CN110713962A

CN110713962A - Genetic engineering bacterium for high-yield production of malonyl coenzyme A and construction method and application thereof

Info

Publication number: CN110713962A
Application number: CN201910845556.3A
Authority: CN
Inventors: 吴俊俊; 周朋; 包美娇; 董明盛
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2019-09-06
Filing date: 2019-09-06
Publication date: 2020-01-21
Anticipated expiration: 2039-09-06
Also published as: CN110713962B

Abstract

The invention discloses a genetically engineered bacterium for high yield of malonyl coenzyme A and a construction method and application thereof, wherein the genetically engineered bacterium is constructed by knocking out five genes including ldhA, pta, frdA, poxB and adhE in a genome of escherichia coli, and then introducing genes of a malonyl coenzyme A synthesis path, including an acetyl coenzyme A synthetase gene of the escherichia coli, an acetyl coenzyme A carboxylase gene of salmonella enterica and a biotin ligase gene of corynebacterium glutamicum. The engineering bacteria can efficiently synthesize a precursor substance malonyl coenzyme A of a flavonoid compound by taking a metabolic byproduct acetic acid of escherichia coli as a substrate and improving the yield of naringenin which is a precursor substance of the flavonoid compound skeleton by a microbiological method.

Description

Genetic engineering bacterium for high-yield production of malonyl coenzyme A and construction method and application thereof

Technical Field

The invention belongs to the technical field of gene recombination, and particularly relates to a genetic engineering bacterium for high yield of malonyl coenzyme A, and a construction method and application thereof.

Background

Malonyl coenzyme A (malonyl coenzyme A), also known as malonyl coenzyme A, is a coenzyme A derivative and is a key compound in the essential metabolic pathway of microorganisms. In an Escherichia coli (Escherichia coli) metabolic network, glucose is used as a carbon source, acetyl coenzyme A is generated through a glycolysis pathway, most of the acetyl coenzyme A is circularly metabolized into carbon dioxide and water through citric acid, and a small part of the acetyl coenzyme A is converted into malonyl coenzyme A through acetyl coenzyme A carboxylase through a fatty acid metabolic pathway, so that the acetyl coenzyme A is widely involved in the metabolic activities of various important substances such as lipid, carbohydrate, amino acid and the like. Meanwhile, malonyl-coa is also an important signaling molecule, and is involved in transcriptional regulation of lipid biosynthesis and transcriptional regulation of fatty acid biosynthesis in many organisms.

Malonyl-coa is widely involved in the synthesis of various metabolites in animals and plants. Malonyl-coa provides a two-carbon unit for fatty acids in fatty acid synthesis, extending the fatty acid carbon chain by two carbon units. A regulation and control system of malonyl coenzyme A-FapR exists in Bacillus subtilis, and when the intracellular malonyl coenzyme A concentration is sufficient, the inhibition of the FapR on a fatty acid synthesis gene can be released, so that the expression of the fatty acid synthesis gene is promoted. Meanwhile, malonyl coenzyme A participates in the fat deposition activity in animals, acetyl coenzyme A and malonyl coenzyme A are converted into triglyceride under the catalysis of fatty acid synthase, and malonyl coenzyme A is used as an important intermediate product of fat metabolism and plays an important regulation and control role in the metabolic process of fat cells. malonyl-CoA also participates in the synthesis of flavonoids and polyketones in plants, and the microbial synthesis of high-value compounds can be realized in microorganisms by utilizing the assembly of related pathway genes, and is limited by the lower malonyl-CoA concentration in the microorganisms, and the malonyl-CoA becomes a key rate-limiting precursor substance for synthesizing high-value compounds such as curcumin, naringenin, resveratrol and the like by a microbial method, wherein the flavonoids have high pharmacological functions and are widely concerned.

In order to increase the intracellular concentration of malonyl-CoA and break through the bottleneck of the microbiological synthesis of flavonoids, many attempts have been made. Coli converts intracellular acetyl-coa into malonyl-coa by acetyl-coa carboxylase, which includes four subunits of biotin carboxylase subunit, biotin carboxyl carrier protein subunit (BCCP), carboxytransferase α and β subunit, Lu and the like improves intracellular acetyl-coa conversion efficiency and increases intracellular malonyl-coa content by over-expressing the acetyl-coa carboxylase of e. However, researches show that the biotin carboxyl carrier protein subunit of the Escherichia coli can form negative feedback regulation on intracellular acetyl coenzyme A carboxylase and reduce the content of the intracellular acetyl coenzyme A carboxylase. Thus, Miyahisa et al greatly increased intracellular malonyl-CoA concentration by overexpressing two acetyl-CoA carboxylase subunits encoded by accBC and dtsR1 genes of Corynebacterium glutamicum (Corynebacterium glutamicum) to achieve naringenin and pinocembrin yields of 60 mg/L.

Intracellular acetyl-CoA is involved in the citric acid cycle and is also an important intermediate metabolite, and overexpression of acetyl-CoA carboxylase inevitably affects the supply of intracellular acetyl-CoA, so Leonard et al convert acetic acid, a byproduct of E.coli metabolism, into acetyl-CoA by overexpression of acetyl-CoA synthetase, and provide sufficient precursor substance for malonyl-CoA synthesis. Acetic acid is partially ionized in the system, and the non-ionized acetic acid enters cells to weaken proton driving force and influence the generation of ATP (adenosine triphosphate) so as to influence the growth of thalli and the expression of recombinant protein. In the E.coli metabolic network, acetyl-CoA also flows to some non-essential by-products, resulting in a decrease in intracellular acetyl-CoA content. These studies uniformly increase the intracellular malonyl-coa levels of the microorganisms, but lack deep mining of pathway-related genes and efficient integration of multiple pathways.

Disclosure of Invention

The purpose of the invention is as follows: aiming at the problems in the prior art, the invention provides a genetic engineering bacterium for efficiently accumulating malonyl coenzyme A, which is a genetic engineering bacterium for producing malonyl coenzyme A modified by chassis microorganisms, inhibits the outflow path of acetyl coenzyme A in the engineering bacterium, constructs a malonyl coenzyme A synthesis path to different expression vectors and transfers the expression vectors into the engineering bacterium, and realizes the efficient accumulation of malonyl coenzyme A. The engineering bacteria can efficiently synthesize the precursor malonyl coenzyme A of the flavonoid compound by using the metabolic byproduct acetic acid of escherichia coli as a substrate, break through the bottleneck of the synthesis path of the flavonoid compound and improve the efficiency of synthesizing the flavonoid compound by a microbiological method.

The invention also provides a construction method and application of the genetic engineering bacterium for high-yield production of malonyl coenzyme A.

The technical scheme is as follows: in order to achieve the above object, the present invention provides a genetically engineered bacterium for high yield of malonyl-coa, which is constructed by knocking out five genes of ldhA, pta, frdA, poxB, and adhE in the genome of escherichia coli, and introducing a malonyl-coa synthesis pathway gene including an acetyl-coa synthase gene acs of escherichia coli, an acetyl-coa carboxylase gene seaccac of salmonella enterica including three subunits seacaca, seacc, and a biotin ligase gene cgbirA of corynebacterium glutamicum.

Wherein the five genes ldhA (Gene ID:946315), pta (Gene ID:946778), frdA (Gene ID:948667), poxB (Gene ID:946132) and adhE (Gene ID:945837) are a competitive metabolic pathway-related Gene ldhA that flows to lactic acid, a competitive metabolic pathway-related Gene pta that flows to acetyl phosphate, a competitive metabolic pathway-related Gene frdA that flows to succinic acid, a competitive metabolic pathway-related Gene poxB that flows to acetic acid, and a competitive metabolic pathway-related Gene adhE that flows to ethanol, respectively.

Wherein, the acetyl coenzyme A synthetase gene acs of the Escherichia coli is transcribed, translated and synthesized to generate acetyl coenzyme A synthetase, and the acetic acid is converted into acetyl coenzyme A; the acetyl coenzyme A carboxylase gene seaccaCD of the salmonella enterica is transcribed and translated to synthesize acetyl coenzyme A carboxylase to convert acetyl coenzyme A into malonyl coenzyme A; the biotin ligase gene cgbirA of corynebacterium glutamicum is transcribed and translated to synthesize biotin ligase so as to assist in improving the activity of acetyl coenzyme A carboxylase.

The genetic engineering bacteria for producing the malonyl coenzyme A are modified by chassis microorganisms, and the modification of the chassis microorganisms comprises the knock-out of genes ldhA, pta, adhE, poxB and frdA; meanwhile, a brand-new synthesis path of malonyl coenzyme A and a brand-new gene of the synthesis path of malonyl coenzyme A are constructed in the engineering bacteria, and the genes for synthesizing malonyl coenzyme A comprise acetyl coenzyme A synthetase genes acs of escherichia coli, acetyl coenzyme A carboxylase subunits seaccA, seaccC and seaccD of salmonella enterica and biotin ligase genes cgbirA of corynebacterium glutamicum.

According to the invention, genes ldhA, pta, adhE, poxB and frdA are genes of acetyl coenzyme A flowing to lactic acid, acetyl phosphate, ethanol, acetic acid and succinic acid, and after knockout, outflow of acetyl coenzyme A is inhibited, so that the content of intracellular acetyl coenzyme A is increased, and acetyl coenzyme A is taken as a direct precursor substance of malonyl coenzyme A, so that the content of intracellular malonyl coenzyme A can be indirectly increased; the acetyl-CoA synthetase Acs of Escherichia coli can convert the metabolic by-product acetic acid into acetyl-CoA, further increasing the intracellular content of acetyl-CoA, and the acetyl-CoA carboxylase SeacccACD of Salmonella enterica can convert acetyl-CoA into malonyl-CoA, increasing the intracellular content of malonyl-CoA. The biotin ligase Cgbira of Corynebacterium glutamicum can assist SeaccaCD in activity, and further improve the intracellular malonyl-CoA content. The malonyl-CoA content was increased from 0.085nmol/mg DCW to 0.812nmol/mg DCW.

The malonyl-coa synthesis pathway of the present invention comprises synthesizing acetyl-coa from a metabolic byproduct of a microorganism, acetic acid, by acetyl-coa synthetase to increase intracellular acetyl-coa content, and then converting acetyl-coa to malonyl-coa using acetyl-coa carboxylase, while co-expressing biotin ligase to further increase the activity of acetyl-coa carboxylase to efficiently convert acetyl-coa to malonyl-coa.

The expression vector comprises the acetyl coenzyme A synthetase gene acs of escherichia coli, the acetyl coenzyme A carboxylase gene seaccaCD of salmonella enterica and the biotin ligase gene cgbirA of corynebacterium glutamicum.

Further, the expression vector comprises the malonyl coenzyme A synthetic pathway, and the expression vector of the genetically engineered bacterium comprising the malonyl coenzyme A synthetic pathway comprises vectors O-acs-cgbirA and A-seaccaCD formed by acs, seaccaCD and cgbirA. Wherein the vector O-acs-cgbirA comprises two genes acs and cgbirA; the vector A-seaccaCD comprises the gene seaccaCD, or formed plasmids pCOLA-acs-cgbirA and pACYC-seaccA-seaccC-SsecacD.

Furthermore, the expression vector constructs acetyl coenzyme A synthetase gene acs of Escherichia coli, acetyl coenzyme A carboxylase gene seacACD of Salmonella enterica and biotin ligase gene cgbirA of Corynebacterium glutamicum on the expression vector so as to be convenient for replication and expression in microorganisms.

The synthesis path of malonyl coenzyme A mainly leads expression vectors O-acs-cgbirA and A-seacACD into genetic engineering bacteria modified by a chassis.

The construction method of the genetic engineering bacteria for high yield of malonyl coenzyme A comprises the following steps:

(1) knocking out five genes of ldhA, pta, frdA, poxB and adhE in the genome of the escherichia coli by using a CRISPR/Cas9 method; carrying out amplification, enzyme digestion, enzyme linkage and transformation on a gene sequence design primer for knocking out five genes to obtain a strain subjected to gene knockout modification;

(2) designing a primer by taking a genome of escherichia coli as a template, amplifying to obtain an acs gene encoding acetyl coenzyme A synthetase in the escherichia coli, and introducing the acs gene into the strain subjected to gene knockout modification in the step (1) to obtain a strain containing the acs gene encoding acetyl coenzyme A synthetase in the escherichia coli;

(3) designing a primer by taking the salmonella enterica genome as a template, amplifying to obtain an acetyl-CoA carboxylase gene of the salmonella enterica, and introducing the acetyl-CoA carboxylase gene into the strain containing the acs gene coding the acetyl-CoA synthetase in the escherichia coli in the step (2) to obtain a strain containing the acs gene coding the acetyl-CoA synthetase in the escherichia coli and the acetyl-CoA carboxylase gene of the salmonella enterica;

(4) and (3) designing a primer by taking the corynebacterium glutamicum genome as a template, amplifying to obtain a biotin ligase gene cgbirA of the corynebacterium glutamicum, and introducing the gene cgbirA into the strain containing the acs gene coding acetyl coenzyme A synthetase in escherichia coli and the acetyl coenzyme A carboxylase gene of salmonella enterica in the step (3) to obtain the genetic engineering bacteria for high-yield malonyl coenzyme A.

The method is a schematic process method for constructing the genetic engineering bacteria for high yield of malonyl coenzyme A, and three genes can be simultaneously introduced into a strain subjected to gene knockout modification in actual construction; or separately introducing the strain subjected to gene knockout modification; or cloning the biotin ligase gene cgbirA of corynebacterium glutamicum to a vector containing an acs gene of coding acetyl coenzyme A synthetase in escherichia coli, and transferring the vector containing three subunit genes of the acetyl coenzyme A carboxylase of salmonella enterica and the vector into the genetically engineered bacterium subjected to gene knockout in the step (1) to perform co-expression to obtain the genetically engineered bacterium with high malonyl coenzyme A yield.

The genetic engineering bacteria for high yield of malonyl coenzyme A disclosed by the invention are applied to high-efficiency accumulation of malonyl coenzyme A. Wherein the intracellular malonyl-coenzyme A content is increased from 0.085nmol/mg DCW to 0.812nmol/mg DCW.

The application of the genetic engineering bacteria for high yield of malonyl coenzyme A in improving the synthesis efficiency of flavonoid compounds by the microbiological method introduces naringenin pathway genes into the genetic engineering bacteria for high yield of malonyl coenzyme A, and the yield of naringenin synthesis by the microbiological method is increased from 16mg/L to 252.31 mg/L. Namely, the genetic engineering bacteria can utilize intracellular malonyl coenzyme A with higher concentration to improve the yield of naringenin which is a precursor substance of flavonoid compound skeleton synthesized by a microbiological method, and the yield of the naringenin is improved from 16mg/L to 252.31 mg/L.

Aiming at the defects that the intracellular malonyl coenzyme A of the microorganism is low and cannot meet the requirement of synthesizing flavonoids, the chassis of a fermentation strain is modified, 5 genes of an acetyl coenzyme A outflow path are knocked out, the consumption of the acetyl coenzyme A is inhibited, the content of the intracellular acetyl coenzyme A is increased, acetyl coenzyme A synthetase is designed to synthesize the metabolic byproduct acetic acid of the microorganism into the acetyl coenzyme A, the content of the intracellular acetyl coenzyme A is further increased, then the acetyl coenzyme A is converted into the malonyl coenzyme A by the acetyl coenzyme A carboxylase, the activity of the acetyl coenzyme A carboxylase is further increased by co-expressing biotin ligase, and the acetyl coenzyme A is efficiently converted into the malonyl coenzyme A. The invention firstly applies a series of strategies in combination in genetic engineering bacteria to comprehensively improve the content of intracellular malonyl coenzyme A, simultaneously firstly prefers that the acetyl coenzyme A synthetase of escherichia coli has the highest acetyl coenzyme A synthesis activity, simultaneously three acetyl coenzyme A carboxylase subunits of salmonella enterica can have very high malonyl coenzyme A synthesis activity under the assistance of biotin ligase of corynebacterium glutamicum, and the content of intracellular malonyl coenzyme A is improved from initial 0.085nmol/mg DCW to 0.812nmol/mg DCW.

In general, the present invention is mainly embodied in the following 5 aspects:

1. the first aspect of the present invention is to provide a novel pathway for synthesizing malonyl-CoA from acetic acid and a novel gene of the malonyl-CoA synthesis pathway.

The synthetic pathway includes synthesizing acetyl-CoA from the metabolic byproduct acetate of the microorganism by acetyl-CoA synthetase to increase the intracellular content of acetyl-CoA, then converting acetyl-CoA into malonyl-CoA using acetyl-CoA carboxylase, and co-expressing biotin ligase to further increase the activity of acetyl-CoA carboxylase to efficiently convert acetyl-CoA into malonyl-CoA.

The malonyl-CoA synthesis pathway genes include acetyl-CoA synthetase from Escherichia coli itself, acetyl-CoA carboxylase A subunit of Salmonella enterica, acetyl-CoA carboxylase C subunit of Salmonella enterica, acetyl-CoA carboxylase D subunit of Salmonella enterica, biotin ligase from Corynebacterium glutamicum.

2. The second aspect of the invention is to provide a genetic engineering bacterium for efficiently accumulating malonyl-CoA, which can efficiently synthesize malonyl-CoA by taking acetic acid as a substrate and improve the content of intracellular malonyl-CoA.

3. In a third aspect of the present invention, there is provided a method for constructing a base cell (i.e., a genetically engineered bacterium) that efficiently accumulates malonyl-coa according to the first aspect of the present invention, comprising: (1) regulation of intracellular acetyl-coa metabolic flux in e.coli (i.e. gene knock-out); (2) overexpresses an acetyl-coa synthetase; (3) overexpresses acetyl-coa carboxylase; (4) overexpresses biotin ligase.

4. The fourth aspect of the invention is to provide an expression vector, wherein the gene related to the efficiently accumulated malonyl-CoA is constructed on the expression vector so as to be convenient for replication and expression in a microorganism.

5. The fifth aspect of the invention is the application of the genetic engineering bacteria capable of efficiently accumulating malonyl coenzyme A, which is constructed by the invention, converts the metabolic byproduct acetic acid of escherichia coli into malonyl coenzyme A, improves the intracellular malonyl coenzyme A content of the engineering bacteria, can be used for the microbiological synthesis of flavonoid compounds and polyketide compounds, can effectively break through the bottleneck steps of the way, and improves the synthesis efficiency.

Has the advantages that: compared with the prior art, the invention has the following advantages:

the invention deeply excavates related genes of the way and effectively integrates various ways for improving the content of intracellular malonyl coenzyme A. The invention constructs a brand-new genetic engineering bacterium for high yield of malonyl coenzyme A and a brand-new way for converting acetic acid into malonyl coenzyme A. The invention carries out chassis transformation on the genetic engineering bacteria, simultaneously knocks out 5 genes of acetyl coenzyme A outflow path, and improves the intracellular malonyl coenzyme A content from initial 0.085nmol/mg DCW to 0.190nmol/mg DCW; the acetyl coenzyme A synthetase with the highest efficiency is screened out and expressed in the genetic engineering bacteria modified by the chassis, and the intracellular malonyl coenzyme A concentration of 0.085nmol/mg is improved to 0.406nmol/mg DCW; screening acetyl coenzyme A carboxylase and biotin ligase with the highest efficiency on the basis of the optimized acetyl coenzyme A synthetase, and increasing the intracellular malonyl coenzyme A content from the initial 0.085nmol/mg DCW to 0.812nmol/mg DCW; the metabolic byproduct acetic acid is converted into acetyl coenzyme A by acetyl coenzyme A synthetase, the acetic acid content is reduced while the intracellular acetyl coenzyme A concentration is improved, and the toxicity of the accumulation of acetic acid on genetic engineering bacteria is avoided. The gene engineering bacteria with high malonyl coenzyme A yield is used as a base cell, the naringenin synthesis pathway is transferred into the gene engineering bacteria, and the yield of the naringenin is increased from 16mg/L to 252.31 mg/L.

The engineering bacteria can efficiently synthesize the precursor malonyl coenzyme A of the flavonoid compound by using the metabolic byproduct acetic acid of escherichia coli as a substrate, break through the bottleneck of the synthesis path of the flavonoid compound and improve the efficiency of synthesizing the flavonoid compound by a microbiological method.

Drawings

FIG. 1 is a schematic representation of the effect of modification of the acetyl-CoA metabolic pathway on intracellular acetyl-CoA and malonyl-CoA levels;

FIG. 2 is a schematic representation of the effect of over-expression of acetyl-CoA synthetase from different sources on intracellular acetyl-CoA and malonyl-CoA levels;

FIG. 3 is a schematic representation of the effect of over-expression of acetyl-CoA carboxylase from different sources on intracellular malonyl-CoA content;

FIG. 4 is a schematic representation of the effect of overexpression of biotin ligase from different sources on intracellular malonyl-CoA concentration;

FIG. 5 high performance liquid chromatogram of naringenin.

Detailed Description

The following further description is made in conjunction with the accompanying drawings and examples.

All the raw materials, reagents, vectors, strains, restriction enzymes and the like in the present invention are commercially available unless otherwise specified. The Gene numbers (Gene ID) in the present invention are all numbers on NCBI.

Example 1

Base cell construction for knocking out 5 acetyl coenzyme A outflow pathway genes

Strains and plasmids

Escherichia coli (Escherichia coli JM109) was used for the replication of plasmids, Escherichia coli BL21(DE3) was used for the expression of pathway plasmids and the fermentation of strains, which were purchased from Novagen (Darmstatt, Germany). Plasmids pCDFDuet-1, pETDuet-1, pCOLADuet-1, pACYCDuet-1 were purchased from Novagen (Damschtatt, Germany).

Enzymes and other reagents

Various antibiotics including ampicillin and chloramphenicol are available from Shanghai Producer, Inc. Various chemical reagents were analytically pure and purchased from Shanghai Biotech, Inc. Various restriction enzymes and DNA ligases were purchased from Thermo. The 1kb DNA Ladder, the plasmid miniprep kit, the gel recovery kit and the bacterial genome extraction kit are purchased from Shanghai Production GmbH.

The plasmid extraction operation is carried out by adopting a small plasmid extraction kit of Shanghai Biotechnology Limited. The genome extraction operation is carried out by adopting a genome extraction kit of Shanghai Biotechnology Ltd.

The digestion and ligation of the plasmid were performed according to the instructions of the restriction enzyme and ligase kit of Thermo. One-step cloning was performed according to the One step kit of Novowed, using the instructions.

Meanwhile, the methods of PCR amplification, detection, enzyme linkage, transformation, expression and the like in the embodiment of the invention are all conventional molecular biological methods.

Main instrument (see table 1)

TABLE 1 instruments used

Preparation of culture Medium

Lb (luria broth) liquid medium: 10g/L tryptone, 5g/L yeast extract, 10g/L NaCl, pH 7.0; sterilizing with high pressure steam at 121 deg.C for 20 min.

LB solid medium: adding 2% agar powder on the basis of LB (Luria broth) liquid culture medium; sterilizing with high pressure steam at 121 deg.C for 20 min.

Fermentation medium:

10 × MOPS mother liquor: (1)77.76g MOPS (potassium morpholinopropane sulfonate) is dissolved in 300mL deionized water, then the pH is adjusted to 7.4 by KOH, the volume is adjusted to 400mL by deionized water, and the solution is filtered by a 0.45 mu L sterile water system filter membrane; (2)7.1668g Tricine (N-Tris (hydroxymethyl) -methyl glycine) dissolved in 30mL deionized water and adjusted to pH 7.4 with KOH; (3)0.0278g FeSO₄·7H₂O；5.08156g NH₄Cl；0.481g K₂SO₄(ii) a 29.22g of NaCl is added into 400mL of deionized water to be dissolved, and steam sterilization is carried out for 20min at 121 ℃ under high pressure; (4) microelement 3.708X 10^-2g(NH₄)₆(MO₇)₂₄·4H₂O，2.4732×10^-1g H₃BO₂，7.1379×10^-2g CoCl₂·6H₂O，2.497×10^-2gCuSO₄·5H₂O，1.583×10^-1g MnCl₂·3H₂O，2.8756×10^-2g ZnSO₄·7H₂O，5.549×10^-1gCaCl₂10mL of deionized water was added to dissolve the residue, and the solution was sterilized through a 0.45. mu.L filter.

400mL of fraction (1); 40mL of fraction (2); 400mL of fraction (3); 1 μ L of fraction (4); the volume of the deionized water is up to 1L.

MOPS medium: 10 × MOPS mother liquor 100mL, 0.296g K₂HPO₄·3H₂O, 5g glucose, 4g ammonium chloride, 900mL sterile distilled water. Sterilizing with high pressure steam at 121 deg.C for 20 min.

CRISPR/Cas9 technical knockout modification of acetyl coenzyme A metabolic pathway

Five genes of ldhA, pta, frdA, poxB and adhE in a genome of Escherichia coli E.coli BL21(DE3) are knocked out by using a CRISPR/Cas9 technology, and primers and plasmids used for knocking out the genes by using the CRISPR/Cas9 are shown in Table 2.

The specific operation steps are as follows, taking the knock-out gene ldhA as an example:

a full-plasmid PCR introduction mutation was carried out using p-target full plasmid (Takara) as a template and primers Pf _ ldhA (Knock) (SEQ ID NO.1) and Pr _ Ptarget (SEQ ID NO.6) to replace the 20bp N20 sequence of the original sgRNA. Add 1. mu.g Dpn I, 5. mu.L Green Buffer to PCR system, react for 30min at 37 ℃ and digest the methylated template plasmid DNA. And (3) carrying out 1% agarose gel electrophoresis on the PCR system digested by Dpn I, cutting the gel to recover a target DNA fragment, carrying out phosphorylation reaction on the DNA fragment by BluntingKination, and connecting the DNA fragment for 16h at the temperature of 16 ℃. And (3) transforming the connecting liquid into escherichia coli (Escherichia coli JM109) competence, picking colony sequencing for verification after a transformant grows out, and extracting a plasmid to obtain an improved plasmid p-target (ldhA).

Primers Pf _ ldhA (upstream) (BamHI) (SEQ ID NO.2), Pr _ ldhA (upstream) (SEQ ID NO.3) and Pf _ ldhA (downstream) (SEQ ID NO.4), Pr _ ldhA (downstream) (XhoI) (SEQ ID NO.5) were designed for the upstream 500bp sequence and the downstream 500bp sequence of the gene sequence to be knocked out, respectively. Coli (e.coli BL21(DE3)) genome upstream 500bp and downstream 500bp fragments of the gene sequence to be knocked out were amplified by PCR using primers Pf _ ldhA (upstream) (BamHI), Pr _ ldhA (upstream) and Pf _ ldhA (downstream), Pr _ ldhA (downstream) (XhoI), respectively. The PCR amplified fragments are respectively subjected to gel recovery, and fusion PCR is carried out by taking the upstream 500bp fragment and the downstream 500bp fragment which are subjected to gel recovery and purification as templates and using primers Pf _ ldhA (upstream) (BamHI) and Pr _ ldhA (downstream) (XhoI) to obtain fusion fragments of the upstream 500bp and the downstream 500bp containing the gene sequence to be knocked out. The fusion fragment was ligated into the T vector pMD^TM19(Simple) (Takara) gave a T-fusion (ldhA) plasmid.

The pcas plasmid (Takara) was transformed into the strain BL21 to be transformed (DE 3). BL21(pcas) was inoculated into 5mL of LB medium, and 5. mu.L of kana resistant solution (final concentration: 50. mu.g/mL) was added to the LB medium, followed by shaking culture overnight (30 ℃, 200rpm, 12 hours). Inoculated at a volume ratio of 1% in 50mL of LB medium containing 50. mu.g/mL of kana-resistant solution, shake-cultured (30 ℃, 200rpm) to OD₆₀₀When the concentration was 0.2, 500. mu.L of 1mol/L arabinose (final concentration: 10mmol/L) was added. Shaking culture (30 ℃, 200rpm) to OD₆₀₀The broth was transferred to a 50mL EP tube and cooled on ice for 15min, 0.6. The cells were collected by centrifugation (2500g, 10min, 4 ℃), washed 2 times with 25mL of chilled sterile water, and then 2 times with 25mL of chilled 10% glycerol. 400 μ L of pre-cooled 10% glycerol was added to resuspend the cells, 50 μ g per tube and stored at-80 ℃.

Obtaining a fusion fragment of upstream 500bp and downstream 500bp of a gene to be knocked out by BamHI/XhoI double enzyme digestion, and simultaneously extracting a ptarget (ldhA) plasmid. Taking BL21(pcas) competent cells out of a refrigerator at-80 ℃, melting in an ice bath, adding p-target (ldhA) plasmid and T-fusion (ldhA) enzyme digestion glue recovered fragments into BL21(pcas) competent cells at the same time, gently sucking and uniformly mixing, then cooling in an ice bath for 10min, precooling an electric shock cup, transferring the competent cells into a precooled 2mm click cup for 2.5kV click, quickly adding 1mL of LB culture medium, and then transferring into a 1.5mL of EP tube for shaking culture (30 ℃, 200rpm and 2 h). And (3) coating the bacterial liquid on a kana resistant and spectinomycin plate with the concentration of 50 mu g/mL, culturing in an inverted culture (30 ℃, 12-16h), selecting a grown single clone, carrying out Shanghai's engineering sequencing, and determining a positive clone for successfully knocking out the gene. A strain BL21 Δ ldhA was obtained in which the gene ldhA in which acetyl-coa flowed to lactate in the genome of escherichia coli (e.coli bl21(DE3)) was knocked out. The other four genes pta, adhE, poxB, frdA were knocked out according to the above method, and the primers for each gene knock out are shown in Table 2.

According to the above method, 5 genes of the genome of E.coli (E.coli BL21(DE3)) were knocked out, respectively, to obtain: five strains of BL21 Δ ldhA, BL21 Δ pta, BL21 Δ frdA, BL21 Δ poxB, BL21 Δ adhE, and 5 genes of the genome of escherichia coli (e.coli BL21(DE3)) were continuously knocked out in the genome of escherichia coli (e.coli BL21(DE3)) were obtained: BL21 Δ ldhA Δ pta, BL21 Δ dhA Δ pta Δ frdA, BL21 Δ ldhA Δ pta Δ frdA Δ poxB, BL21 Δ ldhA Δ pta Δ frdA Δ poxB Δ adhE. After the gene-knockout modification, the strain was fermented, and as shown in fig. 1, the intracellular acetyl-coenzyme a concentration of the final strain BL21 Δ ldhA Δ pta Δ frdA Δ p oxB Δ adhE, from which 5 genes were continuously knocked out, was increased to 1.436nmol/mg DCW, and the malonyl-coenzyme a concentration was increased to 0.190nmol/mg DCW. The gene-knocked-out strain BL21 delta ldhA delta pta delta frdA delta poxB delta adhE can improve the intracellular malonyl-CoA content to a certain extent.

TABLE 2 primers and plasmids used for CRISPR/Cas9 knock-out gene

The preparation and fermentation of E.coli transformed in example 1, and the detection of acetyl-CoA content and acetyl-CoA content were as follows.

E, preparing escherichia coli competence:

the transgenic receptor selected in the example is Escherichia coli (Escherichia coli BL21 delta ldhA delta pta delta frdA delta poxB delta adhE) after gene knockout modification, the strain is a phage DE3 fusion source type, and a single colony is selected and cultured in 5mL of LB culture medium by shaking (37 ℃, 200rmp) overnight (about 12 h). mu.L of the overnight culture was transferred to 50mL of fresh LB medium and shake-cultured (37 ℃ C., 200rmp) until the absorbance reached 0.35-0.6 at 600 nm. Adding 0.1mol/L CaCl₂The solution was placed on ice for precooling. 25mL of the suspension was aspirated into a 50mL EP tube, and the tube was cooled on ice for 10 min. Centrifuging (3000g, 5min, 4 ℃), discarding the supernatant, adding 1.666mL of precooled 0.1mol/L CaCl₂The solution was gently pipetted up and down using a pipette to resuspend the cells and allowed to stand on ice for 20 min. Centrifuging (3000g, 5min, 4 ℃), discarding the supernatant, adding 1mL of a pre-cooled mixed solution (0.1mol/L CaCl)₂Mix 10% glycerol), aspirate and mix to resuspend the cells. 100. mu.L of the cell suspension per tube was dispensed into 1.5mL EP tubes and stored frozen at-70 ℃ until use.

Transforming the plasmid into genetically modified escherichia coli: after the competent cells were thawed, 1. mu.L of plasmid was transferred into 100. mu.L of competent cells, and the mixture was gently flicked and mixed. Standing on ice for 30min, heat-shocking in 42 deg.C water bath for 90s, and standing on ice for 10 min. 1mL of fresh LB medium was added to a competent cell EP tube and shake-cultured (37 ℃, 200rpm, 1 h). And (3) adding all the escherichia coli into a corresponding resistant plate of the plasmid, and fully and uniformly coating. The transformation plate is placed into an incubator at 37 ℃ for inverted culture for 12-24 h. (examples 2 to 4)

Fermentation:

the engineered bacteria were first shake-cultured overnight (37 ℃ C., 200rpm) in LB medium and then at the initial OD₆₀₀Inoculating the strain with the inoculum size of 0.1, re-inoculating into a fresh MOPS fermentation culture medium, and simultaneously adding final concentration into a fermentation systemCarbon source glucose at a concentration of 5g/L was shake-cultured (37 ℃ C., 200rpm) to an OD600 of 0.5. At this time, induction was carried out with 1mmol/L of IPTG (isoproyl-. beta. -D-thiogalactopyranoside) at the final concentration, and fermentation was carried out for 52 hours after feeding with 5g/L of glucose at the final concentration, 1g/L of sodium acetate as a substrate and 2.5g/L of tyrosine as a substrate, followed by shake cultivation (30 ℃ C., 200 rpm).

Detection of acetyl coenzyme A content

Taking 1mL of fermentation liquid, centrifuging at 13000rpm and 4 ℃ for 10min, and discarding the supernatant. Resuspending the lysed cells in 1mL of 6% perchloric acid, neutralizing with 0.3mL of 3mol/L potassium carbonate, centrifuging at 13000rpm for 10min at 4 ℃, collecting the supernatant for LC-MS and Agilent ZORBAX Eclipse Plus reverse C₁₈Column chromatography (4.6 mm. times.250 mm,5 μm). To quantify the dry cell weight, 1mL of the same cell culture was filtered through a 0.45 μm cellulose filter. The cellulose filter membrane is washed with distilled water and dried in an oven to constant weight, the dry cell weight being equal to the difference between the membrane with cell residue and the empty membrane. The LC-MS instrument and column used for the determination of intracellular acetyl-CoA were the same as those used for the determination of naringenin. Wherein the liquid phase conditions are as follows: the flow rate is 0.3 mL/min; the mobile phase A is 15mmol/L ammonium formate, and the mobile phase B is a methanol solution dissolved with 10% of 10mmol/L ammonium acetate; the chromatographic conditions are as follows: in 0-10min, 2-60% of B, 10-20min, 60-76% of B; 20-25min, 76% -2% B. The MS/MS system operates in a negative ion mode, and the detection voltage is as follows: 1.60Kv, atomizing gas (N)₂) Flow: 1.5L/min, drying gas flow: 200kPa, ion accumulation time: 30MS, m/z scan range of MS 1: 100-: 100-500.

Determination of malonyl-coenzyme A content

10mL of the fermentation broth was centrifuged at 13000rpm at 4 ℃ for 10min, and the supernatant was discarded. The resulting cells were resuspended in 2mL of 6% perchloric acid for cell disruption. Then 0.6mL of 3mol/L potassium carbonate was added, and the internal acid was neutralized by shaking. Then, the mixture was centrifuged at 13000rpm at 4 ℃ for 10min, and the supernatant was collected to determine the malonyl-CoA concentration. To measure the dry cell weight, 2mL of the same cell lysate was filtered through a 0.45 μm cellulose filter, and the resulting cells were washed with distilled water and dried in an oven to a constant weight. The dry cell weight is equal to the difference between the empty membrane and the membrane with cell residues.

Example 2

Overexpression of acetyl-CoA synthetase from different sources

Escherichia coli (Escherichia coli JM109) was used for the replication of plasmids, Escherichia coli BL21(DE3) was used for the expression of pathway plasmids and the fermentation of strains, which were purchased from Novagen (Darmstatt, Germany). Plasmids pCDFDuet-1, pETDuet-1, pCOLADuet-1, pACYCDuet-1 were purchased from Novagen (Damschtatt, Germany). Saccharomyces cerevisiae ATCC9080 was purchased from Qincui biotechnology, Inc. of Shanghai, yarrowia lipolytica ATCC9773 was purchased from Kinhawei chemical technology, Inc. of Shanghai, Salmonella enterica ATCC10723 was purchased from Baiohbowei biotechnology, Inc. of Beijing and Corynebacterium glutamicum ATCC13032 was purchased from Qiangxin Borui biotechnology, Inc. of Beijing, and Pseudomonas aeruginosa ATCC27853 was purchased from Hengfei biotechnology, Inc. of Shanghai.

In order to obtain the acs Gene (Gene ID:948572) encoding acetyl-CoA synthetase in E.coli, the Gene group of E.coli (E.coli BL21(DE3)) was used as a template, and the obtained acs Gene was amplified by primers Pf _ acs (NdeI) (SEQ ID NO.7) and Pr _ acs (KpnI) (SEQ ID NO.8) to obtain T-acs by ligating the obtained acs Gene into T vector pMD19T (Simple) (Takara). Cloning the acs gene from T-acs to NdeI/KpnI sites of pCOLADuet-1 by NdeI/KpnI double enzyme digestion to obtain pCOLA-acs plasmid; to obtain the seacs Gene (Gene ID:1250688) encoding acetyl-CoA synthetase in Salmonella enterica, the wild-type seacs Gene was ligated into the T vector pMD19T (Simple) (Takara) using Salmonella enterica genome as a template and amplified by primers Pf _ seacs (NdeI) and Pr _ seacs (XhoI) to obtain a T-seacs plasmid. The seacs gene was cloned from T-seacs into pETDuet-1 by NdeI/KpnI double digestion to obtain pCOLA-seacs plasmid.

To obtain genes scacs1(Gene ID:851245) and scacs2(Gene ID:850846) encoding acetyl-CoA synthetase in the genome of Saccharomyces cerevisiae (Saccharomyces cerevisiae), the resulting genes were amplified with primers Pf _ scacs1(NdeI), Pr _ scacs1(XhoI) and Pf _ scacs2(NdeI), Pr _ scacs2(XhoI) using the Saccharomyces cerevisiae genome as a template, and ligated into T vector pMD19T (Simple) (Takara) to obtain T-scacs1 and T-scacs 2. Cloning genes from T-scacs1 and T-scacs2 to NdeI/KpnI sites of pCOLADuet-1 by NdeI/KpnI double digestion to obtain pCOLA-scacs1 and pCOLA-scacs 2; to obtain the gene encoding acetyl-CoA synthetase in the genome of Yarrowia lipolytica (Yarrowia lipolytica), ylacs (Guo H, Madzak C, Du G, et al. effects of viral enzymes deletion overexpression on the α -ketoglutamate production in Yarrowia lipolytica WSH-Z06[ J ]. Appl Microbiol Biotechnol,2014,98(16):7003-7012), T-ylacs were obtained by amplification with the primers Pf _ ylacs (NdeI) and Pr _ ylacs (XhoI) using the genome of Yarrowia lipolytica as template and ligating the resulting gene into the T vector pMD19T (Simple) (Takara). The gene was cloned from T-ylacs into NdeI/KpnI site of pCOLADuet-1 by NdeI/KpnI double digestion to yield pCOLA-ylacs.

Transforming the plasmids containing the acetyl-CoA synthetase genes from different sources into the strain BL21 delta ldhA delta pta delta frdA delta poxB delta adhE subjected to chassis modification in example 1 for expression fermentation, taking fermentation liquor to measure the malonyl-CoA content, and comparing the influence of the acetyl-CoA synthetase from different sources on the increase of the intracellular malonyl-CoA content (refer to the fermentation and detection method in example 1), finding that the acetyl-CoA synthetase activity of escherichia coli is highest, as shown in FIG. 2, the intracellular acetyl-CoA concentration is 5.216nmol/mg DCW, and the malonyl-CoA concentration is 0.406nmol/mg DCW, which indicates that the introduction of the acetyl-CoA synthetase can effectively increase the intracellular malonyl-CoA content; the introduction of the Escherichia coli acetyl-CoA synthetase gene acs can improve the intracellular malonyl-CoA concentration.

Meanwhile, the invention also constructs a path from malonic acid to malonyl-coenzyme A, and extracellular malonic acid is transferred into cells and converted into malonyl-coenzyme A by over-expressing malonyl-coenzyme A synthetase gene matB and malonate carrier protein gene matC from rhizobium meliloti. The pathway from malonic acid to malonyl-CoA was constructed using the matB and matC genes from Rhizobium trefoil to achieve transport of malonic acid from extracellular to intracellular and conversion to malonyl-CoA, increasing the intracellular malonyl-CoA concentration from 0.085nmol/mg DCW to 0.174nmol/mg DCW under the same conditions as in example 2. The effect of the acetate pathway on malonyl-coa was further explored because of the inefficiency of the malonate pathway and the inability of the malonate to be used in industrial production at a price.

Example 3

Overexpression of acetyl-CoA carboxylases from different sources

To obtain acetyl coenzyme A carboxylase dtsR1(Gene ID:1018707) and accBC (Gene ID:1019303) from Corynebacterium glutamicum (Corynebacterium glutamicum), the Corynebacterium glutamicum genome was amplified using primers Pf _ accBC (BamHI)/Pr _ accBC (HindIII) and Pf _ dtsR1(NdeI)/Pr _ dtsR1(KpnI), and the resulting genes were ligated into T vector pMD19T (Simple) (Takara) to obtain T-dtsR1 and T-accBC, and T-dtsR1 was cloned into pACYuet-1 at NdeI/KpnI by NdeI/KpnI double digestion to obtain pACYC-dtsR 1. The gene was cloned from T-accBC to the BamHI/HindIII site of pACYC-dtsR1 by BamHI/HindIII double digestion to give plasmid pACYC-dtsR 1-accBC.

In order to obtain acetyl coenzyme A carboxylase Gene PaACC (Gene ID:880489) from Pseudomonas aeruginosa (Pseudomonas aeruginosa), primers Pf _ PaACC (NdeI) and Pr _ PaACC (BglII) are used for amplification by taking Pseudomonas aeruginosa genome as a template, the obtained Gene is ligated into T vector pMD19T (Simple) (Takara) to obtain T-PaACC, and the Gene is cloned from the T-PaACC to the NdeI/BglII site of CYCDuet-1 by NdeI/BglII double enzyme digestion to obtain plasmid pACYC-PaACC.

To obtain the different subunits of the acetyl-CoA carboxylase from Salmonella enterica (Salmonella enterica) (Gene ID:1251750), seaccB (Gene ID:1254902), seaccC (Gene ID:1254903), seaccD (Gene ID:1253888), the primers Pf _ seaccA (NcoI)/Pr _ seaccA (BamHI) (SEQ ID NO.9-10), Pf _ seacB (NcoI)/Pr _ seacB (BamHI) (SEQ ID NO.11-12), Pf _ seacC (oI)/Pr _ seacC (BamHI) (SEQ ID NO.13-14) and Pf _ seacD (NcoI)/Pr _ seacD BamHI) (SEQ ID NO.15-16) were used, the resulting Gene was amplified using Salmonella enterica as a template and ligated into a double-seacT/SecT vector (SicacT-19, pAceT-scT-19, and the double-seacT-BamHI (SEQ ID NO: BamHI/BamHI) vectors, plasmids pACYC-seaccA, pACYC-seacB, pACYC-seacC, pACYC-seacD were obtained and in order to ligate seacB into pACYC-seaccA, a one-step cloning was carried out. 1. And (3) vector linearization: and carrying out BamHI/EcoRI double enzyme digestion linearization on the pACYC-seacA vector, and recovering the gel. 2. And (3) PCR amplification: designing a primer Pf _ T7seaccB (BamHI)/Pr _ T7seaccB (EcoRI) (SEQ ID NO.17-18) for amplification, and adding homologous sequences of a 15bp vector (the homologous sequences are sequences at two ends of an enzyme cutting site of an expression vector, so that homologous recombination of a gene fragment is facilitated) at the 5 'end and the 3' tail end of the primer. 3. PCR amplification of the insert: SeaccB connected into the expression vector is amplified by using the designed primer pair, a T7 promoter and a seaaccB gene are amplified, the gel is recovered, and a PCR amplification system is shown in Table 3.

TABLE 3 PCR amplification System

4. Recombinant reaction system configuration

And (3) configuring a recombination reaction system in an ice water bath. And (3) lightly blowing and uniformly mixing by using a liquid transfer gun, reacting for 30min in a metal bath at 37 ℃, immediately placing in an ice water bath for 5min after the reaction is finished, and storing in a refrigerator at-20 ℃, wherein a recombination reaction system is shown in table 4.

TABLE 4 recombination reaction System

5. Transformation of

10 μ L of the recombinant solution was added to JM109 for competence and transformed. And selecting a single colony for colony PCR verification, and extracting a plasmid after the verification to obtain pACYC-seaccA-seaccB.

Primers Pf _ T7seaccC (EcoRI)/Pr _ T7seaccC (HindIII) (SEQ ID NO.19-20) and Pf _ T7seaccD (HindIII)/Pr _ T7seaccD (NdeI) (SEQ ID NO.21-22) are designed for amplification, and seacC and seacD are connected to a vector in sequence according to the method to finally obtain pACYC-seaccA-seacB-seacC-seacD and pACYC-seaccA-seacC-SseccD.

In addition, different subunits are sequentially constructed to an expression vector by adopting the same one-step cloning method to obtain plasmids pACYC-seaccA-seacC, pACYC-seaccA-seacD pACYC-seacC-seacD, pACYC-seacB-seacC, pACYC-seacB-seacD, pACYC-seacB-seacC-seacD, pAC-seaccA-seacB-seacC and the like.

The plasmids containing acetyl-CoA carboxylase genes from different sources are transformed into the chassis-modified strain BL21 delta ldhA delta pta delta frdA delta poxB delta adhE containing the Escherichia coli acetyl-CoA synthetase acs gene in example 2 for expression fermentation, and the fermentation broth was taken to determine the malonyl-CoA content, and acetyl-CoA synthetase from various sources was compared (see fermentation and detection methods in example 1), and it was found that acetyl-CoA carboxylase from Corynebacterium glutamicum has the highest malonyl-CoA conversion activity, as shown in FIG. 3, the intracellular malonyl-CoA concentration reached 0.776nmol/mg DCW, meanwhile, the acetyl coenzyme A carboxylase gene seacACD of Salmonella enterica (Salmonella enterica) can also obviously improve the conversion activity of malonyl coenzyme A, which indicates that the overexpression of the acetyl coenzyme A carboxylase on the basis of the expression of the acetyl coenzyme A synthetase can further improve the intracellular malonyl coenzyme A content of the microorganism 1.

Further analysis results show that the salmonella enterica acetyl-coa carboxylase has special results, the seaccA gene expressing salmonella enterica obviously increases intracellular malonyl-coa concentration while intracellular malonyl-coa concentration decreases when seaccA and seaccB are expressed, and the accB gene expressing the BCCP subunit encoding the acetyl-coa carboxylase of escherichia coli itself decreases intracellular acetyl-coa carboxylase concentration, so it is presumed that the subunit encoded by the seaccB gene negatively regulates intracellular acetyl-coa carboxylase and decreases intracellular acetyl-coa carboxylase concentration. Therefore, only the genes seacA, seacC and seacD of Salmonella enterica are expressed, fermentation is carried out, intracellular malonyl coenzyme A concentration is measured, and the intracellular malonyl coenzyme A concentration is found to be higher when seacA and seacC are simultaneously overexpressed or seacA, seacC and seacD are simultaneously overexpressed than when seacB is simultaneously overexpressed, and is respectively 0.664nmol/mg DCW and 0.774nmol/mg DCW. Co-expressing with naringenin pathway gene, wherein the naringenin yield is 171.2mg/L and 190.25mg/L respectively.

Example 4

Overexpression of Biotin ligase from different sources

To obtain the biotin ligase Gene cgbirA from Corynebacterium glutamicum (Gene ID:1018708), the biotin ligase Gene sebera from Salmonella enterica (Gene ID:1255664), the biotin ligase Gene pabirA from Pseudomonas aeruginosa (Gene ID:881668), the resulting biotin ligase genes were ligated into T-vector pMD19T (Simple) (Takara) using primers Pf _ cgbirA (NcoI)/Pr _ cbirA (BamHI) (SEQ ID NO: 23-24), Pf _ sebirA (NcoI)/Pr _ sebirA (BamHI) and Pf _ pabirA (NcoI)/Pr _ pabirA (BamHI), and the genomes of Corynebacterium glutamicum, Salmonella enterica, and Pseudomonas aeruginosa were used as templates to amplify the resulting biotin ligase genes into T-cgbirA, T-sebirA, T-pabirA, Cgbira, and Bcgbira, and the cloned into the site of the T-Gene pCoI/BamHI by enzyme digestion, to obtain the plasmids pCOLA-acs-cgbirA, pCOLA-acs-sebirA and pCOLA-acs-pabirA.

The pCOLA-acs-cgbirA, pCOLA-acs-seberrA and pCOLA-acs-pabirA are respectively transferred into the genetically engineered bacteria BL21 delta ldhA delta pta delta frdA delta poxB delta adhE which are modified by the chassis and are co-expressed with different acetyl coenzyme A carboxylase gene plasmids obtained in the example 3, and the expression fermentation is carried out and the fermentation liquor is taken to determine the content of malonyl coenzyme A. Comparing the combination of biotin ligase and different acetyl-CoA carboxylases, it was found that Salmonella enterica acetyl-CoA carboxylase can exert maximal activity with the help of Corynebacterium glutamicum biotin ligase (see fermentation and assay methods in example 1), as shown in FIG. 4, increasing intracellular malonyl-CoA concentration to 0.812nmol/mg DCW, which is 0.046nmol/mg DCW compared to the state without the help of biotin ligase.

To sum up, the five genes ldhA, pta, frdA, poxB and adhE in the genome of Escherichia coli were knocked out in examples 1-4, and then acetyl-CoA synthetase gene acs of Escherichia coli, acetyl-CoA carboxylase gene seaCCA of Salmonella enterica (containing 3 subunits seaCCA, seaCCC and seaCCD of acetyl-CoA carboxylase of Salmonella enterica) and biotin ligase gene cgbirA of Corynebacterium glutamicum were introduced to construct a genetically engineered bacterium (example 4) with high malonyl-CoA yield, and the intracellular malonyl-CoA concentration was increased from 0.085nmol/mg DCW to 0.812nmol/mg DCW, thereby achieving high malonyl-CoA yield.

The primers used in examples 2-4 are shown in Table 5.

TABLE 5 primers used in examples 2 to 4 of the present invention

Example 5

Microbial method for improving naringenin synthesis yield by high-yield malonyl coenzyme A engineering bacteria after modification

Tyrosine Ammonia Lyase (TAL) from Rhodotorula rubra, 4-coumaroyl-CoA ligase (4CL) from parsley, chalcone synthase (CHS) from petunia and chalcone isomerase (CHI) from Medicago sativa were selected as naringenin synthesis pathway genes (Wu Junjun. synthetic biotechnology engineering Escherichia coli for the production of flavone backbone material [ D ]. stannless: university of Jiangnan, 2015.), and the relevant genes were synthesized by Shanghai and constructed onto plasmids pCDFDuet-1 and pETDuet-1.

Regulating the expression strength of TAL and 4CL genes by referring to a multi-module metabolic engineering means, replacing an original T7 promoter on an expression vector by a Trc promoter, and expressing plasmids pCDF-Trc-TAL-Trc-4CL and pET-CHS-CHI. The two plasmids, pCDF-Trc-TAL-Trc-4CL and pET-CHS-CHI, were co-expressed by simultaneous transformation into BL21(DE3) competence, fermentation and sampling for analysis. The target product naringenin expressed by fermentation was detected by High Performance Liquid Chromatography (HPLC) using Agilent 1100 chromatograph and a reverse phase ZORBAX SB-C18 column (4.6X 150mm) at a temperature of 25 ℃. The flavone skeleton material is separated by gradient elution of acetonitrile/water: at 0-10min, the chromatographic conditions are 10-40% acetonitrile (volume/volume); controlling the chromatographic condition to be 40-60% acetonitrile (volume/volume) in 10-15 min; controlling the chromatographic condition at 60-10% acetonitrile in 15-17 min. The detection wavelength of the product was 290 nm.

As shown in FIG. 5, the fermentation liquid has a detection peak consistent with naringenin standard at 15.85min, and compared with the ultraviolet spectrogram, the fermentation liquid has a maximum absorption wavelength consistent with naringenin standard at 288.7 nm. And determining that the naringenin synthesis way is successfully constructed and successfully expresses the target product naringenin, wherein the naringenin yield is 15.776mg/L, and verifying the influence of the modified engineering bacteria with high malonyl coenzyme A yield on the naringenin yield by taking the yield as a standard.

Naringenin pathway gene was transferred to the engineered high-yielding malonyl-coenzyme A-producing strain (example 4) for fermentation, and the engineered strain was first shake-cultured in LB medium overnight (37 ℃ C., 200rpm) and then cultured at the original OD₆₀₀Inoculating the mixture to a fresh MOPS fermentation medium at an inoculum size of 0.1, adding glucose as a carbon source with a final concentration of 5g/L into the fermentation system, and performing shake culture (37 deg.C, 200rpm) to OD₆₀₀Is 0.5. At the moment, 1mmol/L IPTG (isoproxyl-beta-D-thiogalactopyranoside) is used for induction, substrate glucose with the final concentration of 5g/L and excessive substrate tyrosine are fed, then shaking table culture (30 ℃, 200rpm) is carried out for fermentation, and fermentation liquor of 53h fermentation is taken for HPLC analysis (liquid phase conditions are the same as above), the naringenin yield is 252.31mg/L, compared with the fermentation liquor before modification, the naringenin yield is improved by 1499.32%, and the improvement of the supply of intracellular malonyl coenzyme A is proved to be capable of effectively improving the efficiency of flavonoid compound microbiological synthesis.

Sequence listing

<110> Nanjing university of agriculture

<120> genetic engineering bacterium for high yield of malonyl coenzyme A, construction method and application thereof

<160>24

<170>SIPOSequenceListing 1.0

<210>1

<211>45

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

ttttcagctc ttccagcacc gttttagagc tagaaatagc aagtt 45

<210>2

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

ggatcccaag cagaatcaag ttctaccatg c 31

<210>3

<211>50

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

taaagccggt cagaccttcc agagaaagac tttctccagt gatgttgaat 50

<210>4

<211>51

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

attcaacatc actggagaaa gtctttctct ggaaggtctg accggcttta c 51

<210>5

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ctcgagagga atgcctggtg cccggtaaac ag 32

<210>6

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

actagtatta tacctaggac tgagc 25

<210>7

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

catatgagcc aaattcacaa acacacc 27

<210>8

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

ctcgagttac gatggcatcg cgatagc 27

<210>9

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

ccatgggcat gagtctgaat ttccttgatt t 31

<210>10

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

ggatccttag gcgtaaccgt agctcat 27

<210>11

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

ccatggatat tcgtaagatt aaaaaactg 29

<210>12

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

ggatccttac tcgatgacga ccagtggctc 30

<210>13

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

ccatgggcat gttggataaa attgtcatcg 30

<210>14

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

ggatccttac ttttcctgaa gaccgag 27

<210>15

<211>35

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

ccatgggcat gagctggatt gaacgaatta aaagc 35

<210>16

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

ggatcctcag gcctcagact cctgatccg 29

<210>17

<211>45

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

tgagctacgg ttacgcctaa ggatccggatctcgacgctc tccct 45

<210>18

<211>53

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

acctgcaggc gcgccgagct cgaattctta ctcgatgacg accagtggct cgt 53

<210>19

<211>54

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

cgagccactg gtcgtcatcg agtaagaatt cggatctcga cgctctccct tatg 54

<210>20

<211>58

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

ttcgacttaa gcattatgcg gccgcaagct tttacttttc ctgaagaccg agtttttt 58

<210>21

<211>55

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>21

aaaactcggt cttcaggaaa agtaaaagct tggatctcga cgctctccct tatgc 55

<210>22

<211>56

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>22

cggccgatat ccaattgaga tctgccatat gtcaggcctc agactcctga tccggc 56

<210>23

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>23

ccatgggcat gaacgttgac atttcacgat cc 32

<210>24

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>24

ggatccttac tgcaggcgaa ggtgcgt 27

Claims

1. A genetically engineered bacterium for high yield of malonyl-CoA is characterized in that the genetically engineered bacterium is constructed by knocking out five genes including ldhA, pta, frdA, poxB and adhE in a genome of escherichia coli and then introducing a malonyl-CoA synthesis pathway gene, wherein the malonyl-CoA synthesis pathway gene comprises acetyl-CoA synthetase gene acs of the escherichia coli, acetyl-CoA carboxylase gene seacACD of salmonella enterica and biotin ligase gene cgbirA of corynebacterium glutamicum, and the acetyl-CoA carboxylase gene seacACD of the salmonella enterica comprises three subunits seacA, seacC and seacD.

2. The genetically engineered bacterium producing malonyl-CoA in high yield according to claim 1, wherein the five genes ldhA, pta, frdA, poxB and adhE are a competitive metabolic pathway-related gene ldhA for lactic acid, a competitive metabolic pathway-related gene pta for acetyl phosphate, a competitive metabolic pathway-related gene frdA for succinic acid, a competitive metabolic pathway-related gene poxB for acetic acid, and an competitive metabolic pathway-related gene adhE for ethanol, respectively.

3. The malonyl-CoA-producing genetically engineered bacterium according to claim 1, wherein the acetyl-CoA synthetase gene acs of Escherichia coli is transcriptionally and translationally synthesized to convert acetate into acetyl-CoA; the acetyl coenzyme A carboxylase gene seaccaCD of the salmonella enterica is transcribed and translated to synthesize acetyl coenzyme A carboxylase to convert acetyl coenzyme A into malonyl coenzyme A; the biotin ligase gene cgbirA of corynebacterium glutamicum is transcribed and translated to synthesize biotin ligase so as to assist in improving the activity of acetyl coenzyme A carboxylase.

4. A malonyl-coa synthesis pathway comprising synthesizing acetyl-coa from acetate, a metabolic byproduct of a microorganism, by acetyl-coa synthetase to increase intracellular acetyl-coa content, and then converting acetyl-coa to malonyl-coa using acetyl-coa carboxylase, while co-expressing biotin ligase to further increase the activity of acetyl-coa carboxylase to efficiently convert acetyl-coa to malonyl-coa.

5. An expression vector, preferably comprising the acetyl-CoA synthetase gene acs of Escherichia coli, the acetyl-CoA carboxylase gene seacACD of Salmonella enterica and the biotin ligase gene cgbirA of Corynebacterium glutamicum according to claim 1.

6. The construction method of the genetic engineering bacteria for high yield of malonyl coenzyme A is characterized by comprising the following steps:

(1) knocking out five genes of ldhA, pta, frdA, poxB and adhE in a target strain escherichia coli genome by using a CRISPR/Cas9 method; carrying out amplification, enzyme digestion, enzyme linkage and transformation on a gene sequence design primer for knocking out five genes to obtain a strain subjected to gene knockout modification;

(2) designing a primer by taking a genome of Escherichia coli (Escherichia coli) as a template, amplifying to obtain an acs gene encoding acetyl coenzyme A synthetase in the Escherichia coli, and introducing the acs gene into the strain subjected to gene knockout modification in the step (1) to obtain a strain containing the acs gene encoding acetyl coenzyme A synthetase in the Escherichia coli;

(3) designing primers by taking a Salmonella enterica genome as a template, respectively amplifying to obtain three subunits of seaccaccd genes of the acetyl-coa carboxylase of the Salmonella enterica, and introducing the genes into the strain containing the acs gene coding the acetyl-coa synthetase in the escherichia coli in the step (2) to obtain a strain containing the acs gene coding the acetyl-coa synthetase in the escherichia coli and the acetyl-coa carboxylase gene of the Salmonella enterica;

(4) and (3) designing a primer by taking a Corynebacterium glutamicum (Corynebacterium glutamicum) genome as a template, amplifying to obtain a biotin ligase gene cgbirA of the Corynebacterium glutamicum, and introducing the gene cgbirA into the strain containing the acs gene of the coding acetyl coenzyme A synthetase in the escherichia coli and the acetyl coenzyme A carboxylase gene of the salmonella enterica in the step (3) to obtain the genetic engineering bacteria for high-yield malonyl coenzyme A.

7. The application of the genetic engineering bacteria for high-yield production of malonyl-CoA in high-efficiency accumulation of malonyl-CoA according to claim 1.

8. The use of claim 8, wherein the genetically engineered bacterium efficiently accumulates malonyl-CoA in an intracellular malonyl-CoA level from 0.085nmol/mg DCW to 0.812nmol/mg DCW.

9. The application of the genetically engineered bacterium capable of producing malonyl-CoA in high yield in claim 1 in improving the synthesis efficiency of flavonoids by a microbiological method.

10. The use of claim 9, wherein the genetic engineering bacteria for high yield of malonyl-CoA increases the yield of naringenin, which is produced by microbiological method and uses malonyl-CoA as precursor, from 16mg/L to 252.31 mg/L.