CN110845604B - African swine fever preventing and/or treating neutralizing antibody, preparation method and application thereof - Google Patents

Abstract

The invention provides an African swine fever preventing and/or treating neutralizing antibody, which is a chimeric monoclonal antibody and comprises a heavy chain and a light chain, wherein the variable region of the light chain has the amino acid sequence shown in SEQ ID No:6 and the heavy chain variable region has a sequence shown in SEQ ID No:2, the light chain constant region and the heavy chain constant region are both derived from porcine antibodies. The invention also provides a gene encoding the chimeric monoclonal antibody, an expression vector or a transformant containing the encoding gene, and the like. The expression vector can be obtained by inserting the coding gene into pAAV-CAG vector. The invention also provides a method for preparing AAV by using the expression vector. The antibody sequence or the transformant and the like provided by the invention can be used for preparing a detection reagent of the African swine fever virus, a medicament for inducing an immune response to an African swine fever virus antigen in a tested animal or a medicament for preventing the animal from being infected by the African swine fever virus, and provides rapid and long-lasting antibody protection, such as an African swine fever virus vaccine.

Description

African swine fever preventing and/or treating neutralizing antibody, preparation method and application thereof

Technical Field

The invention relates to a neutralizing antibody, in particular to an African swine fever preventing and/or treating neutralizing antibody, a preparation method and application thereof, and belongs to the technical field of animal immune drugs.

Background

African Swine Fever (ASF) is an acute, febrile, highly contagious disease of pigs caused by African Swine Fever Virus (ASFV), and is clinically manifested as high fever, cutaneous congestion, edema, generalized bleeding of organs, and changes in respiratory and nervous system functions. The disease has short morbidity process, a latent period of 5-15 days, high morbidity and mortality, and even the mortality can reach 100%. In countries or regions infected by this pathogen, huge economic losses can be caused, food safety is seriously threatened and the pig industry is affected. The world animal health Organization (OIE) classifies the disease as a type A epidemic disease, and the disease is specified as an animal disease in China.

The ASFV is an icosahedral symmetrical structure with a diameter of 175-215 nm. The virus nucleic acid is double-stranded DNA, has the length of 170 kb-190 kb, contains 151 open reading frames, and can encode 150-200 proteins, wherein the main structural proteins of virus particles comprise P72, P54, P220, P62, CD2V and the like. The P54 protein is used as a main structural protein of the African swine fever virus, is a main binding site of a serum antibody, has good immunogenicity, and can be used as a marker for early detection of the African swine fever virus.

The resistance of the African swine fever virus in tissues and environment is strong, no effective treatment measures exist at present, the most effective method in the whole world is to kill all pigs in an epidemic area and nearby areas, and disastrous results are brought to pig raising enterprises and pig farmers.

Moreover, there is currently no vaccine that is particularly effective against african swine fever. Vaccines prepared by traditional methods, such as purified and inactivated virus, formaldehyde inactivated virus-infected porcine alveolar macrophages, and porcine infected peripheral blood leukocyte supernatants do not induce protective immunity. That is, cellular immunity and humoral immunity are limited in preventing and treating infection of African swine fever and in eliminating viruses in general.

Early results of the study tended to suggest that African swine fever virus could not induce the production of neutralizing antibodies (HessWR.1981.African swine fever mover: a reassessment. Advances in veterinary science and comparative media 25:39-69) because the detection of neutralizing antibodies using the plaque reduction method was difficult, and more particularly, because the formation of macroscopic plaques was very difficult with some isolated ASFVs, especially ASFVs with a low number of generations. However, with the advancement of research methods, the detection of viruses has been facilitated by introducing marker genes into viruses, and more studies have been carried out on neutralization of serum or monoclonal antibodies of some isolated ASFVs recovered from infection with viruses (Borca MV, Irusta P, Carrillo C, Afanso CL, Burrage T, RockDL.1994.African switch virus structural protein P72 antibodies for neutral epitope 201: 413-418; Gomez-Puertas P, Rodriguez F, Oedio, Ramio-Ibannez F, Ruiz-Gonzaro F, Alonso C, Escribane D. 1996.Neutralizing virus to viral infection of viral infection 19, vitamin K J. J.R. F5632. and F, vitamin K J.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R.R, carnero ME, Caballero C, Martinez J.1986.inhibition of African Swinhaeffector infection in the presence of immune sera in vivo and in vitro. am J VetRs 47: 1249-1252; ruiz Gonzalvo F, Cabillaro C, Martinez J, CarneroME.1986.Neutralization of African swine farm by sera from African swine farm by-resistant pigs. am J Vet Res 47: 1858-1862). There are at least two mechanisms by which sera from pigs immunized with live attenuated vaccines neutralize viral infection of Vero or porcine alveolar macrophages. One mechanism is to prevent binding of the virus to the cell, and the other mechanism is to prevent endocytosis of the virus (Gomez-Puertas P, Rodriguez F, Ovido JM, Ramiro-Ibanez F, Ruiz-Gonzalo F, Alonso C, Escribano JM.1996.neutral antibodies to differential proteins of African swineverture virus in vivo virus tissue attachment and interaction. journal of virology70: 5689-.

Studies of sera from pigs infected with virus that are recovering health have shown that the P72, P30, and P54 proteins are the three most immunogenic outer membrane proteins in ASFV (Afanso CL, Alcaraz C, Brun A, Sussman MD, Onisk DV, Escribano JM, Rock DL.1992. Characterisation of P30, a high antibody membrane and secreted protein of African swine farm virus, virology 189: 373). Antibodies against P72 and P54 proteins neutralize the virus only before the virus adsorbs susceptible cells, while anti P30 antibodies neutralize the virus before or after the virus adsorbs susceptible cells. Therefore, it is considered that the antibodies against P72 and P54 inhibit the first step of the viral replication cycle, i.e., the viral adsorption process. While antibodies against the P30 protein inhibit the endocytosis of the virus (Gomez-Puertas P, Rodriguez F, Ovido JM, Ramiro-Ibanez F, Ruiz-Gonzalo F, Alonso C, Escribano JM.1996. neutralling antibodies to differential proteins of African swinevirus with bit virus attachment and interaction. journal of virology70: 5689-.

Treatment of ASFV virus with detergent releases the P30 and P54 proteins, which are able to adsorb to the surface of ASFV-sensitive porcine alveolar macrophages, and this adsorption can be inhibited by the corresponding antibodies. In addition, the insect cells are used for expressing ASFV hemagglutinin protein CD2V, a protein homologous with CD2 protein, and the immune pig can generate temporary hemagglutination inhibition antibody.

The porcine immune attenuated strain OUR/T88/3 was able to defend against challenge by the homologous virulent strain OUR/T88/1, but when CD8+ lymphocytes in vivo were depleted, it was not able to completely defend against challenge by the virulent strain, suggesting that cellular immunity of CD8+ lymphocytes plays a critical role in immune protection, whereas neutralizing antibodies alone are not able to adequately defend against virus challenge (Gomez-Puertas P, Rodriguez F, Ovido JM, Ramio-Ibanez F, Ruiz-Gonzalo F, Alonso C, Esacro JM.1996.neutral antibodies, colloidal protein of animal virus in vivo virus infection bone virus infection, Golvo virus infection, Golvin J12547, Marlvin J12547, CaballeroC, Martinez J, Carnero ME.1986.Neutralization of African swing boiler virus from African swing boiler-resistant pills. am J Vet Res 47: 1858-; barderas MG, Rodriguez F, Gomez-Puertas P, Aviles M, Beitia F, Alonso C, EscribanoJM.2001.Antigenic and immunogenic properties of a chicken of twosimulune bacterial viruses in Arch Virol 146: 1681-; Gomez-Puertas P, Rodriguez F, Ovido JM, Brun A, Alonso C, Escribano JM.1998, the African swine boiler virus proteins P54 and P30 area involved in two variants of virus approach and both constraint to the antibody-mediated protective immune response, virology 243:461 @ -471; onisk DV, Borca MV, Kutish G, Kramer E, Irusta P, Rock DL.1994.Passively transferred African swine revolute antibodies protective swine against viral infection. virology 198: 350-.

On the other hand, one to weak low virulent strain that has been adapted to culture in CV1 cells was injected into pigs, and antibodies isolated from serum of recovered pigs immunized against otherwise healthy pigs that were able to defend against challenge with the virulent strain. Antibodies isolated from recovered porcine serum were able to neutralize wild strains including E75, E70, Lisbon60, etc., reducing their ability to infect Vero cells or macrophages by 86-97%.

Some studies have shown that 85% of pigs vaccinated with anti-ASFV antibodies are able to withstand challenge with the virulent strain E75 strain, while the remainder of pigs vaccinated with negative serum alone or PBS alone are 100% dead. The clinical manifestations of the vaccinated pigs were the same as those of normal pigs except for delayed and transient febrile reactions, whereas the control group showed significant clinical signs of ASFV 4 days after challenge. In addition, the virus content in the blood of the pigs inoculated with the antibody group is reduced by more than 10000 times, which indicates that the anti-ASFV antibody alone can protect the attack of ASFV virulent strains. There is also data indicating that antibody-mediated protection can delay disease progression early. Other studies have shown that some protection is obtained in piglets when they pass colostrum for antibodies against ASFV.

Research and development of a drug effective in preventing and treating African swine fever is the most serious challenge and urgent task for the global medical science community.

There are also some studies on African swine fever virus vaccines reported at present. For example, CN110093324A and CN106459931A propose attenuated strains of african swine fever virus with different gene knock-outs as live attenuated african swine fever vaccines, although the protective effect of the vaccines is good under laboratory conditions, the live attenuated vaccines are used with very large side effects, and because the research on the african swine fever virus is not thorough, the genes and mechanisms related to the virus virulence are not well understood, and the live attenuated vaccines have not been subjected to rigorous and comprehensive safety assessment, the biological risk as vaccines is extremely high. CN109836478A, CN104311660A and the like propose a monoclonal antibody against ASFV P11.5 and VP73 proteins. The monoclonal antibodies proposed in this patent are only useful as diagnostic reagents, and the antibodies have no neutralizing ability and cannot be used in therapeutic as well as prophylactic vaccines. CN109734810A patent application discloses a method for preparing anti-african swine fever virus and CD dual-target swine humanized antibody. This patent provides a method for preparing bispecific antibodies without providing antibody sequences, which uses recombinant CHO cells to express the antibody, which is then purified and injected into swine, but repeated injections are required at short intervals because the antibody half-life is very short and does not provide continuous protection. The antibody sequence and protection mechanism in the preparation method of the antibody are completely different from the antibody sequence and protection mechanism. The method utilizes the injection of recombinant AAV to continuously produce neutralizing antibodies for the treatment and prevention of ASFV.

Disclosure of Invention

The invention mainly aims to provide an African swine fever preventing and/or treating neutralizing antibody, a preparation method and application thereof, so as to overcome the defects in the prior art.

In order to achieve the purpose, the technical scheme adopted by the invention comprises the following steps:

the embodiment of the invention provides a chimeric monoclonal antibody, which comprises a heavy chain and a light chain, wherein the light chain comprises a light chain variable region and a light chain constant region, and the heavy chain comprises a heavy chain variable region and a heavy chain constant region; the light chain variable region has the sequence shown in SEQ ID No:6 or a conservative variant thereof, and the heavy chain variable region has a sequence shown in SEQ ID No:2 or a conservative variant sequence thereof; the light chain constant region and the heavy chain constant region are both derived from porcine antibodies.

In some embodiments, the light chain and the heavy chain of the chimeric monoclonal antibody have the amino acid sequences of SEQ ID nos: 14. SEQ ID No: 16 or a conservative variant thereof.

The embodiment of the invention also provides a gene for coding the chimeric monoclonal antibody, wherein the gene for coding the light chain has the nucleotide sequence shown in SEQ ID No:15 or a conservative variant sequence thereof, and the gene encoding the heavy chain has the sequence shown in SEQ ID No:13 or a conservative variant thereof.

The embodiment of the invention also provides an expression vector or a transformant containing the gene for encoding the chimeric monoclonal antibody.

In some embodiments, the expression vector is obtained by inserting the gene encoding the chimeric monoclonal antibody between the cleavage sites EcoRI and HindIII of the pAAV-CAG vector, and the transformant is obtained by co-transfecting a host cell with the expression vector, a pHelper vector, and a pAAV-RC vector.

The embodiment of the invention also provides application of the chimeric monoclonal antibody, the gene for coding the chimeric monoclonal antibody or the expression vector or the transformant in preparing a detection reagent of the African swine fever virus, a medicament for inducing an immune response to an African swine fever virus antigen in a tested animal or a medicament for preventing the animal from being infected by the African swine fever virus.

The embodiment of the invention also provides a preparation method of the virus particles, which comprises the following steps: culturing host cells, adding a transfection reagent when the cells grow to be 70% fused, adding the expression vector, the pAAV2-RC vector and the pHelper vector to co-transfect the host cells, culturing at 37 ℃ for 5 hours, then changing a fresh culture medium, continuing culturing and collecting the cells, repeatedly freezing and thawing the collected cells for cracking, and then extracting the virus particles by post-treatment.

Compared with the prior art, the technical scheme provided by the embodiment of the invention has the following outstanding advantages and effects:

(1) for example, 293 cells and other eukaryotic cells express ASFV P54 protein antigen, and the protein is expressed by soluble secretion, correct in folding and strong in immunogenicity;

(2) the selected monoclonal antibody has high neutralizing potency, and can effectively resist the adsorption infection of the virus to cells.

(3) The gene sequence of the antibody is obtained by extracting the total mRNA of the hybridoma cell and an RT-PCR amplification method, and the light chain and the heavy chain variable region of the monoclonal antibody are hybridized with the light chain and the heavy chain constant region of the pig IgG antibody to form the chimeric antibody, so that the high neutralizing activity of the antibody is kept, the immunogenicity of the antibody is reduced, and the effect of the antibody is improved.

(4) The AAV is used as a gene vector to transduce the antibody gene into the pig cell, so that the advantages of high safety, small virus particles, weak antigenicity and the like of the AAV vector can be fully exerted, the pig can quickly and continuously secrete the monoclonal antibody for a long time, and the pig can be protected for a long time. In the existing method of using monoclonal antibody injection, because the half-life of the antibody is very short, in order to achieve immunoprophylaxis, repeated injection is needed at short intervals, which is costly and complicated.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are required to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a schematic representation of the pCI-P54His plasmid in example 1;

FIG. 2 is an SDS-PAGE gel electrophoresis chart in example 2;

FIG. 3 is a schematic diagram of the pAAV-CAG-Cap vector in example 6.

Detailed Description

It is to be understood that the following detailed description is exemplary and is intended to provide further explanation of the invention as claimed. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof, unless the context clearly indicates otherwise.

One aspect of the embodiments provides a chimeric monoclonal antibody comprising a heavy chain and a light chain, the light chain comprising a light chain variable region and a light chain constant region, and the heavy chain comprising a heavy chain variable region and a heavy chain constant region; the light chain variable region has the sequence shown in SEQ ID No:6 or a conservative variant thereof, and the heavy chain variable region has a sequence shown in SEQ ID No:2 or a conservative variant sequence thereof; the light chain constant region and the heavy chain constant region are both derived from porcine antibodies.

In some embodiments, the light chain constant region has the amino acid sequence of SEQ ID No: 8 or a conservative variant sequence thereof.

In some embodiments, the heavy chain constant region has the amino acid sequence of SEQ ID No: 4 or a conservative variant sequence thereof.

In some embodiments, the heavy and light chains are linked by interchain disulfide bonds.

In some embodiments, the amino acid sequence of the chimeric monoclonal antibody is as set forth in SEQ ID No: 12 or a conservative variant sequence thereof.

In some embodiments, the light chain variable region and the light chain constant region comprise a light chain and the heavy chain variable region and the heavy chain constant region comprise a heavy chain, and the gene encoding the light chain has the amino acid sequence of SEQ ID No:15 or a conservative variant sequence thereof, and the coding gene of the heavy chain has a sequence shown in SEQ ID No:13 or a conservative variant thereof.

In some embodiments, the gene encoding the light chain variable region has the amino acid sequence of SEQ ID No:5 or a conservative variant sequence thereof.

In some embodiments, the gene encoding the heavy chain variable region has the amino acid sequence of SEQ ID No:1 or a conservative variant sequence thereof.

In some embodiments, the gene encoding the light chain constant region has the amino acid sequence of SEQ ID No: 7 or a conservative variant sequence thereof.

In some embodiments, the gene encoding the heavy chain constant region has the amino acid sequence of SEQ ID No: 3 or a conservative variant sequence thereof.

In some embodiments, the gene encoding the chimeric monoclonal antibody has the amino acid sequence of SEQ ID No:11 or a conservative variant thereof.

In the present specification, the aforementioned conservative variant sequence refers to a nucleotide and/or amino acid sequence formed by substitution, insertion or deletion of a nucleotide or amino acid at one or more sites in the original nucleotide sequence and/or the original amino acid sequence. Preferably, the conservative variant sequence is at least 95% identical to the original sequence.

In another aspect of the embodiments of the present invention, there is provided an expression vector or a transformant containing the gene encoding the chimeric monoclonal antibody.

In some embodiments, the expression vector (which may be defined as an AAV expression vector) is the gene encoding the chimeric monoclonal antibody inserted between EcoRI and HindIII of the pAAV-CAG vector.

In the present specification, the pAAV-CAG vector is prepared by a method which is conventional in the art, or is commercially available. Wherein the restriction sites of the multicloning site of the pAAV-CAG vector are those conventional in the art as long as the gene encoding the chimeric monoclonal antibody can be cloned into the pAAV-CAG vector, and the restriction sites are preferably those of restriction enzymes EcoRI and HindIII.

In some embodiments, the sequence of the gene encoding the chimeric monoclonal antibody is preferably a homologue of SEQ ID No. 11, which may be a promoter variant. The promoter or signal sequence preceding the nucleic acid sequence may be altered by one or more nucleic acid substitutions, insertions or deletions without these alterations having a negative effect on the function of the promoter. Furthermore, the expression level of the target protein can be increased by changing the sequence of the promoter or even completely replacing it with a more efficient promoter from a different species of organism. Homologs of SEQ ID No. 11 also include a class of polynucleic acids having a base sequence capable of hybridizing with a polynucleic acid having a sequence shown in SEQ ID No. 11 under standard conditions in a manner described in Current Protocols in Molecular Biology, described in Molecular cloning. The homologue of SEQ ID No. 11 is preferably one in which a signal peptide molecule is added before the sequence of SEQ ID No. 11, which serves to control functions such as transfer and localization of the sequence of SEQ ID No. 11 in cells, wherein the signal peptide molecule is a signal peptide molecule that is conventional in the art, and the sequence of the signal peptide molecule can be obtained by artificially synthesizing a polypeptide sequence or by molecular cloning techniques, in a manner described in the general protocol in molecular biology, described in molecular cloning (Cold Spring Harbor Laboratory Press).

In some embodiments, the gene encoding the heavy chain and the gene encoding the light chain are inserted after the CAG promoter in the expression vector, and the gene encoding the heavy chain and the gene encoding the light chain are connected by a connecting peptide. Preferably, the linking peptide includes, but is not limited to, the FMDV (foot and Mouth Disease Virus)2A peptide.

In the present specification, the transformant is prepared by transforming the expression vector of the present invention into a corresponding host cell. The host cell is conventional in the art, preferably a eukaryotic cell, more preferably a HEK293 cell, as long as it is sufficient that the AAV vector is stably self-replicating. The HEK293 cell line is prepared by a conventional method in the art or is commercially available.

In some embodiments, the transformants are obtained by co-transfecting the expression vector (AAV expression vector described above) with a pHelper vector, a pAAV-RC vector, and a host cell.

Another aspect of the embodiments of the present invention provides a method for preparing a virus particle, including: culturing host cells, adding a transfection reagent when the cells grow to be 70% fused, adding the expression vector, the pAAV2-RC vector and the pHelper vector to co-transfect the host cells, culturing at 37 ℃ for 5 hours, then changing a fresh culture medium, continuing culturing and collecting the cells, repeatedly freezing and thawing the collected cells for cracking, and then extracting the virus particles by post-treatment.

In some embodiments, the host cell is a host cell conventional in the art, preferably a eukaryotic cell, more preferably a HEK293 cell.

In some embodiments, the transfection reagent is a transfection reagent conventional in the art, provided that it is sufficient to transfect the foreign plasmid into the host cell, preferably a polyethyleneimine reagent (PEI reagent). The preparation method of the polyethyleneimine reagent is a conventional preparation method in the field, or is commercially available.

In some embodiments, the AAV vector, pAAV2-RC vector, and pHelper vector are preferably added in equal mass ratios.

In some embodiments, the three plasmids are preferably added in an amount of 6-16. mu.g.

When the addition amount of the three plasmids is not within the above range, the AAV virus packaging efficiency is low, and even the AAV virus cannot be packaged.

In the specification, the pAAV2-RC vector and the pHelper vector are pAAV2-RC vector and pHelper vector which are conventional in the field, and the preparation methods of the vectors are conventional in the field or are commercially available.

In some embodiments, the method for preparing the virus particles may further comprise a concentration step, and the concentration method is a conventional concentration method in the field, for example, the collected eluate containing the virus may be concentrated and processed by a concentration column. Wherein the concentration column is a concentration column conventional in the art as long as it can concentrate the resulting virus particles. The preparation method of the concentration column is a conventional preparation method in the field, or is commercially available.

Another aspect of the embodiments of the present invention provides an AAV viral particle comprising the expression vector. The AAV viral particles can be prepared by the methods described previously.

In another aspect of the embodiments of the present invention, there is provided a use of the chimeric monoclonal antibody, the gene encoding the chimeric monoclonal antibody, the expression vector or transformant, or the AAV viral particle in the preparation of a detection reagent for african swine fever virus, a medicament for inducing an immune response against an african swine fever virus antigen in a test animal, or a medicament for preventing an infection of an animal with african swine fever virus.

For example, some embodiments of the invention provide for the use of said expression vector or said AAV viral particle in the preparation of an african swine fever virus vaccine.

Another aspect of the embodiments of the present invention provides an immunological composition comprising the expression vector as described above as an active ingredient and at least one pharmaceutically acceptable carrier. The pharmaceutical carrier of the present invention is a conventional pharmaceutical carrier in the art, preferably a filler, diluent or excipient, etc., and is not limited thereto. Further, the immune composition may be prepared in various dosage forms including, but not limited to, tablets, capsules, powders, pills, granules, syrups, solutions, suspensions, emulsions, suspensions, injections, or powder injections; preferably, the dosage form is injection, such as intravenous injection, intraperitoneal injection and the like.

In some more specific embodiments of the present invention, mice are immunized with 293 cell expressed ASFV P54 protein as an antigen to prepare hybridoma cells, cell lines capable of secreting monoclonal antibodies with high neutralizing titers are selected, total RNA of the hybridoma cells is extracted, the gene sequences of the monoclonal antibodies are amplified by reverse transcription, and the variable region sequences of the heavy and light chains of the monoclonal antibodies and the published constant region sequences of the heavy and light chains of the porcine antibodies are made into a humanized chimeric antibody. The chimeric antibody gene is then codon optimized and cloned into an AAV vector, which can be used for the treatment or prevention of african swine fever virus, e.g. for the preparation of an african swine fever virus vaccine.

It is to be understood that the definitions of certain terms used herein are known to those of ordinary skill in the art unless otherwise indicated. For example:

an antibody consisting of two identical light chains (L) and two identical heavy chains (H). Each heavy chain is flanked by a variable region (V) followed by a number of constant regions (C). Each light chain is flanked by a variable region (V) followed by a number of constant regions (C).

The variable regions of the natural heavy and light chains each contain four FR regions, most of which adopt an β folded configuration, linked by three CDRs, three CDR links forming a loop link and in some cases forming a portion of β folds.

Adeno-associated virus (AAV), which belongs to the genus dependovirus of the family parvoviridae, is a DNA replication-deficient virus, and replication and propagation of AAV virus need to depend on the participation of other helper viruses such as adenovirus. The genome of an AAV virus is a single-stranded DNA, about 4.7Kb in length, and is composed of three important elements, namely: a pair of Inverted Terminal Repeats (ITRs), a Rep region and a Cap region. ITRs can form T-type secondary structures and are the only cis-acting elements required for AAV virus replication, packaging, integration and rescue (molecular structure of adeno-associated virus variant DNA. the Journal of biological chemistry 1980, 255: 3194. sup. 3203). Systems have been developed in the present stage that do not require helper viruses to accomplish recombinant adeno-associated virus packaging (high pure viral infection-associated virus vectors active and free of detectable salts and wild-type viruses HumGene Heat 1999,10: 1031-. The packaging system comprises three plasmids and a cell line, wherein the three plasmids are respectively pAAV-MCS carrying ITRs elements, eukaryotic promoters and exogenous gene insertion sites; pAAV-RC providing the Rep region and Cap region necessary for AAV viral packaging; pHelper derived from helper proteins E2A, E4 and VA RNA in helper viruses is provided. The three plasmids are co-transfected into a HEK-293 cell line, and then can be packaged to form infectious recombinant adeno-associated virus particles. The recombinant adeno-associated virus can stably express foreign genes in cells, and AAV causes a relatively mild immune response in the body compared with other viruses. AAV has found widespread use as a viral vector in gene therapy, prophylaxis and therapeutic vaccines and in basic research.

The aforementioned embodiment of the present invention utilizes eukaryotic expressed ASFV P54 protein as immunogen, selects monoclonal antibody which can effectively neutralize ASFV virus, obtains the sequence of the neutralizing antibody, and clones the neutralizing antibody into AAV vector after codon optimization of the coding gene of the neutralizing antibody, which can be used for treating or preventing African swine fever virus, for example, for preparing African swine fever virus vaccine.

The invention is further illustrated by the following examples, which are not intended to limit the scope of the invention. The reagents and starting materials used in the following examples are commercially available, and the test methods in which specific conditions are not specified are generally carried out under conventional conditions or conditions recommended by the respective manufacturers. Further, unless otherwise indicated, the assays, detection methods, and preparations disclosed herein are performed using molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA techniques, and techniques conventional in the art. These techniques are well described in the literature, and may be found in particular in the study of the MOLECULAR CLONING, Sambrook et al: a LABORATORYMANUAL, Second edition, Cold Spring Harbor Laboratory Press, 1989and third edition, 2001; ausubel et al, Current PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987and periodic updates; the series METHODS IN ENZYMOLOGY, Academic Press, San Diego; wolffe, CHROMATIN STRUCTURE AND FUNCTION, third edition, Academic Press, San Diego, 1998; (iii) METHODS IN ENZYMOLOGY, Vol.304, Chromatin (P.M.Wassarman and A.P.Wolffe, eds.), Academic Press, San Diego, 1999; and Methodsin Molecular BIOLOGY, Vol.119, Chromatin Protocols (P.B.Becker, ed.) Humana Press, Totowa, 1999, etc.

EXAMPLE 1 construction of recombinant plasmid expressing P54 protein

The amino acid sequence of P54 protein of ASFV (Gene Bank accession number: MK128995) separated in China is subjected to codon optimization (SEQ ID No: 11), synthesized and cloned into a pCI expression vector by Nanjing Kinshire company, a His tag is added at the C end of the protein, and the protein is inserted between the restriction enzyme sites of restriction enzymes MluI and XhoI of the pCI vector to obtain a pCI-P54His plasmid, which is shown in figure 1. The pCI expression vector may be replaced with various vectors that can replicate and express in a host, which are conventional in the art. The host may be a prokaryotic cell, such as a bacterial cell; eukaryotic cells, such as insect, yeast, mammalian cells, and the like; more specifically, the recombinant plasmid may be a genetically engineered bacterium obtained by transforming Escherichia coli with the recombinant plasmid.

Example 2 preparation of an Immunity antigen (ASFV P54 protein)

The pCI-P54His plasmid was amplified using E.coli and extracted. PEI and pCI-P54His plasmid are used for transfecting HEK293 cells, after 3 days, 3000r/min is used for centrifugation for 15min, and supernatant is taken to obtain P54His protein (SEQ ID No: 12). Harvested cell cultures were subjected to SDS-PAGE detection while empty HEK293 cells were used as negative controls. The specific operation is as follows: mu.l of the harvested cell culture was taken, 10. mu.l of 5 × loading buffer was added, the mixture was centrifuged in a boiling water bath for 5 minutes at 12000r/min for 1 minute, the supernatant was subjected to SDS-PAGE gel (12% strength gel) electrophoresis, and the gel was stained and decolored after electrophoresis to observe the band. As shown in FIG. 2, a band appeared around a molecular weight of about 20kDa, and the negative control had no band at the corresponding position.

Example 3 preparation of African swine fever virus P54 monoclonal antibody and hybridoma cell line

Immunizing a mouse by using the prepared P54His protein, and performing a polyethylene glycol method on spleen B cells and SP20 cells according to the cell number of 10:1, gently suspending the fused cells by using HAT selection culture solution containing 20% fetal calf serum, dispersing the fused cells into a 96-well cell culture plate, and culturing the cell culture plate in an incubator to obtain the positive clone resisting P54. Collecting cell supernatant in time after the fusion cells grow out monoclone, screening positive clone by adopting an indirect ELISA method, transferring the positive clone to a 24-hole cell culture plate for amplification culture, and performing subcloning by using a limiting dilution method until a neutralizing antibody clone hybridoma cell strain 9D8 capable of secreting African swine fever virus is screened out.

Example 4 amplification of antibody variable region Gene sequences

Extracting total RNA of hybridoma cell strain 9D8, reverse transcribing to prepare cDNA, amplifying light chain variable region sequence (corresponding F, R primer sequence is shown as SEQ ID No: 19 and SEQ ID No: 20) and heavy chain variable region sequence (corresponding F, R primer sequence is shown as SEQ ID No: 21 and SEQ ID No: 22) with specific primer, and sequencing.

Wherein: m ═ A or C, W ═ A or T, S ═ C or G, R ═ A or G

EXAMPLE 5 obtaining of antibody sequences

The light chain variable region (the corresponding gene and the polypeptide sequence are respectively SEQ ID NO:5 and SEQ ID NO:6) and the heavy chain variable region (the corresponding gene and the polypeptide sequence are respectively SEQ ID NO:1 and SEQ ID NO:2) are spliced with the published constant region sequence of the pig IgG antibody, so as to obtain the chimeric swine ASFV neutralizing antibody sequence.

Example 6 expression of chimeric ASFV neutralizing antibody AAV expression vector construction.

The amino acid sequence of the chimeric neutralizing antibody is subjected to codon optimization, and then is cloned to a vector pAAV-CAG vector, the vector uses a CAG promoter, a heavy chain gene sequence (SEQ ID NO:13) and a light chain gene sequence (SEQ ID NO:15) are inserted behind the promoter, and the two gene sequences are connected by an FMDV 2A peptide sequence (the corresponding gene and the polypeptide sequence are respectively SEQ ID NO: 9and SEQ ID NO: 10). The structural schematic diagram of the obtained pAAV-CAG-Cap vector is shown in FIG. 3, wherein the sequences of the cloned gene and the protein encoded by the gene are shown in SEQ ID No: 17. SEQ ID No: 18, respectively.

Example 7 recombinant AAV production

HEK293 cells in T25 flasks were passaged 1: 3 and transfected to about 70% confluence. The cell culture medium was changed to DMEM and AAV expressing Cap was prepared for transfection using a three plasmid transfection method, the three plasmids were co-transfected at 12.5. mu.g and the molar ratio of pHelper, pAAV-RC and pAAV-CAG-Cap was 1: 1: 1 mixing DNA samples, transferring the mixed DNA samples into 500 mu L DMEM, standing at room temperature for two minutes after short vortex oscillation, adding 31.25 mu L Polyethyleneimine (PEI) into the samples, incubating at room temperature for 10 minutes after short vortex oscillation, adding the transfection complex into HEK293 cells, and changing the complete culture medium after 5 hours.

And (2) transfecting HEK293 cells with virus collection plasmids for 48-72 hours, collecting the cells, removing the original culture medium, adding a proper amount of DMEM, scraping the cells by using a cell scraper, transferring the cells into a 15mL centrifuge tube, centrifuging for 20min at 5000rmp, freezing at-20 ℃, thawing at room temperature, completely freezing and thawing for 3 times, crushing the cells for 4 times under ice bath, centrifuging for 20min at 10000rmp, and collecting the supernatant.

Example 8 Virus Titer assay

1. Determination of AAV titer of purified AAV virions

Titraction Kit (for RealTime PCR) Ver.2(TaKaRa, Cat. #6233), 0.5M EDTA (1/80 added in volume of medium), 1750g, centrifugation at 4 ℃ for 10 minutes completely removed the supernatant. Vortex the sample and add 250. mu.L AAV

And (3) carrying out vortex oscillation on the Titraction Kit extracting solution A for 15s to resuspend the cells, standing at room temperature for 5 minutes, then carrying out vortex oscillation for 15 seconds, and centrifuging at 2000-14000 g for 10 minutes at 4 ℃. The supernatant was collected in a new centrifuge tube, and 25. mu.L of AAV was added

Extracting the buffer solution B by the Titraction Kit, and washing and uniformly mixing by using a pipette.

2. Extract AAV viral genome with 15. mu.L dH₂O dissolving 2. mu.L AAV virus sample, adding 2. mu. L L0 xDNase I Buffer and 1. mu.L DNase I, incubating at 37 ℃ for 15 minutes, then incubating at 95 ℃ for 10 minutes, adding 20. mu.L lysis Buffer, incubating at 70 ℃ for 10 minutes, and diluting the sample 50-fold with EASY dilution solution.

PCR assay gradient dilution Standard from 2X 10⁷copies/. mu.l dilution to 2X 10²copies/. mu.l, 50X primer mix, 5. mu.L AAV Forward Titer primer, 5. mu.L AAV Reverse Titer primer and addition of 15. mu.L dH₂And O. 12.5. mu.L of TB GreenPremix Ex Taq II (2 Xconc.), 0.5. mu.L of the primer mix, and 7. mu.L of dH₂Performing RT-PCR reaction on O and 5 mu L of template, and performing pre-denaturation at 95 ℃ for 2 minutes; denaturation at 94 ℃ for 5 seconds, reaction at 60 ℃ for 30 seconds, 35 cycles. The titer of the sample was calculated from the plotted standard curve of the standard sample.

Example 9 animal immunization and neutralizing antibody assay

Collecting 20 healthy and uninfected ASFV virus suckling pigs, wherein 10 pigs are inoculated with 10 viruses¹³gC (genome copies) recombinant AAV2, another 10 inoculations 10¹³AAV2, empty at gc, was bled 4, 6, 8, 10, 12, 14week post inoculation and tested for ASFV neutralizing antibody titers in serum, as shown in the table below.

Time (week)	Negative control neutralizing antibody titer	Neutralizing antibody titer
			4	Negative of	1:24.1
6	Negative of	1:25.3
			8	Negative of	1:26.7
10	Negative of	1:28.4
			12	Negative of	1:28.7
14	Negative of	1:29.1

It is to be understood that the above-described embodiments are part of the present invention, and not all embodiments. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention as claimed, but is merely representative of selected embodiments of the invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Sequence listing

<110> Suzhou Shino Biotechnology, Inc., Suzhou Midi Biotechnology, Inc

<120> African swine fever preventive and/or therapeutic neutralizing antibody, preparation method and application thereof

<160>22

<170>SIPOSequenceListing 1.0

<210>1

<211>411

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>1

atgggatgga cctggatctt tattttaatc ctgtcagtaa ctacaggtgt ccactctgac 60

gtccagctgc agcagtctgg acctgagctg ataaagcctg gcgcttcagt gaagatatcc 120

tgcaaggctt ctggtttctc attcaccggc cacggagtaa gctggatagt gcagaggaat 180

ggaaagagcc ttgagtggat tggaaatatt gatcctggaa gcggtgtaac taacttcaac 240

caaaagttca agggcaaggc cacattgact gtagacaaat cctccagtac attgtacatg 300

cacctcacga gcctgcaatc tgaggactct gcagtctatt actgtgcaag aagacggcca 360

tgggactacg tatttgacta ctggggccaa gggactctgg tcactgtctc t 411

<210>2

<211>137

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>2

Met Gly Trp Thr Trp Ile Phe Ile Leu Ile Leu Ser Val Thr Thr Gly

1 5 10 15

Val His Ser Asp Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Ile Lys

20 25 30

Pro Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Phe Ser Phe

35 40 45

Thr Gly His Gly Val Ser Trp Ile Val Gln Arg Asn Gly Lys Ser Leu

50 55 60

Glu Trp Ile Gly Asn Ile Asp Pro Gly Ser Gly Val Thr Asn Phe Asn

65 70 75 80

Gln Lys Phe Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser

85 90 95

Thr Leu Tyr Met His Leu Thr Ser Leu Gln Ser Glu Asp Ser Ala Val

100 105 110

Tyr Tyr Cys Ala Arg Arg Arg Pro Trp Asp Tyr Val Phe Asp Tyr Trp

115 120 125

Gly Gln Gly Thr Leu Val Thr Val Ser

130 135

<210>3

<211>990

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>3

tcagccccca agacggcccc atcggtctac cctctggccc cctgcggcag ggacacgtct 60

ggccctaacg tggccttggg ctgcctggcc tcaagctact tccccgagcc agtgaccatg 120

acctggaact cgggcgccct gaccagtggc gtgcatacct tcccatccgt cctgcagccg 180

tcagggctct actccctcag cagcatggtg accgtgccgg ccagcagcct gtccagcaag 240

agctacacct gcaatgtcaa ccacccggcc accaccacca aggtggacaa gcgtgttgga 300

acaaagacca aaccaccatg tcccatatgc ccaggctgtg aagtggccgg gccctcggtc 360

ttcatcttcc ctccaaaacc caaggacacc ctcatgatct cccagacccc cgaggtcacg 420

tgcgtggtgg tggacgtcag caaggagcac gccgaggtcc agttctcctg gtacgtggac 480

ggcgtagagg tgcacacggc cgagacgaga ccaaaggagg agcagttcaa cagcacctac 540

cgtgtggtca gcgtcctgcc catccagcac caggactggc tgaaggggaa ggagttcaag 600

tgcaaggtca acaacgtaga cctcccagcc cccatcacga ggaccatctc caaggctata 660

gggcagagcc gggagccgca ggtgtacacc ctgcccccac ccgccgagga gctgtccagg 720

agcaaagtca ccgtaacctg cctggtcatt ggcttctacc cacctgacat ccatgttgag 780

tggaagagca acggacagcc ggagccagag ggcaattacc gcaccacccc gccccagcag 840

gacgtggacg ggaccttctt cctgtacagc aagctcgcgg tggacaaggc aagatgggac 900

catggagaaa catttgagtg tgcggtgatg cacgaggctc tgcacaacca ctacacccag 960

aagtccatct ccaagactca gggtaaatga 990

<210>4

<211>329

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>4

Ser Ala Pro Lys Thr Ala Pro Ser Val Tyr Pro Leu Ala Pro Cys Gly

1 5 10 15

Arg Asp Thr Ser Gly Pro Asn Val Ala Leu Gly Cys Leu Ala Ser Ser

20 25 30

Tyr Phe Pro Glu Pro Val Thr MetThr Trp Asn Ser Gly Ala Leu Thr

35 40 45

Ser Gly Val His Thr Phe Pro Ser Val Leu Gln Pro Ser Gly Leu Tyr

50 55 60

Ser Leu Ser Ser Met Val Thr Val Pro Ala Ser Ser Leu Ser Ser Lys

65 70 75 80

Ser Tyr Thr Cys Asn Val Asn His Pro Ala Thr Thr Thr Lys Val Asp

85 90 95

Lys Arg Val Gly Thr Lys Thr Lys Pro Pro Cys Pro Ile Cys Pro Gly

100 105 110

Cys Glu Val Ala Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Pro Lys

115 120 125

Asp Thr Leu Met Ile Ser Gln Thr Pro Glu Val Thr Cys Val Val Val

130 135 140

Asp Val Ser Lys Glu His Ala Glu Val Gln Phe Ser Trp Tyr Val Asp

145 150 155 160

Gly Val Glu Val His Thr Ala Glu Thr Arg Pro Lys Glu Glu Gln Phe

165 170 175

Asn Ser Thr Tyr Arg Val Val Ser Val Leu Pro Ile Gln His Gln Asp

180 185 190

Trp Leu Lys Gly Lys Glu Phe Lys Cys Lys ValAsn Asn Val Asp Leu

195 200 205

Pro Ala Pro Ile Thr Arg Thr Ile Ser Lys Ala Ile Gly Gln Ser Arg

210 215 220

Glu Pro Gln Val Tyr Thr Leu Pro Pro Pro Ala Glu Glu Leu Ser Arg

225 230 235 240

Ser Lys Val Thr Val Thr Cys Leu Val Ile Gly Phe Tyr Pro Pro Asp

245 250 255

Ile His Val Glu Trp Lys Ser Asn Gly Gln Pro Glu Pro Glu Gly Asn

260 265 270

Tyr Arg Thr Thr Pro Pro Gln Gln Asp Val Asp Gly Thr Phe Phe Leu

275 280 285

Tyr Ser Lys Leu Ala Val Asp Lys Ala Arg Trp Asp His Gly Glu Thr

290 295 300

Phe Glu Cys Ala Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

305 310 315 320

Lys Ser Ile Ser Lys Thr Gln Gly Lys

325

<210>5

<211>387

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>5

atggcctgga tttcacttat actctctctc ctggctctca gctcaggggc catttcccag 60

gctgttgtga ctcaggaatc tgcactcacc acatcacctg gtggaacagt catactcact 120

tgtcgctcaa gtactggggc tgttacaact agtaactatg ccaactggat acaagaaaaa 180

ccagatcatt tattcatagg actaataggt ggtaccagca accgaggacc aggtgttcct 240

gccagattct caggctccct gattggagac aaggctgccc tcaccatcat aggggcacag 300

actgaggatg aggcaatata tttctgtgct ctatggttca gaacacactt tgtattcggc 360

agtggaacca aggtcactgt cctaggt 387

<210>6

<211>129

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>6

Met Ala Trp Ile Ser Leu Ile Leu Ser Leu Leu Ala Leu Ser Ser Gly

1 5 10 15

Ala Ile Ser Gln Ala Val Val Thr Gln Glu Ser Ala Leu Thr Thr Ser

20 25 30

Pro Gly Gly Thr Val Ile Leu Thr Cys Arg Ser Ser Thr Gly Ala Val

35 40 45

Thr Thr Ser Asn Tyr Ala Asn Trp Ile Gln Glu Lys Pro Asp His Leu

50 55 60

Phe Ile Gly Leu Ile Gly Gly Thr Ser Asn Arg Gly Pro Gly Val Pro

65 70 75 80

Ala Arg Phe Ser Gly Ser Leu Ile Gly Asp Lys Ala Ala Leu Thr Ile

85 90 95

Ile Gly Ala Gln Thr Glu Asp Glu Ala Ile Tyr Phe Cys Ala Leu Trp

100 105 110

Phe Arg Thr His Phe Val Phe Gly Ser Gly Thr Lys Val Thr Val Leu

115 120 125

Gly

<210>7

<211>318

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>7

cagcccaagg ccgctcccac ggtcaacctc ttcccgccct cctctgagga gctcggcacc 60

aacaaggcca ccctggtgtg tctaataagt gacttctacc cgggcgccgt gacggtgacc 120

tggaaggcag gcggcaccac cgtcacccag ggcgtggaga ccaccaagcc ctcgaaacag 180

agcaacaaca agtacgcggc cagcagctac ctggccctgt ccgccagtga ctggaaatct 240

tccagcggct tcacctgcca ggtcacccac gaggggacca ttgtggagaa gacagtgacg 300

ccctccgagt gcgcctag 318

<210>8

<211>105

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>8

Gln Pro Lys Ala Ala Pro Thr Val Asn Leu Phe Pro Pro Ser Ser Glu

1 510 15

Glu Leu Gly Thr Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp Phe

20 25 30

Tyr Pro Gly Ala Val Thr Val Thr Trp Lys Ala Gly Gly Thr Thr Val

35 40 45

Thr Gln Gly Val Glu Thr Thr Lys Pro Ser Lys Gln Ser Asn Asn Lys

50 55 60

Tyr Ala Ala Ser Ser Tyr Leu Ala Leu Ser Ala Ser Asp Trp Lys Ser

65 70 75 80

Ser Ser Gly Phe Thr Cys Gln Val Thr His Glu Gly Thr Ile Val Glu

85 90 95

Lys Thr Val Thr Pro Ser Glu Cys Ala

100 105

<210>9

<211>54

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>9

tccttgaact ttgatctgct caagttggca ggggacgtgg agtccaaccc tggg 54

<210>10

<211>18

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>10

Ser Leu Asn Phe Asp Leu Leu Lys Leu Ala Gly Asp Val Glu Ser Asn

1 5 10 15

Pro Gly

<210>11

<211>489

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>11

gccgccacca tggaaacaga tacactcctc ctctgggtgc tgctcctctg ggtgccagga 60

tctacaggat cctcccggaa gaagaaggcc gccgccatcg aggaggagga catccagttc 120

atcaacccct accaagatca gcagtgggtg gaggtgaccc ctcagcccgg aacctccaag 180

cccgctggcg ctaccacagc ctccgtgggc aaacccgtga ctggtcgtcc cgctaccaat 240

cgtcccgcta ccaacaagcc cgtgaccgac aaccccgtga ccgataggct ggtgatggcc 300

accggaggac ccgctgctgc tcccgctgcc gctagcgctc ccgctcatcc cgctgagccc 360

tacaccaccg tgactaccca gaacaccgct tcccagacca tgtccgccat cgagaatctg 420

cggcagcgga acacctacac ccacaaggat ttagaaaact ctttacatca ccatcaccat 480

cactgatga 489

<210>12

<211>158

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>12

Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro

1 5 10 15

Gly Ser Thr Gly Ser Ser Arg Lys Lys Lys Ala Ala Ala Ile Glu Glu

20 25 30

Glu Asp Ile Gln Phe Ile Asn Pro Tyr Gln Asp Gln Gln Trp Val Glu

35 40 45

Val Thr Pro Gln Pro Gly Thr Ser Lys Pro Ala Gly Ala Thr Thr Ala

50 55 60

Ser Val Gly Lys Pro Val Thr Gly Arg Pro Ala Thr Asn Arg Pro Ala

65 70 75 80

Thr Asn Lys Pro Val Thr Asp Asn Pro Val Thr Asp Arg Leu Val Met

85 90 95

Ala Thr Gly Gly Pro Ala Ala Ala Pro Ala Ala Ala Ser Ala Pro Ala

100 105 110

His Pro Ala Glu Pro Tyr Thr Thr Val Thr Thr Gln Asn Thr Ala Ser

115 120 125

Gln Thr Met Ser Ala Ile Glu Asn Leu Arg Gln Arg Asn Thr Tyr Thr

130 135 140

His Lys Asp Leu Glu Asn Ser Leu His His His His His His

145 150 155

<210>13

<211>1401

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>13

atgggatgga cctggatctt tattttaatcctgtcagtaa ctacaggtgt ccactctgac 60

gtccagctgc agcagtctgg acctgagctg ataaagcctg gcgcttcagt gaagatatcc 120

tgcaaggctt ctggtttctc attcaccggc cacggagtaa gctggatagt gcagaggaat 180

ggaaagagcc ttgagtggat tggaaatatt gatcctggaa gcggtgtaac taacttcaac 240

caaaagttca agggcaaggc cacattgact gtagacaaat cctccagtac attgtacatg 300

cacctcacga gcctgcaatc tgaggactct gcagtctatt actgtgcaag aagacggcca 360

tgggactacg tatttgacta ctggggccaa gggactctgg tcactgtctc ttcagccccc 420

aagacggccc catcggtcta ccctctggcc ccctgcggca gggacacgtc tggccctaac 480

gtggccttgg gctgcctggc ctcaagctac ttccccgagc cagtgaccat gacctggaac 540

tcgggcgccc tgaccagtgg cgtgcatacc ttcccatccg tcctgcagcc gtcagggctc 600

tactccctca gcagcatggt gaccgtgccg gccagcagcc tgtccagcaa gagctacacc 660

tgcaatgtca accacccggc caccaccacc aaggtggaca agcgtgttgg aacaaagacc 720

aaaccaccat gtcccatatg cccaggctgt gaagtggccg ggccctcggt cttcatcttc 780

cctccaaaac ccaaggacac cctcatgatc tcccagaccc ccgaggtcac gtgcgtggtg 840

gtggacgtca gcaaggagca cgccgaggtc cagttctcct ggtacgtgga cggcgtagag 900

gtgcacacgg ccgagacgag accaaaggag gagcagttca acagcaccta ccgtgtggtc 960

agcgtcctgc ccatccagca ccaggactgg ctgaagggga aggagttcaa gtgcaaggtc 1020

aacaacgtag acctcccagc ccccatcacg aggaccatct ccaaggctat agggcagagc 1080

cgggagccgc aggtgtacac cctgccccca cccgccgagg agctgtccag gagcaaagtc 1140

accgtaacct gcctggtcat tggcttctac ccacctgaca tccatgttga gtggaagagc 1200

aacggacagc cggagccaga gggcaattac cgcaccaccc cgccccagca ggacgtggac 1260

gggaccttct tcctgtacag caagctcgcg gtggacaagg caagatggga ccatggagaa 1320

acatttgagt gtgcggtgat gcacgaggct ctgcacaacc actacaccca gaagtccatc 1380

tccaagactc agggtaaatg a 1401

<210>14

<211>466

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>14

Met Gly Trp Thr Trp Ile Phe Ile Leu Ile Leu Ser Val Thr Thr Gly

1 5 10 15

Val His Ser Asp Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Ile Lys

20 25 30

Pro Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Phe Ser Phe

35 40 45

Thr Gly His Gly Val Ser Trp Ile Val Gln Arg Asn Gly Lys Ser Leu

50 55 60

Glu Trp Ile Gly Asn Ile Asp Pro Gly Ser Gly Val Thr Asn Phe Asn

65 70 75 80

Gln Lys Phe Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser

85 9095

Thr Leu Tyr Met His Leu Thr Ser Leu Gln Ser Glu Asp Ser Ala Val

100 105 110

Tyr Tyr Cys Ala Arg Arg Arg Pro Trp Asp Tyr Val Phe Asp Tyr Trp

115 120 125

Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Pro Lys Thr Ala Pro

130 135 140

Ser Val Tyr Pro Leu Ala Pro Cys Gly Arg Asp Thr Ser Gly Pro Asn

145 150 155 160

Val Ala Leu Gly Cys Leu Ala Ser Ser Tyr Phe Pro Glu Pro Val Thr

165 170 175

Met Thr Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro

180 185 190

Ser Val Leu Gln Pro Ser Gly Leu Tyr Ser Leu Ser Ser Met Val Thr

195 200 205

Val Pro Ala Ser Ser Leu Ser Ser Lys Ser Tyr Thr Cys Asn Val Asn

210 215 220

His Pro Ala Thr Thr Thr Lys Val Asp Lys Arg Val Gly Thr Lys Thr

225 230 235 240

Lys Pro Pro Cys Pro Ile Cys Pro Gly Cys Glu Val Ala Gly Pro Ser

245 250255

Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Gln

260 265 270

Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Lys Glu His Ala

275 280 285

Glu Val Gln Phe Ser Trp Tyr Val Asp Gly Val Glu Val His Thr Ala

290 295 300

Glu Thr Arg Pro Lys Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val

305 310 315 320

Ser Val Leu Pro Ile Gln His Gln Asp Trp Leu Lys Gly Lys Glu Phe

325 330 335

Lys Cys Lys Val Asn Asn Val Asp Leu Pro Ala Pro Ile Thr Arg Thr

340 345 350

Ile Ser Lys Ala Ile Gly Gln Ser Arg Glu Pro Gln Val Tyr Thr Leu

355 360 365

Pro Pro Pro Ala Glu Glu Leu Ser Arg Ser Lys Val Thr Val Thr Cys

370 375 380

Leu Val Ile Gly Phe Tyr Pro Pro Asp Ile His Val Glu Trp Lys Ser

385 390 395 400

Asn Gly Gln Pro Glu Pro Glu Gly Asn Tyr Arg Thr Thr Pro Pro Gln

405 410 415

Gln Asp Val Asp Gly Thr Phe Phe Leu Tyr Ser Lys Leu Ala Val Asp

420 425 430

Lys Ala Arg Trp Asp His Gly Glu Thr Phe Glu Cys Ala Val Met His

435 440 445

Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Ile Ser Lys Thr Gln

450 455 460

Gly Lys

465

<210>15

<211>705

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>15

atggcctgga tttcacttat actctctctc ctggctctca gctcaggggc catttcccag 60

gctgttgtga ctcaggaatc tgcactcacc acatcacctg gtggaacagt catactcact 120

tgtcgctcaa gtactggggc tgttacaact agtaactatg ccaactggat acaagaaaaa 180

ccagatcatt tattcatagg actaataggt ggtaccagca accgaggacc aggtgttcct 240

gccagattct caggctccct gattggagac aaggctgccc tcaccatcat aggggcacag 300

actgaggatg aggcaatata tttctgtgct ctatggttca gaacacactt tgtattcggc 360

agtggaacca aggtcactgt cctaggtcag cccaaggccg ctcccacggt caacctcttc 420

ccgccctcct ctgaggagct cggcaccaac aaggccaccc tggtgtgtct aataagtgac 480

ttctacccgg gcgccgtgac ggtgacctgg aaggcaggcg gcaccaccgt cacccagggc 540

gtggagacca ccaagccctc gaaacagagc aacaacaagt acgcggccag cagctacctg 600

gccctgtccg ccagtgactg gaaatcttcc agcggcttca cctgccaggt cacccacgag 660

gggaccattg tggagaagac agtgacgccc tccgagtgcg cctag 705

<210>16

<211>234

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>16

Met Ala Trp Ile Ser Leu Ile Leu Ser Leu Leu Ala Leu Ser Ser Gly

1 5 10 15

Ala Ile Ser Gln Ala Val Val Thr Gln Glu Ser Ala Leu Thr Thr Ser

20 25 30

Pro Gly Gly Thr Val Ile Leu Thr Cys Arg Ser Ser Thr Gly Ala Val

35 40 45

Thr Thr Ser Asn Tyr Ala Asn Trp Ile Gln Glu Lys Pro Asp His Leu

50 55 60

Phe Ile Gly Leu Ile Gly Gly Thr Ser Asn Arg Gly Pro Gly Val Pro

65 70 75 80

Ala Arg Phe Ser Gly Ser Leu Ile Gly Asp Lys Ala Ala Leu Thr Ile

85 90 95

Ile Gly Ala Gln Thr Glu Asp Glu Ala Ile Tyr Phe Cys Ala Leu Trp

100 105 110

Phe Arg Thr His Phe Val Phe Gly Ser Gly Thr Lys Val Thr Val Leu

115 120 125

Gly Gln Pro Lys Ala Ala Pro Thr Val Asn Leu Phe Pro Pro Ser Ser

130 135 140

Glu Glu Leu Gly Thr Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp

145 150 155 160

Phe Tyr Pro Gly Ala Val Thr Val Thr Trp Lys Ala Gly Gly Thr Thr

165 170 175

Val Thr Gln Gly Val Glu Thr Thr Lys Pro Ser Lys Gln Ser Asn Asn

180 185 190

Lys Tyr Ala Ala Ser Ser Tyr Leu Ala Leu Ser Ala Ser Asp Trp Lys

195 200 205

Ser Ser Ser Gly Phe Thr Cys Gln Val Thr His Glu Gly Thr Ile Val

210 215 220

Glu Lys Thr Val Thr Pro Ser Glu Cys Ala

225 230

<210>17

<211>2169

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>17

gccgccacca tggcctggat cagcctgatc ctgagcctgc tggccctgag cagcggcgcc 60

atcagccagg ccgtggtgac ccaggagagc gccctgacca ccagccccgg cggcaccgtg 120

atcctgacct gccgcagcag caccggcgcc gtgaccacca gcaactacgc caactggatc 180

caggagaagc ccgaccacct gttcatcggc ctgatcggcg gcaccagcaa ccgcggcccc 240

ggcgtgcccg cccgcttcag cggcagcctg atcggcgaca aggccgccct gaccatcatc 300

ggcgcccaga ccgaggacga ggccatctac ttctgcgccc tgtggttccg cacccacttc 360

gtgttcggca gcggcaccaa ggtgaccgtg ctgggccagc ccaaggccgc ccccaccgtg 420

aacctgttcc cccccagcag cgaggagctg ggcaccaaca aggccaccct ggtgtgcctg 480

atcagcgact tctaccccgg cgccgtgacc gtgacctgga aggccggcgg caccaccgtg 540

acccagggcg tggagaccac caagcccagc aagcagagca acaacaagta cgccgccagc 600

agctacctgg ccctgagcgc cagcgactgg aagagcagca gcggcttcac ctgccaggtg 660

acccacgagg gcaccatcgt ggagaagacc gtgaccccca gcgagtgcgc cagcctgaac 720

ttcgacctgc tgaagctggc cggcgacgtg gagagcaacc ccggcatggg ctggacctgg 780

atcttcatcc tgatcctgag cgtgaccacc ggcgtgcaca gcgacgtgca gctgcagcag 840

agcggccccg agctgatcaa gcccggcgcc agcgtgaaga tcagctgcaa ggccagcggc 900

ttcagcttca ccggccacgg cgtgagctgg atcgtgcagc gcaacggcaa gagcctggag 960

tggatcggca acatcgaccc cggcagcggc gtgaccaact tcaaccagaa gttcaagggc 1020

aaggccaccc tgaccgtgga caagagcagc agcaccctgt acatgcacct gaccagcctg 1080

cagagcgagg acagcgccgt gtactactgc gcccgccgcc gcccctggga ctacgtgttc 1140

gactactggg gccagggcac cctggtgacc gtgagcagcg cccccaagac cgcccccagc 1200

gtgtaccccc tggccccctg cggccgcgac accagcggcc ccaacgtggc cctgggctgc 1260

ctggccagca gctacttccc cgagcccgtg accatgacct ggaacagcgg cgccctgacc 1320

agcggcgtgc acaccttccc cagcgtgctg cagcccagcg gcctgtacag cctgagcagc 1380

atggtgaccg tgcccgccag cagcctgagc agcaagagct acacctgcaa cgtgaaccac 1440

cccgccacca ccaccaaggt ggacaagcgc gtgggcacca agaccaagcc cccctgcccc 1500

atctgccccg gctgcgaggt ggccggcccc agcgtgttca tcttcccccc caagcccaag 1560

gacaccctga tgatcagcca gacccccgag gtgacctgcg tggtggtgga cgtgagcaag 1620

gagcacgccg aggtgcagtt cagctggtac gtggacggcg tggaggtgca caccgccgag 1680

acccgcccca aggaggagca gttcaacagc acctaccgcg tggtgagcgt gctgcccatc 1740

cagcaccagg actggctgaa gggcaaggag ttcaagtgca aggtgaacaa cgtggacctg 1800

cccgccccca tcacccgcac catcagcaag gccatcggcc agagccgcga gccccaggtg 1860

tacaccctgc ccccccccgc cgaggagctg agccgcagca aggtgaccgt gacctgcctg 1920

gtgatcggct tctacccccc cgacatccac gtggagtgga agagcaacgg ccagcccgag 1980

cccgagggca actaccgcac cacccccccc cagcaggacg tggacggcac cttcttcctg 2040

tacagcaagc tggccgtgga caaggcccgc tgggaccacg gcgagacctt cgagtgcgcc 2100

gtgatgcacg aggccctgca caaccactac acccagaaga gcatcagcaa gacccagggc 2160

aagtgatga 2169

<210>18

<211>718

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>18

Met Ala Trp Ile Ser Leu Ile Leu Ser Leu Leu Ala Leu Ser Ser Gly

1 5 10 15

Ala Ile Ser Gln Ala Val Val Thr Gln Glu Ser Ala Leu Thr Thr Ser

20 25 30

Pro Gly Gly Thr Val Ile Leu Thr Cys Arg Ser Ser Thr Gly Ala Val

35 40 45

Thr Thr Ser Asn Tyr Ala Asn Trp Ile Gln Glu Lys Pro Asp His Leu

50 55 60

Phe Ile Gly Leu Ile Gly Gly Thr Ser Asn Arg Gly Pro Gly Val Pro

65 70 75 80

Ala Arg Phe Ser Gly Ser Leu Ile Gly Asp Lys Ala Ala Leu Thr Ile

85 90 95

Ile Gly Ala Gln Thr Glu Asp Glu Ala Ile Tyr Phe Cys Ala Leu Trp

100 105 110

Phe Arg Thr His Phe Val Phe Gly Ser Gly Thr Lys Val Thr Val Leu

115 120 125

Gly Gln Pro Lys Ala Ala Pro Thr Val Asn Leu Phe Pro Pro Ser Ser

130 135 140

Glu Glu Leu Gly Thr Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp

145 150 155 160

Phe Tyr Pro Gly Ala Val Thr Val Thr Trp Lys Ala Gly Gly Thr Thr

165 170 175

Val Thr Gln Gly Val Glu Thr Thr Lys Pro Ser Lys Gln Ser Asn Asn

180 185 190

Lys Tyr Ala Ala Ser Ser Tyr Leu Ala Leu Ser Ala Ser Asp Trp Lys

195 200 205

Ser Ser Ser Gly Phe Thr Cys Gln Val Thr His Glu Gly Thr Ile Val

210 215 220

Glu Lys Thr Val Thr Pro Ser Glu Cys Ala Ser Leu Asn Phe Asp Leu

225 230 235 240

Leu Lys Leu Ala Gly Asp Val Glu Ser Asn Pro Gly Met Gly Trp Thr

245 250 255

Trp Ile Phe Ile Leu Ile Leu Ser Val Thr Thr Gly Val His Ser Asp

260 265 270

Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Ile Lys Pro Gly Ala Ser

275 280 285

Val Lys Ile Ser Cys Lys Ala Ser Gly Phe Ser Phe Thr Gly His Gly

290 295 300

Val Ser Trp Ile Val Gln Arg Asn Gly Lys Ser Leu Glu Trp Ile Gly

305 310 315 320

Asn Ile Asp Pro Gly Ser Gly Val Thr Asn Phe Asn Gln Lys Phe Lys

325 330 335

Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Leu Tyr Met

340 345 350

His Leu Thr Ser Leu Gln Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala

355 360 365

Arg Arg Arg Pro Trp Asp Tyr Val Phe Asp Tyr Trp Gly Gln Gly Thr

370 375 380

Leu Val Thr Val Ser Ser Ala Pro Lys Thr Ala Pro Ser Val Tyr Pro

385 390 395 400

Leu Ala Pro Cys Gly Arg Asp Thr Ser Gly Pro Asn Val Ala Leu Gly

405 410 415

Cys Leu Ala Ser Ser Tyr Phe Pro Glu Pro Val Thr Met Thr Trp Asn

420 425 430

Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ser Val Leu Gln

435 440 445

Pro Ser Gly Leu Tyr Ser Leu Ser Ser Met Val Thr Val Pro Ala Ser

450 455 460

Ser Leu Ser Ser Lys Ser Tyr Thr Cys Asn Val Asn His Pro Ala Thr

465 470 475 480

Thr Thr Lys Val Asp Lys Arg Val Gly Thr Lys Thr Lys Pro Pro Cys

485 490 495

Pro Ile Cys Pro Gly Cys Glu Val Ala Gly Pro Ser Val Phe Ile Phe

500 505 510

Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Gln Thr Pro Glu Val

515 520 525

Thr Cys Val Val Val Asp Val Ser Lys Glu His Ala Glu Val Gln Phe

530 535 540

Ser Trp Tyr Val Asp Gly Val Glu Val His Thr Ala Glu Thr Arg Pro

545 550 555 560

Lys Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu Pro

565 570 575

Ile Gln His Gln Asp Trp Leu Lys Gly Lys Glu Phe Lys Cys Lys Val

580 585 590

Asn Asn Val Asp Leu Pro Ala Pro Ile Thr Arg Thr Ile Ser Lys Ala

595 600 605

Ile Gly Gln Ser Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Pro Ala

610 615 620

Glu Glu Leu Ser Arg Ser Lys Val Thr Val Thr Cys Leu Val Ile Gly

625 630 635 640

Phe Tyr Pro Pro Asp Ile His Val Glu Trp Lys Ser Asn Gly Gln Pro

645 650 655

Glu Pro Glu Gly Asn Tyr Arg Thr Thr Pro Pro Gln Gln Asp Val Asp

660 665 670

Gly Thr Phe Phe Leu Tyr Ser Lys Leu Ala Val Asp Lys Ala Arg Trp

675 680 685

Asp His Gly Glu Thr Phe Glu Cys Ala Val Met His Glu Ala Leu His

690 695 700

Asn His Tyr Thr Gln Lys Ser Ile Ser Lys Thr Gln Gly Lys

705 710 715

<210>19

<211>21

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>19

cttgggctga cctaggacag t 21

<210>20

<211>21

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>20

caggctgttg tgactcagga a 21

<210>21

<211>20

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>21

gacagtggat aracmgatgg 20

<210>22

<211>23

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>22

gaggtsmarc tgcagsagtc wgg 23

Claims (16)

1.A chimeric monoclonal antibody that binds to an ASFV P54 protein, comprising a heavy chain and a light chain, characterized in that: the light chain comprises a light chain variable region and a light chain constant region, and the heavy chain comprises a heavy chain variable region and a heavy chain constant region; the light chain variable region is SEQ ID No:6, and the heavy chain variable region is a sequence shown in SEQ ID No: 2; the light chain constant region and the heavy chain constant region are both derived from porcine antibodies.

2. The chimeric monoclonal antibody that binds to an ASFV P54 protein according to claim 1, characterized in that: the light chain constant region is SEQ ID No: 8, and the heavy chain constant region is a sequence shown in SEQ ID No: 4.

3. The chimeric monoclonal antibody that binds to an ASFV P54 protein according to claim 1, characterized in that: the heavy and light chains are bound by interchain disulfide bonds.

4. The chimeric monoclonal antibody that binds to an ASFV P54 protein according to claim 1, characterized in that: the heavy chain and the light chain of the chimeric monoclonal antibody are respectively SEQ ID No: 14. SEQ ID No: 16, or a variant thereof.

5. A gene encoding the chimeric monoclonal antibody that binds to ASFV P54 protein according to any one of claims 1 to 4, wherein the gene encoding the light chain is a light chain variable region represented by SEQ ID No:15, and the gene of the coding heavy chain is SEQ ID No:13, and (c) a sequence shown in (c).

6. An expression vector comprising the gene encoding the chimeric monoclonal antibody that binds to ASFV P54 protein according to claim 5.

7. The expression vector of claim 6, wherein: the expression vector is obtained by inserting the gene encoding the chimeric monoclonal antibody binding to the ASFVP54 protein between EcoRI and HindIII of pAAV-CAG vector.

8.The expression vector of claim 6, wherein: the gene coding the heavy chain and the gene coding the light chain are inserted into the expression vector behind the CAG promoter, and the gene coding the heavy chain and the gene coding the light chain are connected through a connecting peptide.

9. The expression vector of claim 8, wherein: the linker peptide includes FMDV 2A peptide.

10. A transformant containing the gene encoding the chimeric monoclonal antibody that binds to the ASFV P54 protein according to claim 5.

11. The transformant according to claim 10, characterized in that: the transformant is obtained by co-transfecting the expression vector of any one of claims 6 to 9 with a pHelper vector and a pAAV-RC vector into a host cell.

12. The transformant according to claim 11, characterized in that: the host cell includes a HEK293 cell.

13. Use of the chimeric monoclonal antibody binding to the ASFV P54 protein according to any one of claims 1 to 4, the gene encoding the chimeric monoclonal antibody binding to the ASFV P54 protein according to claim 5, or the expression vector according to any one of claims 6 to 9, or the transformant according to any one of claims 10 to 12 for the preparation of a reagent for detecting african swine fever virus, for the preparation of a medicament for inducing an immune response against an antigen of african swine fever virus in a test animal, or for the preparation of a medicament for preventing an infection of an animal with african swine fever virus.

14. A method for producing a recombinant AAV, comprising: culturing host cells, adding transfection reagent when the cells grow to 50% -70% fusion, adding the expression vector of any one of claims 6-9, pAAV2-RC vector and pHelper vector to co-transfect the host cells, culturing at room temperature for more than 5h, changing fresh culture medium, continuing culturing and collecting cells, repeatedly freezing and thawing the collected cells for lysis, and performing post-treatment to extract the recombinant AAV.

15. The method of claim 14, wherein: the host cell is HEK293 cell.

16. The method of claim 14, wherein: the transfection reagent is polyethyleneimine.

Images