;
2. the micro-titration of the reaction field greatly reduces the requirement on the initial sample amount, and a 10pg template can be detected, so that the detection sensitivity is high;
3. the copy number of the target molecule can be directly read without depending on the Cq value or an internal reference gene, so that high accuracy is realized;
4. the method has the advantages of few operation steps and short time consumption, improves the flux of one-time detection, and greatly shortens the detection period.
Drawings
FIG. 1 is a diagram showing the detection result of miRNA in the blood exosomes of a liver cancer patient in the embodiment of the present invention.
Detailed Description
The present invention will be further described by the following specific embodiments with reference to the attached drawings, and it should be understood that the following embodiments do not limit the scope of the present invention. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Examples
One, related miRNA and sequence thereof
miR-221：AAATCTACATTGTATGCCAGGT；
miR-222：AGGATCTACACTGGCTACTGAG；
miR-21：TAGCTTATCAGACTGATGTTGA；
miR-224：CTAAACGGAACCACTAGTGACTTGAAAGCCC；
miR-192：GGCTGTCAATTCATAGGTCAG。
Second, detection primer and probe sequence
Thirdly, experimental steps:
1. blood samples from liver cancer patients were obtained from the cooperative hospital with patient consent (all signed informed consent).
2. Extraction of blood exosome miRNA
1) Blood exosome extraction
Extraction kit adopting full-type gold exosomes
A. A fresh blood sample was taken and centrifuged at 3000g for 15 minutes at 4 ℃ in 100. mu.l aliquots to remove residual cells and debris.
B. Add 25. mu.l EPS and mix well, 4 degrees C stand 30 minutes, 10000g centrifuge 10 minutes.
C. The precipitate was collected by discarding the supernatant, centrifuged again at 4 ℃ for 30 minutes at 3000g, and the supernatant was carefully discarded.
D. Adding 50 mul ERS solution, and gently blowing and beating the solution by a pipette to resuspend the precipitate to obtain the exosome.
E. Taking 1 tube of EMB microspheres, centrifuging for 3 minutes at 4000g, discarding supernatant, retaining microspheres, adding 1ml of ERS solution, and mixing well.
F. Centrifugation at 4000g for 3 minutes was carried out, the supernatant carefully discarded and the microspheres retained.
G. The obtained exosome solution is added into microspheres and gently mixed for 2 hours at 4 ℃.
H. Centrifuging at 4 ℃ for 3 minutes at 4000g, and carefully sucking the supernatant into a new centrifuge tube to obtain the purified exosome.
2) Extraction of exosome miRNA
The German Qiagen RNA extraction kit is adopted.
A. 1ml of QIAzol was added to the exosomes and lysed at room temperature for 5 min.
B. To the QIAzol solution was added 200. mu.l of chloroform, followed by vigorous shaking, standing for 5min, centrifugation at 4 ℃ and recovery of the aqueous phase.
C. Mixing the water phase with 0.5 times of ethanol, transferring into a miRspin centrifugal column for centrifugation, and discarding the centrifugal column to retain the centrifuged liquid.
D. Mixing the centrifugate with 0.75 times of anhydrous ethanol, centrifuging in a miRelute centrifugal column, and keeping the centrifugal column.
E. Mu.l of deproteinized solution MRD (please check whether ethanol has been added or not) was added to the adsorption column miRelute, and the mixture was allowed to stand at room temperature for 2min, centrifuged at 12,000rpm (. about.13, 400 Xg) at room temperature for 30sec, and the waste liquid was discarded.
F. To the adsorption column miRelute was added 500. mu.l of the rinse solution RW (please check whether ethanol was added or not), left to stand at room temperature for 2min, centrifuged at 12,000rpm (. about.13, 400 Xg) at room temperature for 30sec, and the waste solution was discarded.
G. The adsorption column, mirelulite, was placed in a 2ml collection tube and centrifuged at 12,000rpm (-13, 400 Xg) for 1min at room temperature to remove residual liquid.
H. Transfer the adsorption column miRelute into a new RNase-Free 1.5ml centrifuge tube, add 15-30. mu.l RNase-Free ddH2O, stand at room temperature for 2min, centrifuge at room temperature for 2min at 12,000rpm (. about.13, 400 Xg). Obtaining the miRNA.
3) Reverse transcription
Reverse transcription was performed using the nuozoken kit.
① genomic DNA removal
System of
| dd H2O | 7μL |
| 5*gDNA Wiper Mix | 2μL |
| RNA | 1μL |
Reaction procedure
42℃ 2min
② cDNA Synthesis
System of
| dd H2O | 5μL |
| The mixed liquid of the last step | 10μL |
| primer | 1μL |
| 10*RT Mix | 2μL |
| Enzyme Mix | 2μL |
Gently blow with a pipette.
Procedure for measuring the movement of a moving object
| 25℃ | 5min |
| 50℃ | 15min |
| 85℃ | 5min |
3. Preparing an amplification reaction system
An experimental system, a negative system and a blank control are prepared. The negative system template uses miRNA of healthy people; blank control with no template added, ddH2O make up volume.
| System of | Volume/. mu.L |
| ddH2O | 10.75 |
| 5*buffer | 5 |
| dNTP | 1 |
| Primer F | 1.5 |
| Primer R | 1.5 |
| Probe needle | 0.75 |
| Taq enzyme | 1 |
| miRNA | 0.5 |
| 1％BIC | 1 |
| 1％SDS | 1 |
| Glycerine | 1 |
5 buffer comprised 250mM KCl, 50mM Tris-HCl (pH 8.3) and 8mM MgCl2。
4. Droplet generation
1) The power to the dropmaker sample preparation instrument is turned on.
2) And checking whether the chip is normal.
3) The chip is placed in the 8 rows and the chip is noted with the notch direction.
4) 25 μ L of the sample reaction solution system was added to the well of the chip, and the tip of the tip was extended to the lowest position of the chip during loading, taking care not to hit air bubbles.
5) Add 40. mu.L of droplet generating oil to the oil fill hole of the chip.
6) And covering a rubber ring, covering an instrument cover, opening a switch and starting to generate liquid drops. Generally 2-3 min, and finally 106An order of magnitude of droplets.
5. Amplification of
After the droplets were generated, they were placed in an 8-line array placed in advance, capped, and the sequence of samples marked with a marker pen was put into a PCR instrument (Bio-rad T100) for amplification. The reaction process is that miRNA is firstly changed into cDNA under the action of reverse transcriptase, and then the cDNA is combined with primer and amplified under the action of polymerase. During amplification, the probe is degraded by enzyme digestion, the 5' reporter group emits a fluorescent signal, and the intensity of fluorescence increases along with the increase of the amount of the product.
And (3) amplification procedure:
6. the result of the detection
After PCR amplification, the amplified drop is injected into the biochip by analyzing with a micro-drop analyzer, and the shape and darkness of the drop in the biochip can be seen on the screen by adjusting the focal length of the analyzer and the position of the corresponding hole, as shown in FIG. 1. And then calculated using the poisson probability distribution formula. Namely:
7. analysis of results
And comparing the expression of the miRNA to be detected in the experimental result with the negative system data, and judging whether the miRNA in the sample is abnormal or not. As shown in the following table: the expressions of miR-221, miR-21 and miR-192 are obviously increased, the expressions of miR-222 and miR-424 are obviously decreased, and the experimental sample is positive.
| miRNA | Liver cancer tissue | Non-cancerous tissue | Difference by multiple |
| miR-221 | 16585.22 | 3，641.4 | 4.56 |
| miR-222 | 971.8 | 4034.39 | -4.15 |
| miR-21 | 189758.19 | 68433.86 | 2.77 |
| miR-424 | 98.38 | 483.13 | -5.00 |
| miR-192 | 1865.69 | 627.85 | 2.97 |
Claims (9)
1. A primer group for detecting blood exosome miRNA comprises the following primer pairs:
primer pair 1:
primer set 2
Primer set 3
Primer set 4
Primer set 5
2. The primer set for detecting miRNA of claim 1, further comprising the following probes:
probe 1, sequence: AGAACATGTTTCCAGGTAGCCTGAA, respectively;
probe 2, sequence: TACACTGGCTACTGAGCCATTGAGG, respectively;
probe 3, sequence: AGACTGATGTTGACTGTTGAATCTC, respectively;
probe 4, sequence: AGTCACTAGGGCACCATTTTGAAAC, respectively;
probe 5, sequence: AACATACCTGTGACCTATGGAATTG are provided.
3. The primer set for detecting miRNA of claim 1, wherein the miRNA comprises:
miR-221, sequence: AAATCTACATTGTATGCCAGGT, respectively;
miR-222, sequence: AGGATCTACACTGGCTACTGAG, respectively;
miR-21, sequence: TAGCTTATCAGACTGATGTTGA, respectively;
miR-224, sequence: CTAAACGGAACCACTAGTGACTTGAAAGCCC, respectively;
miR-192, sequence: GGCTGTCAATTCATAGGTCAG are provided.
4. A kit for detecting miRNA of blood exosomes, comprising the primer set for detecting miRNA of blood exosomes according to any one of claims 1 to 3.
5. A method of detecting a blood exosome miRNA, comprising:
1) extracting exosome miRNA of blood to be detected;
2) preparing an amplification reaction system of miRNA;
3) generating reaction liquid drops, and wrapping an amplification reaction system in the liquid drops;
4) amplifying the nucleic acid fragment to be detected in the liquid drop according to a reaction program;
5) the detection results were analyzed using a droplet analyzer.
6. The method for detecting miRNA of claim 5, wherein the following primer sets are adopted in the amplification reaction system:
primer pair 1:
1, probe 1: AGAACATGTTTCCAGGTAGCCTGAA, respectively;
primer set 2
And (3) probe 2: TACACTGGCTACTGAGCCATTGAGG, respectively;
primer set 3
And 3, probe 3: AGACTGATGTTGACTGTTGAATCTC, respectively;
primer set 4
And 4, probe 4: AGTCACTAGGGCACCATTTTGAAAC, respectively;
primer set 5
And 5, probe: AACATACCTGTGACCTATGGAATTG are provided.
7. The method according to claim 6, wherein in the step 2), each 25 μ L of the amplification reaction system comprises:
8. the method for detecting miRNA of claim 7, wherein in step 4), the reaction procedure is as follows:
95℃，5min；
40 cycles of 95 deg.C, 30min, 60 deg.C, 30 min;
72℃，10min；
keeping at 4 ℃.
9. The method for detecting miRNA of claim 5, wherein in the step 3), the volume ratio of the amplification reaction system to the droplet generation oil is 1: 1.0-2.0.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911305363.5A CN110878341A (en) | 2019-12-18 | 2019-12-18 | Primer group, kit and method for detecting blood exosome miRNA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911305363.5A CN110878341A (en) | 2019-12-18 | 2019-12-18 | Primer group, kit and method for detecting blood exosome miRNA |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110878341A true CN110878341A (en) | 2020-03-13 |
Family
ID=69730986
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911305363.5A Pending CN110878341A (en) | 2019-12-18 | 2019-12-18 | Primer group, kit and method for detecting blood exosome miRNA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110878341A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101755208A (en) * | 2007-07-25 | 2010-06-23 | 路易斯维尔大学研究基金会公司 | Allochthon associated microRNA as diagnostic marker |
| CN102292457A (en) * | 2008-11-25 | 2011-12-21 | 简·探针公司 | Compositions and methods for detecting small rnas, and uses thereof |
| CN102892897A (en) * | 2009-12-24 | 2013-01-23 | 复旦大学 | Compositions and methods for microrna expression profiling of lung cancer |
| CN106636440A (en) * | 2017-02-20 | 2017-05-10 | 南京九寿堂医药科技有限公司 | Application of plasma microRNAs to preparation of diagnosis reagent for screening and diagnosing lung adenocarcinoma patients from male population |
| CN109913547A (en) * | 2019-03-01 | 2019-06-21 | 浙江大学医学院附属妇产科医院 | A kind of blood plasma excretion body miRNA molecule marker and its application in reagent preparation box |
| CN110144400A (en) * | 2019-04-22 | 2019-08-20 | 浙江大学 | Excretion body miRNA is preparing the application in diagnosing cancer of liver product |
-
2019
- 2019-12-18 CN CN201911305363.5A patent/CN110878341A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101755208A (en) * | 2007-07-25 | 2010-06-23 | 路易斯维尔大学研究基金会公司 | Allochthon associated microRNA as diagnostic marker |
| CN102292457A (en) * | 2008-11-25 | 2011-12-21 | 简·探针公司 | Compositions and methods for detecting small rnas, and uses thereof |
| CN102892897A (en) * | 2009-12-24 | 2013-01-23 | 复旦大学 | Compositions and methods for microrna expression profiling of lung cancer |
| CN106636440A (en) * | 2017-02-20 | 2017-05-10 | 南京九寿堂医药科技有限公司 | Application of plasma microRNAs to preparation of diagnosis reagent for screening and diagnosing lung adenocarcinoma patients from male population |
| CN109913547A (en) * | 2019-03-01 | 2019-06-21 | 浙江大学医学院附属妇产科医院 | A kind of blood plasma excretion body miRNA molecule marker and its application in reagent preparation box |
| CN110144400A (en) * | 2019-04-22 | 2019-08-20 | 浙江大学 | Excretion body miRNA is preparing the application in diagnosing cancer of liver product |
Non-Patent Citations (3)
| Title |
|---|
| WON SOHN等: "Serum exosomal microRNAs as novel biomarkers for hepatocellular carcinoma", 《EXPERIMENTAL & MOLECULAR MEDICINE》 * |
| 张芳雍等: "外泌体非编码 ＲＮＡ 在肝癌液体活检中的研究进展", 《国际肿瘤学杂志》 * |
| 曾溢滔主编: "《遗传病分子基础与基因诊断》", 31 December 2017, 上海科学技术出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104946739B (en) | EGFR genetic mutation detection kit and its application | |
| CN108048466A (en) | The crRNA and system of CRISPR-Cas13a systemic characteristics targeting people's RSPO2 genes and application | |
| CN107012220A (en) | It is a kind of to utilize the method for matching the unicellular inclusion of micro-fluidic chip high throughput analysis | |
| CN110724741B (en) | Primer, probe and kit for detecting minimal residual leukemia related fusion gene | |
| CN109517881A (en) | A kind of high-throughput sequencing library construction method of body fluid micro free RNA | |
| CN108796086A (en) | A kind of circular rna circBCBM1 and its nondiagnostic fluorescence quantitative detecting method | |
| CN111424087A (en) | Detection Panel for pan-cancer species detection or targeted drug application based on next-generation sequencing, kit and application | |
| CN108796074A (en) | Detect application and kit of the reagent of circular rna circRNF13 on preparing tumour auxiliary diagnosis preparation | |
| CN109402262B (en) | PCR detection kit for auxiliary diagnosis of neuroblastoma and method for detecting miR-199a-3p expression level | |
| CN108048565A (en) | A kind of primer for detecting ApoE gene pleiomorphisms and its detection method and application | |
| CN111518877A (en) | One-tube method nest type real-time quantitative PCR detection kit for detecting echinococcus multilocularis and echinococcus granulosus by parting trace samples | |
| CN110484625A (en) | For detecting primer combination of probe object, kit and the detection method of PRKY gene methylation | |
| CN109251964A (en) | Recycle the method and application of microRNAs detection kit and specific detection circulation microRNAs | |
| CN116445608B (en) | Composition for detecting deafness-related gene mutation, kit and application | |
| CN105176995B (en) | Thalassemia α can be detected simultaneously based on hydrolysis probes method21.9The kit that deletion form and α 2 make a variation | |
| CN107058579A (en) | Adenocarcinoma of lung related miRNA, composition and its application | |
| CN109371122B (en) | Reference gene for panda milk miRNA detection and application thereof | |
| CN109536502B (en) | PCR (polymerase chain reaction) internal reference applicable to plasma exosome miRNA of patient with gestational trophoblastic tumor | |
| CN110878341A (en) | Primer group, kit and method for detecting blood exosome miRNA | |
| WO2022134225A1 (en) | Marker gene for identifying and classifying dpc cell, screening method therefor and use thereof | |
| CN108660213A (en) | The application of three kinds of non-coding RNA reagents of detection and kit | |
| CN104651492B (en) | Applications of the miRNA410 in prostatic cancer diagnostic reagent kit is prepared | |
| CN108165546A (en) | A kind of miRNA biomarker, composition and application thereof | |
| CN112609002A (en) | Peripheral blood miRNA colon cancer diagnosis marker combination and detection kit thereof | |
| CN114381519A (en) | Serum miRNA marker combination for breast cancer auxiliary diagnosis and detection kit thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200313 |