CN110656174B

CN110656174B - Specific marker closely related to occurrence and development of primary hepatocellular carcinoma and application thereof

Info

Publication number: CN110656174B
Application number: CN201910851143.6A
Authority: CN
Inventors: 胡康洪; 徐恒; 宋锐
Original assignee: Chengdu Luo Kang Biotechnology Co ltd
Current assignee: Chengdu Luo Kang Biotechnology Co ltd
Priority date: 2019-09-10
Filing date: 2019-09-10
Publication date: 2022-09-27
Anticipated expiration: 2039-09-10
Also published as: CN110656174A

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to a specific marker closely related to the occurrence and development of primary hepatocellular carcinoma and application thereof. The invention discovers that the up-regulation of eIF3e promotes the development of primary hepatocellular carcinoma for the first time, and suggests that eIF3e may be a new target for HCC treatment or a biomarker related to diagnosis and prognosis. After the expression level of the eIF3e is changed by using a cell model and an animal model, behaviors such as proliferation, migration, apoptosis and the like of cells and influence of tumorigenicity in animals are systematically investigated. The result shows that after eIF3e is up-regulated, HepG2 proliferation and migration behaviors are enhanced, but the apoptosis is not influenced; after the gene is down regulated, the proliferation and migration behaviors of HepG2 are weakened, and apoptosis is promoted. Nude mice experiments further confirmed that eIF3e promotes tumor growth. Experiments prove that eIF3e is closely related to the occurrence and development of liver cancer, and has important clinical significance for the treatment or early diagnosis of cancer.

Description

Specific marker closely related to occurrence and development of primary hepatocellular carcinoma and application thereof

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to a specific marker closely related to the occurrence and development of primary hepatocellular carcinoma and application thereof.

Background

According to the statistics of international cancer research institutions, primary Hepatocellular carcinoma (HCC) is the second most fatal cancer worldwide, and the incidence rate of the HCC is second to that of lung cancer and gastric cancer in China. HCC is high in malignancy, strong in infiltration and metastasis, and latent in symptoms during onset. In most cases, HCC is diagnosed at a late-intermediate stage and HCC patients have a poor prognosis with a 5-year survival rate of less than 5%. The traditional treatment means comprises surgical excision, liver transplantation, transcatheter arterial chemoembolization, radiotherapy and chemotherapy and the like, and the treatment effect and prognosis are poor. Therefore, there is an urgent need to find specific biomarkers of liver cancer and new targets for drug intervention, which can be used for early diagnosis, prognosis classification and treatment of liver cancer, thereby reducing death rate and medical cost of liver cancer. Currently recommended screening strategies for patients with cirrhosis include determination of serum alpha-fetoprotein (AFP) levels and abdominal ultrasound examinations every 6 months. However, serum AFP levels were not elevated in up to 40% of patients with early HCC due to HCC heterogeneity and low AFP sensitivity and specificity. Furthermore, 11-47% of cirrhosis patients have elevated serum AFP levels but have not yet suffered HCC. The reliability of abdominal ultrasound examination is limited by physician experience, and the results of different patients of different ages vary. In terms of treatment, although the emergence of a group of molecular targeted drugs represented by Sorafenib (Sorafenib) improves the current severe situation, with the decrease of drug tolerance and the emergence of drug resistance problems of patients, new drugs with better curative effect and less side effects are urgently needed. Therefore, the search for new specific markers for better diagnosis or prognosis of HCC, and the discovery of new targets for drug intervention, have always been a very important clinical concern.

eIF3e is a component of the eukaryotic translation initiation factor 3(eIF-3) complex, necessary to regulate translation initiation for protein synthesis. Alterations in the protein synthesis machinery and translational control can lead to selective translation of specific mrnas, which promotes tumor cell survival, angiogenesis, transformation, invasion, and metastasis. Translation factors also functionally interact with oncogenes and are often the primary target of signal transduction pathways that constitute most human cancers. Thus, translational control plays a key role in the complex mechanisms of cancer development.

eIF3 is an 800kDa molecule, the largest factor in the eIF family, consisting of 13 subunits, named from eIF3a to eIF3 m. Of the 13 subunits of eIF3, eIF3e is the p48 subunit, contributing to the stability of the entire eIF3 complex. It has been reported that eIF3e is not directly responsible for cancer, but is closely related to the development of cancer. However, the precise role of eIF3e in malignancy remains controversial among the different types of tumors. eIF3e expression is down-regulated and acts as a tumor suppressor in breast and lung cancer. In contrast, eIF3e was shown to be overexpressed and to promote tumor progression in glioblastoma and colon cancer. To date, the role of eIF3e in primary hepatocellular carcinoma has not been published.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a specific marker closely related to the occurrence and development of primary hepatocellular carcinoma and application thereof.

The invention is realized by the fact that the specific marker is closely related to the occurrence and development of the primary hepatocellular carcinoma and comprises an eIF3e gene and/or an expression product of an eIF3e gene.

Furthermore, the nucleotide sequence of the eIF3e gene is a DNA sequence shown in SEQ ID NO.1 or a DNA sequence of a protein with the same function as the DNA sequence shown in SEQ ID NO. 1.

Further, the expression product of the eIF3e gene includes eIF3e mRNA and/or eIF3e protein.

Further, the amino acid sequence of the eIF3e protein is the sequence shown in SEQ ID NO. 12; or derived from the amino acid sequence shown in SEQ ID NO.12, is generated by substitution and/or deletion and/or addition of a plurality of amino acid residues, and has the same function with the amino acid sequence shown in SEQ ID NO. 12.

The application of the specific marker closely related to the occurrence and development of the primary hepatocellular carcinoma in hepatocellular carcinoma detection is disclosed.

The application of the specific marker closely related to the occurrence and development of the primary hepatocellular carcinoma in the preparation of a kit for detecting the hepatocellular carcinoma is disclosed.

Further, the kit comprises a qRT-PCR detection kit or a protein immunoassay kit.

Further, the qRT-PCR detection kit comprises a primer for amplifying an eIF3e gene fragment, and the sequence of the primer is shown in SEQ ID NO.2 and SEQ ID NO. 3.

Further, the protein immunoassay kit comprises an antibody specifically binding to the eIF3e protein.

In summary, the advantages and positive effects of the invention are:

the invention discovers that the up-regulation of eIF3e promotes the development of HCC (primary hepatocellular carcinoma) for the first time, and suggests that eIF3e may be a new target for HCC treatment or a biomarker related to diagnosis and prognosis. The expression level of eIF3e in primary hepatocellular carcinoma tissues was significantly increased by comparison with healthy human paracancerous tissues. In vitro experiments comparing the normal liver cell line HL7702 with the two liver cancer cell lines HepG2 and Huh7, the eIF3e transcription level in HepG2 and Huh7 was found to be higher than that in HL7702, consistent with the results in the tissues. The vector containing eIF3e or the gene silencing vector is used for transfecting HepG2 respectively, so that the expression level of eIF3e in cells is up-regulated or down-regulated. After eIF3e is up-regulated, HepG2 proliferation and migration behaviors are enhanced, but no influence on apoptosis is caused; after the gene is down regulated, the proliferation and migration behaviors of HepG2 are weakened, and apoptosis is promoted. Nude mouse experiments confirmed that eIF3e promotes liver cancer growth.

Drawings

FIG. 1 is a graph comparing the amount of eIF3e relative to mRNA in fresh liver cancer tissue and healthy paracancerous tissue as measured by qRT-PCR;

FIG. 2 is a graph comparing the amount of endogenous eIF3e relative to mRNA measured by qRT-PCR in normal liver cell line HL7702 and two liver cancer cell lines HepG2 and Huh 7;

FIG. 3 is a schematic diagram of siRNA production by intracellular transcription of a constructed pSuper interference vector;

FIG. 4 is a graph showing the results of evaluation of transfection efficiency by observing the ratio of the number of green cells expressing GFP to the total number of cells in a field of view with a fluorescence microscope after transfecting HepG with pEGFP at 224 hours (A), 48 hours (B), 72 hours (C), and 96 hours (D), and at a magnification x 100;

FIG. 5 shows the quantitative results of eIF3eRNA in HepG2 cells 24, 48, 72 hours after transfection of pcDNA-eIF3e plasmid by qRT-PCR analysis;

FIG. 6 shows the quantitative results of eIF3eRNA in HepG2 cells after 24 hours, 48 hours and 72 hours of qRT-PCR analysis of transfected pSuper-sheIF3e plasmid;

FIG. 7 is a photograph of immunoblotting to analyze the expression level of eIF3eRNA protein in HepG2 cells 72 hours after transfection of various plasmids;

FIG. 8 shows the comparison of the expression levels of eIF3e in the para-carcinoma (N) and liver cancer (T) tissues after the operation of five HCC patients by immunoblotting;

FIG. 9 shows the effect of the change in eIF3e expression on cell proliferation after transfection of HepG2 cells with either over-expression plasmid (A) or interference plasmid (B) by the CCK-8 method;

FIG. 10 shows the effect of eIF3e expression up-regulation on cell migration after 0 hr, 24 hr, 48 hr and 72 hr of transfection of HepG2 cells with eIF3e overexpression plasmid by scratch assay;

FIG. 11 shows the effect of eIF3e expression down-regulation on cell migration after 0 h, 24 h, 48 h and 72 h of scratching method detection of eIF3e interference plasmid transfection HepG2 cells;

FIG. 12 is a graph of Annexin V-FITC/PI method used to evaluate the effect of changes in eIF3e over-expression levels of eIF3e in group (A) and eIF3e interference in group (B) on apoptosis in HepG2 cells;

FIG. 13 is a subcellular localization of eIF3e expression in HepG2 as determined by immunofluorescence staining;

FIG. 14 is a graph showing the results of a nude mouse tumorigenesis experiment.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

The invention discloses a specific marker closely related to the occurrence and development of primary hepatocellular carcinoma and application thereof. The details are shown in the following examples.

eIF3e (Gene-bank accession No.: NM-001568.3) full-length sequence was visualized by accessing https:// www.ncbi.nlm.nih.gov/nuccore/NM-001568.3/and the CDS region sequence encoding eIF3e protein is shown in SEQ ID No.1, where: the box lines are labeled as cloning primer sequences; the underlined part is the qPCR primer sequence; the grey background is marked as interfering sequence. The corresponding amino acid sequence of eIF3e is 445aa, the molecular weight is 48KDa, and the amino acid sequence is shown in SEQ ID NO. 12.

EXAMPLE 1 mRNA levels of eIF3e in liver cancer tissue and paracancerous tissue and eIF3e in normal liver cell line HL7702 and two liver cancer cell lines HepG2 and Huh7 were examined by qRT-PCR

1.1 liver cancer tissue and tissue specimens beside the liver cancer after the operation of five HCC patients are obtained from the southern Hospital of Wuhan university, and the research scheme related to the patent is approved by the medical ethics committee of the institution. The normal liver cell line HL7702 and the two hepatoma cell lines HepG2 and Huh7 were purchased from American Type Culture Collection (ATCC) and grown in DMEM medium (Gibco, USA) containing 10% fetal bovine serum (Gibco, USA) with 5% CO at 37 ℃ ₂ Culturing in a cell culture box.

1.2 extraction of RNA: total RNA was extracted from fresh tissue surgically excised from the patient using Trizol reagent according to the method provided by the kit supplier (Invitrogen, usa).

1.3 qRT-PCR reaction

cDNA was prepared using Primescript RT kit (Takara, Japan) and PCR amplified using the primers in Table 1. According to

Standard protocol for 96real-time PCR system (Roche, switzerland) real-time quantitative analysis was performed using SYBR premix ex TAQ II (Takara, japan). Beta-actin (beta-actin) as internal reference, 2 ^-ΔΔCT Values were normalized to β -actin levels.

TABLE 1 primer sequences used in qRT-PCR detection of eIF3e in liver tissue

All primers were synthesized by Wuhan Quintarabio, diluted to 10. mu.M at the time of use.

The fluorescent quantitative qRT-PCR reaction was performed on a LightCycler 96Real-Time PCR system from Roche, 20. mu.l total reaction system was prepared as follows:

after the samples were mixed well, the reaction solution was spun down to the bottom by low-speed centrifugation for 5 seconds to start amplification. The reaction procedure was as follows:

after the reaction is finished, relative quantitative calculation is carried out according to the Cq value.

The results are shown in FIG. 1, which is a graph comparing the amount of eIF3e relative to mRNA detected by qRT-PCR in fresh liver cancer tissue (left black box) and healthy paracarcinoma tissue (right black and white chimeric box) surgically excised from five patients. The liver cancer tissues and the para-carcinoma tissues of each patient were divided into one group, the quantitative data of mRNA in the para-carcinoma tissues in each group was set to 1, and the results were corrected by beta-actin as an internal reference, and the results were the average of three independent experiments (p <0.05, p < 0.01).

From the results in fig. 1, the amount of eIF3e mRNA in liver cancer tissue was higher in five patients with liver cancer than in healthy paracancerous tissue eIF3e, with the lowest being about 20% higher (patient 1) and the highest being about 4 times higher (patient 5). The amount of eIF3e mRNA in five liver cancer tissues was on average 2 times higher than that of eIF3e mRNA in healthy paracancerous tissues (1.2+1.5+1.8+1.6+ 4.0)/5-2.02 relative to eIF3e mRNA in liver cancer tissues of patients 1 to 5).

A comparison graph of the relative mRNA amount of endogenous eIF3e detected by qRT-PCR in the normal liver cell line HL7702 and the two liver cancer cell lines HepG2 and Huh7 is shown in FIG. 2. mRNA quantitation of HL7702 was set to 1, and the results were corrected for β -actin as an internal reference and were the average of three independent experiments (. p <0.05,. p < 0.01).

FIG. 2 shows the results consistent with those in the tissue of FIG. 1, where the mRNA levels for eIF3e in both the hepatoma cell lines HepG2 and Huh7 were higher than that of eIF3e in the normal hepatoma line HL7702, the mRNA level for eIF3e in HepG2 was about 170% of that of eIF3e in HL7702, and the mRNA level for Huh7 was about 125% of that in HL 7702.

Example 2 construction of eIF3e overexpression plasmid pcDNA3.1-eIF3e and interference plasmid pSuper-sheIF3e against eIF3e

2.1 design and Synthesis of eIF3 e-specific primers

To obtain the full-length sequence of eIF3e (Gene-bank accession No.: NM-001568.3), a pair of PCR primers (5'→ 3' direction) F were designed using Primer Premier 5 software: GG (GG)AAGCTTATGGCGGAGTACGACTTGAC, see SEQ ID NO. 6; r: GG (GG)CTCGAGTCAGTAGAAGCCAG AATCTTGAGTTG, see SEQ ID NO. 7; HindIII and Xho I endonuclease sites are included in F and R, respectively, and are underlined to facilitate cloning.

2.2 preparation of genomic cDNA: total RNA from HepG2 cells extracted according to protocol 1.2 was purified by

Genomic cDNA was prepared using the Reverse Transcriptase kit. The method comprises the following two steps:

2.2.1) removal of genomic DNA

The following system was placed in a 1.5mL RNase-free EP tube:

after gently pipetting and mixing, incubating at 42 ℃ for 2 minutes.

2.2.2) reverse transcription

After a system is prepared, the mixture is lightly blown and uniformly mixed, incubated at 50 ℃ for 15 minutes and then transferred to 85 ℃ for incubation for 5 seconds, and then quenched on ice, immediately used for PCR reaction or stored at-20 ℃ for half a year, and if the mixture needs to be stored for a long time, the mixture can be placed at-80 ℃. Repeated freeze-thawing of the cDNA should be avoided.

2.3 PCR amplification of the Gene of interest eIF3e

First, the primers synthesized at 2.1 were prepared as a 100. mu.M stock solution as described, and then diluted to 10. mu.M working solution for the subsequent PCR amplification experiment. The template used for PCR was cDNA obtained using the method described in scheme 2.2. The whole reaction is carried out on a PCR instrument, and the reaction system is shown in Table 2:

TABLE 2 PCR reaction conditions for amplification of the eIF3e gene

After being prepared according to the system, the mixture is placed in a PCR instrument for reaction. The PCR program was set as follows: pre-denaturation at 95 ℃ for 5 min for 1 cycle; denaturation at 95 ℃ for 30 seconds, annealing at 64.5 ℃ for 30 seconds, and extension at 72 ℃ for 80 seconds for a total of 34 cycles; extension at 72 ℃ for 5 min, 1 cycle. In order to prevent gene mutation and ensure high amplification efficiency, high fidelity enzyme Prime is used in the experiment

Max DNA。

2.4PCR fragment gel recovery

The PCR fragment separation was performed by 2% agarose gel electrophoresis, and the amplified 1338bp eIF3e fragment was initially judged to be in the correct position by DNA molecular weight Marker. Then recovering the kit E.Z.N.A by using glue ^TM The recovery of the PCR fragment was carried out using Gel Extraction Kit (Omega, USA), and the DNA concentration was determined using a ultramicrospectrophotometer.

2.5 double digestion and column purification of the target Gene fragment and vector

In designing the primers, Hind III and Xho I sites corresponding to the vectors were added, and a Hind III (Takara, Japan) and Xho I (Takara, Japan) double-cleavage of the 1338bp eIF3e gene fragment and the corresponding vector pcDNA3.1 were performed, respectively, to prepare for the subsequent ligation reaction. The specific cleavage reactions are shown in tables 3 and 4:

TABLE 3 PCR amplified 1338bp eIF3e gene fragment subjected to Hind III and Xho I double digestion reaction conditions

TABLE 4 double digestion of pcDNA3.1 vector with Hind III and Xho I conditions

After the reaction system was prepared in a 1.5ml EP tube, the tube was incubated in a 37 ℃ incubator for 3 hours, and then purified using a DNA column purification Kit E.Z.N.A. Cycle Pure Kit (Omega, USA) according to the manufacturer's instructions.

2.6 connection of the restriction enzyme eIF3e target fragment and the vector pcDNA3.1

2.6.1) ligation: mixing the eIF3e target gene after enzyme digestion with a vector pcDNA3.1 in a molar ratio of 3:1, and connecting the mixture at 4 ℃ overnight under the action of T4 ligase to obtain a pcDNA3.1-eIF3e positive clone. The specific reaction system is shown in table 5:

TABLE 5 ligation reaction conditions of eIF3e target gene and vector pcDNA3.1

2.6.2) double restriction enzyme identification and sequencing verification

Transformation of the recombinant plasmid into competent DH5 α, amplification and seed preservation steps were performed according to methods in schemes 2.7.7 and 2.7.8, respectively. Plasmids were extracted using a plasmid miniprep kit, and the extracted plasmids were double digested with Hind III and Xho I for 3 hours at 37 ℃ as follows:

10 μ l of the enzyme digestion product is taken out and electrophoresed in 2% agarose gel, and the experimental result is observed and preserved after the gel imaging. The length of the eIF3e fragment after double enzyme digestion of the positive clone is 1338bp, and the primary identification and evaluation are carried out on the eIF3e fragment through the position of a DNA Marker. The screened positive clones are sent to Wuhan Quintarabio company for sequencing identification, and the sequence is confirmed to be completely correct, so that the over-expression plasmid pcDNA3.1-eIF3e is successfully constructed.

2.7 construction of eIF3e interference vector pSuper-sheIF3e

Each of the designed pair of oligonucleotide chains is 60nt, and the 5 'end and the 3' end respectively contain Bgl II and Hind III enzyme cutting sites, so that the oligonucleotide chains are conveniently connected with the pSuper vector. The coding sequence of 19nt at the 5' end is homologous with a target gene and is called an interference sense sequence, the other sequence of 19nt and the reverse complement thereof are called an interference antisense sequence, a 9nt TTCAAGAGA spacer sequence forms a ring structure, and the end is added with a transcription termination signal TTTTT. Two complementary oligonucleotide strands with the structural characteristics are annealed and phosphorylated to form double-stranded DNA (dsDNA), then directionally inserted into a pSuper vector containing an H1 promoter, transcribed in cells to form RNA self-hairpin loops, and cut into siRNA by ribonuclease III enzyme (Dicer) and then play an interference role (see figure 3).

2.7.1) design and Synthesis of interference sequences

The complete sequence includes the TTCAAGAGA loop between the sense and antisense strands and the 3' TTTTT transcriptional termination signal, i.e.:

shRNA-F(5′→3′)：GAT CCC C…TTC AAG AGA…TTT TTA；

shRNA-R(5′→3′)：AGC TTA AAA A…TCT CTT GAA…GGG；

bgl II and Hind III enzyme cutting sites are arranged at the 5 'end and the 3' end and are respectively marked by gray shades; "…" on the left and right sides of TTCAAGAGAGA indicate 19nt interfering sense and 19nt interfering antisense sequences, respectively. A pair of interfering group sequences and a pair of non-interfering effect control group sequences are shown in Table 6:

TABLE 6 complete sequences of interference vector pSuper-sheIF3e and unrelated interference vector pSuper-Sn, underlined are interference sense and antisense sequences

2.7.2) annealing

The synthesized pair of F and R oligonucleotides was then ligated with ddH ₂ O was diluted to 3. mu.g/. mu.l, and 1. mu.l each was added to 48. mu.l of 1 × annealing buffer (10 × annealing buffer formulation: 100mM Tris-HCl (pH 7.5), 10mM EDTA, 1mM NaCl), and incubated at 95 ℃ for 4 minutes; incubation at 7 ℃ for 10 min; slowly cooling to 4 ℃ and hybridizing to obtain dsDNA;

2.7.3) 5' phosphorylation of dsDNA

TABLE 7 conditions for 5' phosphorylation of annealed dsDNA interference sequences

The phosphorylation reaction conditions were 37 ℃ for 30 minutes, and PNK was inactivated by incubation at 70 ℃ for 10 minutes after the reaction was completed.

2.7.4) linearization of pSuper vector

As the distance between the Bgl II and Hind III sites of the pSuper vector is only 6bp, in order to avoid incomplete double enzyme digestion, the vector linearization is carried out by adopting a method of single enzyme digestion twice in the experiment.

The first step is firstly enzyme-cutting with Hind III, and the reaction system is as follows:

the reaction was carried out at 37 ℃ for 2 hours and purified by column chromatography.

The second step is carried out by Bgl II enzyme digestion, and the reaction system is as follows:

the reaction conditions were 37 ℃ overnight digestion, column purification method according to scheme 2.5, 1% agarose gel to verify fragment size.

2.7.5) double digested pSuper Linear vector was ligated to dsDNA interference sequences in vitro

The above 20. mu.l system was ligated overnight at 4 ℃.

2.7.6) preparation of DH5 alpha competent cells

A single colony was picked from an overnight-cultured plate at 37 ℃ and inoculated into 5ml of LB liquid medium, followed by culturing overnight at 37 ℃ with shaking at 200 rpm. Then, the above-mentioned initial culture was transferred to 50ml of LB liquid medium and incubated at 37 ℃ for 4 to 6 hours with shaking at 300 rpm. The culture was transferred to a 50ml polyacrylamide tube, left on ice for 10 minutes, and then centrifuged at 4000 g/min at 4 ℃ for 10 minutes, and the culture solution was poured out to collect the cells. 30ml of precooled 0.1M CaCl per 50ml of initial culture ₂ Resuspend the cells, place on ice for 20 min, centrifuge at 4000 g/min for 10 min at 4 ℃, pour the supernatant and invert for 1 min to drain the liquid. 1ml of precooled CaCl was added per 50ml of initial culture ₂ Resuspend the cell pellet.

2.7.7) transformation of the recombinant plasmid into competent DH5 alpha

The competent cells were thawed on ice from-70 ℃, 50 μ l of each EP tube was dispensed, 2 μ l of plasmid to be transformed was added, the contents were gently mixed, ice-bathed for 20 to 30 minutes, the EP tubes were placed in a water bath preheated to 42 ℃, placed for 90 seconds, the EP tubes were quickly transferred to the ice-bath, placed for 1 to 2 minutes, 800 μ l of LB broth preheated to 37 ℃ was added to each tube, gently cultured for 45 minutes at 37 ℃ with 150 rpm/min of a shaker, 300 μ l of the transformed culture was spread on a plate containing ampicillin, cultured overnight in a 37 ℃ incubator, and positive clones were picked.

2.7.8) amplification and conservation

2.7.8.1) the picked colonies were inoculated into a test tube containing LB medium containing 100. mu.g/ml ampicillin, and the enzyme digestion was carried out at 37 ℃ for 12-16 hours with shaking at 220 rpm.

2.7.8.2) storing the above bacterial liquid, mixing with 50% glycerol at a ratio of 1:1 to obtain 800 μ l, and storing at-70 deg.C.

2.7.9) enzyme digestion and sequencing identification

2.7.9.1) extracting plasmids in small quantities

The plasmid was extracted using a small plasmid kit and its concentration was measured by UV spectrophotometry.

2.7.9.2) double enzyme digestion identification

The extracted plasmid was double digested with Hind III and EcoR I for 2 hours at 37 ℃ as follows:

and 5. mu.l of the enzyme digestion product is subjected to electrophoresis in 2% agarose gel, and the experimental result is observed and stored after the gel is imaged. The size of the fragments is compared by using the DNA Marker loaded at the same time, the fragments subjected to double enzyme digestion of the positive clone should be 287bp, and the enzyme digestion fragments of the empty vector should be 227 bp. The selected positive clones are sent to Wuhan Quintarabio company for sequencing identification, and the sequence is confirmed to be completely correct, so that the interference plasmid pSuper-sheIF3e is successfully constructed.

Example 3 transient transfection of cells, determination of optimal data acquisition time points

On the day before transfection, cells were counted using a micro-counter, using 12-well plates as an example, with the number of cells seeded per well being 1X 10 ⁶ . After overnight culture, the cell growth state is observed under an inverted microscope, and when the cell growth reaches 80% -90% fusion degree, the overexpression plasmid pcDNA3.1-eIF3e or the interference plasmid pSuper-sheIF3e is mixed with Lipofectamine TM 2000 for transfection respectively. The specific transfection steps are as follows:

3.1 mu.g plasmid DNA and 4. mu.l Lipofectamine ^TM 2000 respectively mixing with 50 mul DMEM medium, and standing for 5 minutes at room temperature;

3.2 dilutions of the plasmid DNA and Lipofectamine ^TM 2000, mixing the diluted solution, lightly blowing and uniformly mixing, and standing for 20 minutes at room temperature to fully combine the plasmid and the liposome;

3.3 remove the cell culture medium in the 12-well plate, wash the cells 3 times with cold 1 × PBS, add 1ml of serum-free cell culture medium into each well;

3.4 plasmid-containing and Lipofectamine ^TM 2000. mu.l of the mixture was added to 12-well plates at 37 ℃ with 5% CO ₂ Transfecting for 4-6 hours in an incubator;

3.5 after transfection, the medium was replaced with fresh medium containing 10% fetal bovine serum and placed at 37 ℃ in 5% CO ₂ The cells were cultured in an incubator and the transfection efficiency was observed under an inverted fluorescence microscope.

To determine the transfection efficiency and optimal transfection time of HepG2 cells, we transfected HepG2 cells with the pEGFP vector, which expresses GFP green fluorescent protein, and the transfection efficiency was calculated by observing the ratio of the number of green cells to the total number of cells under an inverted fluorescence microscope. The results of observation every 24 hours are shown in FIG. 4, in which transfection efficiency was evaluated by observing the ratio of the number of GFP-expressing green cells to the total number of cells in a field of view with a fluorescence microscope after transfecting HepG with pEGFP for 224 hours (A), 48 hours (B), 72 hours (C) and 96 hours (D). Magnification x 100.

In FIG. 4 are pictures taken under a fluorescence microscope (magnification x 100) 24 hours, 48 hours, 72 hours and 96 hours after transfection, respectively. Comparing the A, B, C, D panels of FIG. 4, it can be seen that the green cell fraction increases gradually over time from 24 hours to 72 hours. Wherein, the percentage of cells containing GFP green fluorescent protein in the whole visual field is the highest after 72 hours of transfection, about 37%, which indicates that Lipofectamine is adopted in the experiment ^TM A positive transfection rate of 37% for 2000 chemical transfections. After 96 hours, the green cells became few, the fluorescence intensity became weak, and more cells had died, indicating transfectionThe time is not as long as possible, and thus the optimal time for data collection after transfection of HepG2 cells is determined to be 24-72 hours, and preferably 72 hours. Subsequent additional experimental data acquisitions were all made during this time period.

EXAMPLE 4 quantitative determination of the intracellular eIF3e transcript levels and changes in expression levels of transfected plasmids by qRT-PCR and immunoblotting (western blot)

Transient transfection of either over-expression plasmid pcDNA3.1-eIF3e containing eIF3e or transient transfection of interference plasmid pSuper-sheIF3e specifically silencing eIF3e into HepG2 as in example 3 verified whether expression levels of eIF3e in cells were up-or down-regulated.

Intracellular RNA extraction and qRT-PCR assay referring to example 1, qRT-PCR results after transfection are shown in FIGS. 5 and 6, which are corrected for β -actin as internal reference and are the average of three independent experiments (. about.p < 0.01). Extraction of total intracellular protein and immunoblotting procedures reference 4.1 and 4.2, and the results of expression of eIF3e protein after transfection are shown in FIG. 6.

4.1 cell lysis to obtain Total proteins

The cells after the corresponding transfection time are collected and lysed to obtain the total protein, taking a 6-well plate as an example, the main steps are as follows:

4.1.1) discard the culture medium from the 6-well plate, wash the cells 2 times with 1 × PBS, add 100 μ l NP40 lysate per well (Biyunyan, product number P0013F);

4.1.2) lysis on ice for 10 minutes, during which shaking is carried out to fully lyse the cells;

4.1.3) scraping the cells in the 6-well plate with a cell scraper, aspirating the cell lysate into a 1.5ml EP tube, and centrifuging at 13000Xg for 15 minutes at 4 ℃;

4.1.4) supernatants were removed to new 1.5ml EP tubes and total protein concentrations were determined by the Bradfold method.

4.2 analysis by immunoblotting (western blot)

4.2.1) sample preparation: taking 40 μ l of supernatant from the extracted total protein, adding 10 μ l of 5xSDS loading buffer, mixing, performing metal bath at 100 ℃ for 10 minutes, immediately inserting to 4 ℃ for 5 minutes, and centrifuging at 12000Xg for 5 minutes;

4.2.2) SDS-polyacrylamide gel electrophoresis: the eIF3e is 48kD, the selected separation gel is 10%, and the selected concentration gel is 5%. Protein samples were transferred to a polyvinylidene fluoride (PVDF) membrane by semidry transfer, incubated overnight at 4 ℃ with goat anti-rabbit eIF3e primary antibody (Abcam, uk) diluted 1:300 fold, followed by further incubation with goat anti-rabbit IgG (H + L) secondary antibody diluted 1:3000 fold for 1 hour at room temperature, finally Image-exposed with ECL immunoblotting kit (Biorad, usa), and signals were semi-quantitatively analyzed with the strip density analysis software Image J.

Experiment setup for overexpression of eIF3e gene in HepG2 cells: HepG2, which was not transfected with any plasmid, was the blank control group, the treatment group transfected with pcDNA3.1 was the empty vector group, and the transfection pcDNA3.1-eIF3e was the experimental group expected to be overexpressed (HepG 2). After transfection for 24 hours, 48 hours and 72 hours, total RNA of cells of each group is respectively extracted, qRT-PCR is carried out after reverse transcription is carried out to obtain cDNA, the mRNA expression level of eIF3e gene is detected, and the experimental result is shown in figure 5. Samples were taken every 24 hours during the 24-72 hour period of transfection and levels of eIF3e mRNA were measured for each group for 3 time periods using qRT-PCR. As can be seen from fig. 5, after 24 hours of transfection, the over-expression group containing eIF3e plasmid was only 120% of the blank control group, and the up-regulation effect was not significant; eIF3e overexpression was nearly 4-fold up 48 hours after transfection; eIF3e overexpression was nearly 8-fold up-regulated after 72 hours; in addition, the mRNA amount of the empty vector pcDNA3.1 group and the cell blank group is not changed basically in three time periods. This result indicates that the transcription level of eIF3e in cells is up-regulated after pcDNA3.1-eIF3e transfection, and the difference between the mRNA amount of eIF3e and the control group reaches the maximum after 72 hours of transfection, and the transcription level is increased most.

HepG2 cell interference eIF3e gene experimental setup: HepG2, which was not transfected with any plasmid, was the blank control group, the treatment group transfected with pcSuper was the empty vector group, the group transfected with pSuper-Sn was the irrelevant interference group, and the group transfected with pcDNA3.1-sheIF3e was the experimental group for which interference was expected. After transfection for 24 hours, 48 hours and 72 hours, total RNA of cells of each group is respectively extracted, cDNA is obtained through reverse transcription, mRNA transcription level of eIF3e gene is detected through qRT-PCR, interference effect is tested, and experimental results are shown in figure 6. Samples were collected every 24 hours during transfection between 24 hours and 72 hours and mRNA transcript levels for each set of eIF3e were measured using qRT-PCR. As can be seen in fig. 6, after 24 hours of transfection, the eIF3e interference group had higher mRNA levels than the cell blank and irrelevant interference groups as well as the empty vehicle group; after 48 hours of transfection, the mRNA level of eIF3e interference group was reduced by half compared with that of cell blank control group, while the amount of mRNA of empty vector pSuper group and irrelevant interference Sn group eIF3e was higher than that of cell blank control group; after 72 hours of transfection, eIF3e interference group mRNA remained only 0.2, which is reduced by 80% compared with cell control group 1, and the empty vector pSuper group and irrelevant interference Sn group mRNA expression level is not changed much compared with cell blank control group. The results of the comprehensive experiment show that after the transfection of the interference plasmid, the interference effect can be obviously observed from 48 hours later, and the down regulation degree is maximum from 72 hours later.

The expression level of eIF3e in HepG2 cells after transfection is detected by an immunoblotting method, after grouping according to the experimental setting, the cells are cracked and extracted after 72 hours of transfection, and the expression level of eIF3e protein is detected by rabbit eIF3e primary antibody (purchased from Abcam company, UK, product number ab36766) diluted by 1:300 times and goat anti-rabbit IgG (H + L) Horse Radish Peroxidase (HRP) secondary antibody (purchased from Abcam company, UK, product number ab205718) diluted by 1:3000 times, wherein the used internal reference protein is beta-actin (beta-actin). The transfection experiment was set up as follows: HepG2 cells without any plasmid transfection were blank control group, pcDNA3.1 or pSuper were transfected as empty vector group, pcDNA3.1-eIF3e or pSuper-sheIF3e were transfected as experimental group, and pSuper-Sn was transfected as irrelevant interference group. The result of the expression level of each group of eIF3e protein is shown in FIG. 7. The empty vector groups pcDNA3.1 and pSuper and the Sn independent interference group are equivalent to the eIF3e band in the blank control group (102:103:98: 100); the eIF3e band in the pcDNA3.1-eIF3e over-expressed group was 1-fold enhanced (205:100) compared to the corresponding band in the placebo group, while the band in the sh eIF3e interference group was only 38% of the corresponding band in the placebo group, which was reduced by 62%. The results demonstrate successful overexpression and interference of eIF3 e.

The five HCC patients in example 1 were also analyzed by immunoblotting for the postoperative liver cancer tissue and the precancerous tissue, and the difference in expression levels of eIF3e between the liver cancer tissue and the precancerous tissue was compared, and the results are shown in fig. 8. The expression level of eIF3e in cancer tissue T was observed to be higher than that in paracarcinoma tissue N in all five patients. Among them, the 1 st and 4 th patients showed the most significant increase in the protein in cancer tissues 25-fold and 138-fold (T1: N1: 435:17) and 138-fold (T4: N4: 138:0), respectively, compared to the paracancerous tissues; the patient 2 had a difference of 1.1 (T2: N2: 127:112), the patient 3 had a difference of 1.5 (T3: N3: 145:97), and the patient 5 had a difference of 1.3 (T5: N5: 214: 168).

Example 5 transient transfection of the hepatoma cell line HepG2 with pcDNA3.1-eIF3e or pcDNA3.1-sheIF3e, respectively, CCK-8 assay of the effect of changes in eIF3e expression in HepG2 on cell proliferation, with empty vector pcDNA or pSuper and irrelevant interference vector pSuper-Sn as controls

CCK-8 kit was obtained by commercial procurement (Nanjing Novozam, product number A311-02), and the operation was performed according to the instructions.

The set of transfection experiments were: transfecting pcDNA3.1 or pSuper as an empty vector control group; the transfection pcDNA3.1-eIF3e is an overexpression experiment group; pSuper-sheIF3e is an interference experimental group; the transfected pSuper-Sn plasmid was an unrelated interfering group. The experimental result is shown in figure 9, and the CCK-8 method detects the influence of the change of the expression of eIF3e on the cell proliferation after the overexpression plasmid (A) or the interference plasmid (B) transfects HepG2 cells. OD of HepG2 samples not transfected with any plasmid was used as a blank control _450nm The absorption value was set to 1, and the other treatment group samples OD were set _450nm The absorbance is compared with the standard absorbance to obtain the relative value of proliferation of each group of samples. 3 replicates were set for each treatment group and the results are the average of three independent experiments (. about.p)<0.01)。

Proliferation of HepG2 was tested in groups of experimental settings 24 hours, 48 hours and 72 hours after transfection and the results were OD _450nm The values are represented. Panel A shows the proliferation of HepG2 24 to 72 hours after transfection of pcDNA3.1-eIF3e plasmid and the empty plasmid pcDNA3.1. As can be seen, eIF3e overexpression group showed some promotion of HepG2 cell proliferation after 48 hours and 72 hours compared to the empty vector control group. Panel B shows HepG2 proliferation 24-72 hours after transfection of pSuper-sheIF3e interference plasmid, pSuper empty vector and Sn plasmid, from which expression of interference eIF3eCompared with the empty vector group and the irrelevant interference control group, the group has certain inhibition effect on the proliferation of HepG2 cells after 48 hours and 72 hours. It can therefore be concluded that overexpression of eIF3e in HepG2 cells promotes HepG2 cell proliferation, and that interference with eIF3e expression acts in opposition to inhibition of proliferation.

Example 6 transient transfection of the hepatoma cell line HepG2 with pcDNA3.1-eIF3e or pSuper-sheIF3e, respectively, and the effects of changes in eIF3e expression on cell migration in HepG2 as determined by the scratch assay, using empty vector pcDNA or pSuper and irrelevant interference vector pSuper-Sn as controls

Tumor cells have a certain mobility. The cell scratching method is one of methods for measuring the movement characteristics of tumor cells, and the method is used for detecting the influence of the expression level change of eIF3e gene on cell migration, and the specific operation method is as follows:

6.1, uniformly marking transverse lines at intervals of 0.5-1 cm along a straight ruler at the back of a 6-hole plate by using a marking pen, transversely penetrating through holes, and at least drawing 3 lines on each hole to mark a scratch part;

6.2 cell 6-hole plate plating, after overnight culture, after the cell growth reaches 50% -60% fusion degree, respectively transfecting each group of cells according to experimental settings;

6.3 after the cells grow to 90% fusion degree, scratching the cells by using a gun head which is compared with the straight ruler and is perpendicular to a transverse line at the back, and keeping the gun head as vertical as possible;

6.4 washing with 1x PBS for 3 times, removing the scratched cells, and adding a serum-free culture medium for culture;

6.5 placing the culture medium into an incubator, photographing and sampling for 0 hour, 24 hours, 48 hours and 72 hours;

6.6 migration was calculated by measuring the distance of cell migration in the scratched area using software.

Scratch area: area test method (scratch distance measurement is an equivalent measurement), average scratch width is scratch void area/length.

The cell mobility was (0 hour scratch width-N hour post-incubation scratch width)/0 hour scratch width × 100%, and N here represents 24, 48, and 72 hours, respectively.

The HepG2 cells were transfected respectively according to the experimental setup, FIG. 10 is a cell scratch experiment after transfection of eIF3e over-expression plasmid pcDNA3.1-BOP1 and no-load plasmid pcDNA3.1, and A is a cell original migration diagram of eIF3e over-expression transfection group (left) and pcDNA3.1 empty vector transfection group (right). B is a comparative graph obtained by converting the original migration data of a into cell migration rates. Cell migration was recorded under an inverted microscope at 0 hour, 24 hours, 48 hours and 72 hours and photographed, and from both the original cell migration map of fig. 10A and the statistical cell mobility map of fig. 10B, it was observed that overexpression of eIF3e promoted cell migration of HepG2 from the 24 th hour, and this difference was maintained at 48 hours and 72 hours. eIF3e group: the mobility of the pcDNA3.1 control group was: 18% after 24 hours: 6.5%, 34% after 48 hours: 14%, 44% after 72 hours: 30 percent.

FIG. 11 shows the results of transfection of eIF3e with interference plasmid sheIF3e, empty plasmid pSuper and irrelevant interference plasmid Sn, where A is the map of the original migration of cells in eIF3e interference transfection group (left), irrelevant interference transfection group (middle) and pSuper empty vector transfection group (right). B is a comparative graph obtained by converting the original migration data of a into cell migration rates. Migration of the cells was also recorded after 0 hours, 24 hours, 48 hours and 72 hours by observation and photography under an inverted microscope. From both the FIG. 11A cell primary migration map and the FIG. 11B cell migration rate statistics map, it was observed that the cell migration rate of the interference plasmid sheIF3e group from the 24 th hour was slower than that of the empty vector group and the irrelevant interference group, and the difference became apparent at 48 hours and 72 hours. eIF3e group: the mobility of the PcSuper group is respectively as follows: 9.8% after 24 hours: 12.5%, 24%, 18% after 48 hours: 31%, 33%, and 21% after 72 hours: 40.7%: 42 percent. The results indicate that expression of interfering eIF3e inhibits migration of HepG2 cells.

The migration experiment results show that the expression level of eIF3e is up-regulated to promote cell migration, and the expression level of eIF3e is down-regulated to inhibit cell migration.

EXAMPLE 7 transient transfection of the hepatoma cell line HepG2 with pcDNA3.1-eIF3e or pSuper-sheIF3e, respectively, and flow sorting of the effects of changes in eIF3e expression on apoptosis in HepG2, using empty vector pcDNA or pSuper and irrelevant interference vector pSuper-Sn as controls

In normal cells, phosphatidylserine is distributed only inside the cell membrane, and when the cell begins to undergo apoptosis, phosphatidylserine is turned outside from inside the lipid membrane. Annexin V is a phospholipid-binding protein with high affinity for phosphatidylserine, and thus can bind to the cell membrane of cells in early apoptosis via the exposed phosphatidylserine on the outside of the cell. Therefore, Annexin V is one of the indexes for detecting early apoptosis of cells. Propidium iodide is a nucleic acid dye that is unable to penetrate the intact cell membrane, but stains late apoptotic and dead cell nuclei, and fails to stain live cells. Thus, the combination of these two dyes allows the detection of apoptosis in cells. The Annexin V-FITC/PI double-staining apoptosis detection kit (Jiangsu Kayji organism, product number KGA106) is selected, and the operation is carried out according to the instruction.

The experiment sets two groups of an overexpression experiment group and an interference experiment group, wherein the former is transfected with pcDNA3.1-eIF3e, the latter is transfected with pSuper-sheIF3e, HepG2 which is not transfected with any plasmid in the two groups is a blank control group, pcDNA3.1 is transfected in the overexpression group as an empty vector group, and pSuper is transfected in the interference group as an empty vector group. The results of apoptosis were observed 48 hours after staining the cells with Annexin V-FITC/PI, and the results are shown in FIGS. 12A and 12B. The influence of the change of the expression level of eIF3e in the eIF3e overexpression group (A) and the eIF3e interference group (B) on the apoptosis of HepG2 cells is evaluated by an Annexin V-FITC/PI method. The abscissa represents the number of FITC-stained cells and the ordinate represents the number of PI-stained cells.

From fig. 12A, it was found that there was substantially no difference in apoptosis in the eIF3e overexpression group compared to the HepG2 cell control group and pcdna3.1 unloaded control group, indicating that upregulation of eIF3e expression level had no effect on HepG2 apoptosis. And fig. 12B shows that apoptosis was significantly increased in the sheIF3e experimental group compared to HepG2 control group and pSuper unloaded group: the upper right corner Q1-UR represents that the proportion of double-staining positive dead cells is increased to 13.2% from 1.0% of the control group and 2.3% of the unloaded group, and no obvious difference exists between the unloaded group and the control group, which indicates that the HepG2 cell apoptosis is promoted by down-regulating the expression level of eIF3 e.

Example 8 expression profiling of eIF3e in HepG2 by immunofluorescence

In order to detect the expression position and the expression strength of eIF3e in cells, the expression condition of eIF3e is observed by an immunofluorescence method, and the specific operation steps are as follows:

8.1 soaking the glass slide in 30% hydrochloric acid and 70% absolute ethyl alcohol overnight, washing clean hydrochloric acid residual liquid with tap water the next day, finally washing 1-2 times with distilled water, wiping the glass slide with gauze, sterilizing, and putting into an oven for drying;

8.2 cell slide: placing the glass slide into a 12-pore cell plate after sterilizing and drying, taking HepG2 cells to perform single cell slide climbing at a proper concentration, and standing overnight until the growth density reaches about 30%;

8.3 fixation of cells: absorbing the culture medium, washing with 1x PBS once, fixing with 3% formaldehyde solution diluted with PBS, fixing at room temperature for 10-15 min, washing with 1x PBS for three times, soaking the slices with PBS, and storing at 4 ℃;

8.4 sucking PBS dry, dropping normal goat serum on the slide, sealing for 30 minutes at room temperature;

8.5 sucking off the confining liquid, dripping diluted primary antibody on each glass slide, and incubating overnight at 4 ℃;

8.6 addition of fluorescent secondary antibody: 1 XPBST (formulation 8mM Na) ₂ HPO ₄ ,0.136M NaCl，2mM KH ₂ PO ₄ 2.6mM KCl, 0.05% (V/V) Tween-20) soaking and washing the slide three times, each time for 3 minutes, dripping diluted fluorescent secondary antibody after absorbing and drying the redundant liquid on the slide, incubating for 1 hour at 37 ℃, and soaking and washing for three times for 3 minutes each time by 1x PBST;

8.7 counterstaining nuclei: the drop-wise fluorescent dye 4', 6-diamidino-2-phenylindole (DAPI) was incubated for 5 minutes in the dark, PBST washed four times for 5 minutes each, the liquid on the slide was blotted with absorbent paper, the slide was mounted with mounting solution containing an anti-fluorescence quencher, and then observed and imaged with an Olympus/IX73 inverted fluorescence microscope (Olympus, Japan), see FIG. 13.

The antibodies used in the experiment were 1:100 fold dilution of eIF3e goat anti-rabbit primary antibody (Abcam, uk) and 1:200 fold dilution of goat anti-rabbit IgG (H + L) secondary antibody Cy 3. FIG. 13 shows the expression of eIF3e in HepG2 cells using orange Cy3 dye with an emission wavelength of 600nm (left panel), DAPI is a fluorescent dye strongly binding to DNA, has a maximum emission peak at 461nm, and specifically stains the nucleus to a bright blue color (middle panel), and the right panel shows the effect of combining the two types of fluorescence.

As seen in figure 13, eIF3e is distributed in both the nucleus and cytoplasm, and the yellow-orange dye is brightest in the cytoplasm in the outer circle of the nucleus, suggesting that the protein is active at the ribosomal site in the cytoplasm, consistent with its regulatory function in ribosome translation initiation.

Example 9 evaluation of the Effect of eIF3e on tumor growth Using nude mouse tumorigenesis experiments

The athymic nude mice become an indispensable experimental animal model in oncology research at present, and male BALB/c nude mice with the age of 5 weeks and the weight of about 18-20 g are inoculated in an abdominal cavity by using HepG2 stably transformed by pcDNA3.1-eIF3e, and the influence of eIF3e on the tumor growth is evaluated by a tumorigenic experiment.

9.1 pretreatment of cells

HepG2 which is injected intraperitoneally with pcDNA3.1-eIF3e for stable transformation is used as an experimental group, and ordinary HepG2 is used as a control group, wherein eIF3e plasmid contained in the cells of the HepG2 is integrated on host chromosome, so that eIF3e can be continuously and stably expressed at high water level, the stable transformation cell line is finished by Wuhan Hejianhe research biological medicine science and technology company, and is obtained by carrying out G418 resistance screening on introduced plasmid in HepG2 on the basis of pcDNA3.1-eIF3e transient transfection.

The inoculated cells are in a logarithmic growth phase, the fusion degree is about 80-90%, and a fresh culture medium needs to be replaced in the evening before the cells are collected. Cells were trypsinized and washed twice with pre-cooled 1x PBS to remove serum from the cells. Blowing and beating the cell sediment to a proper concentration by using 1x PBS or serum-free culture medium, wherein the cell quantity inoculated in the abdominal cavity of each nude mouse is 1-5 x10 ⁶ Cells, the seeding volume is 0.1ml, so the concentration of the cell suspension is 1-5 x10 ⁷ Cells/ml. After digestion, the cells are inoculated into the abdominal cavity of a nude mouse within half an hour, and the cell suspension is placed on ice on the way to reduce cell metabolism.

9.2 Abdominal Cavity inoculation of nude mice

The control group and the experimental group each contained 15 nude mice, and the total number of the nude mice was 30. Mice were anesthetized with 10% chloral hydrate at a dose of 3 μ l/g intraperitoneally for about 5 minutes, and the animals were started to rest and fixed supine, noting that this procedure is contraindicated for overdose of anesthetic. The iodophor cotton ball disinfects the ventral side of the abdomen to the neck, the groin and the posterior axillary line, and the disinfection is carried out twice. The mice were draped with a surgical drape and their left abdominal sides exposed by a cut (4x4cm) and sterilized once with iodophor. Cutting 2cm of skin downwards at 1cm of lower edge of left costal arch to expose abdominal wall muscle, pulling abdominal wall muscle with forceps to avoid spleen in abdominal cavity, cutting abdominal wall muscle, and exposing viscera. PBS was dipped with a cotton swab, the lower spleen was removed, and the spleen and pancreas were not damaged by pulling. While finding the spleen, mix 25. mu.l Matrigel in the cell tube, suspend the cell pellet to disperse the cells uniformly into a single cell suspension. Sucking the single cell suspension in the EP tube with BD needle, slightly withdrawing the needle core to form air bubble, inserting the needle at the inner side of the concave surface of the lower extreme of the spleen, injecting cells about 2mm towards the splenomegaly, staying for about 30 seconds after injection, and slowly withdrawing the needle to prevent the cells from exuding. Meanwhile, a cotton ball dipped with PBS is used for pressing peripheral bleeding points to stop bleeding. The normal saline for aspiration 250: 1 diluted gentamicin injection 400. mu.l, injected into abdominal cavity, and dipped in antibiotic exuded from dry skin edge by cotton ball. The abdominal wall muscles were sutured starting and 4 needles were sutured consecutively. The syringe is used again to suck 400 mul of gentamicin injection, the stitching opening is washed, and the cotton ball is dipped to be dry. The skin was sutured intermittently with 4 needles. An iodophor cotton ball is used for disinfecting and suturing the mouth. After the cell injection is finished, the ear-cutting marks are cut, and the ear-cutting marks and grouping conditions are recorded. The fixation was removed and the mice were placed in their natural position in their cages.

9.3 neoplasia data processing and analysis

The animals began to develop a mass about one week after inoculation, and subcutaneous neoplasia was observed from day 6 onwards. The tumor size is measured once every 6 days by using a vernier caliper, 1-3 mice are killed by random cervical vertebra separation in each group, the tumors which are removed four times are collected after 24 days, the tumors are classified according to groups and are placed from left to right according to the time sequence, the size of the tumor volume is visually displayed by the aid of the vernier caliper arranged below, the images are photographed (fig. 14A), and a tumor growth trend graph is drawn according to the tumor volume measured at different times (fig. 14B).

HepG2 or a normal HepG2 control of stable eIF3e was intraperitoneally injected, and the sizes of newborn tumors in two groups of nude mice were measured and compared from day 6, and samples were taken every 6 days until day 24. It was found that the mean tumor volume in the experimental group was slightly larger than that of the control group from day 12, the difference was increased at day 18, and the mean tumor volume in the experimental group stably transformed with eIF3e at day 24 reached 2200mm ³ While the control group was only 400mm ³ And the difference between the two is 5.5 times, and the expression level of eIF3e is shown to be up-regulated to obviously promote the growth of the tumor.

And (4) conclusion: the expression of eIF3e is up-regulated to be positively correlated with the occurrence and development of liver cancer, and the eIF3e has the potential to become a new HCC treatment target or a biomarker related to diagnosis and prognosis and is applied to clinical medicine.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Sequence listing

<110> Chengdu kang Lopa Biotechnology Ltd

<120> specific marker closely related to occurrence and development of primary hepatocellular carcinoma and application thereof

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1338

<212> DNA

<213> eIF3e(eIF3e)

<400> 1

atggcggagt acgacttgac tactcgcatc gcgcactttt tggatcggca tctagtcttt 60

ccgcttcttg aatttctctc tgtaaaggag atatataatg aaaaggaatt attacaaggt 120

aaattggacc ttcttagtga taccaacatg gtagactttg ctatggatgt atacaaaaac 180

ctttattctg atgatattcc tcatgctttg agagagaaaa gaaccacagt ggttgcacaa 240

ctgaaacagc ttcaggcaga aacagaacca attgtgaaga tgtttgaaga tccagaaact 300

acaaggcaaa tgcagtcaac cagggatggt aggatgctct ttgactacct ggcggacaag 360

catggtttta ggcaggaata tttagataca ctctacagat atgcaaaatt ccagtacgaa 420

tgtgggaatt actcaggagc agcagaatat ctttattttt ttagagtgct ggttccagca 480

acagatagaa atgctttaag ttcactctgg ggaaagctgg cctctgaaat cttaatgcag 540

aattgggatg cagccatgga agaccttaca cggttaaaag agaccataga taataattct 600

gtgagttctc cacttcagtc tcttcagcag agaacatggc tcattcactg gtctctgttt 660

gttttcttca atcaccccaa aggtcgcgat aatattattg acctcttcct ttatcagcca 720

caatatctta atgcaattca gacaatgtgt ccacacattc ttcgctattt gactacagca 780

gtcataacaa acaaggatgt tcgaaaacgt cggcaggttc taaaagatct agttaaagtt 840

attcaacagg agtcttacac atataaagac ccaattacag aatttgttga atgtttatat 900

gttaactttg actttgatgg ggctcagaaa aagctgaggg aatgtgaatc agtgcttgtg 960

aatgacttct tcttggtggc ttgtcttgag gatttcattg aaaatgcccg tctcttcata 1020

tttgagactt tctgtcgcat ccaccagtgt atcagcatta acatgttggc agataaattg 1080

aacatgactc cagaagaagc tgaaaggtgg attgtaaatt tgattagaaa tgcaagactg 1140

gatgccaaga ttgattctaa attaggtcat gtggttatgg gtaacaatgc agtctcaccc 1200

tatcagcaag tgattgaaaa gaccaaaagc ctttccttta gaagccagat gttggccatg 1260

aatattgaga agaaacttaa tcagaatagc aggtcagagg ctcctaactg ggcaactcaa 1320

gattctggct tctactga 1338

<210> 2

<211> 24

<212> DNA

<213> Artificial sequence (eIF3e-F)

<400> 2

acaaggcaaa tgcagtcaac cagg 24

<210> 3

<211> 24

<212> DNA

<213> Artificial sequence (eIF3e-R)

<400> 3

tgctgctcct gagtaattcc caca 24

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence (beta-actin-F)

<400> 4

catgtacgtt gctatccagg c 21

<210> 5

<211> 21

<212> DNA

<213> Artificial sequence (beta-actin-R)

<400> 5

ctccttaatg tcacgcacga t 21

<210> 6

<211> 28

<212> DNA

<213> Artificial sequence (eIF3e-PCR-F)

<400> 6

ggaagcttat ggcggagtac gacttgac 28

<210> 7

<211> 34

<212> DNA

<213> Artificial sequence (eIF3e-PCR-R)

<400> 7

ggctcgagtc agtagaagcc agaatcttga gttg 34

<210> 8

<211> 60

<212> DNA

<213> Artificial sequence (sheIF3e-F)

<400> 8

gatccccgga agaccttaca cggttattca agagataacc gtgtaaggtc ttccttttta 60

<210> 9

<211> 60

<212> DNA

<213> Artificial sequence (sheIF3e-R)

<400> 9

agcttaaaaa ggaagacctt acacggttat ctcttgaata accgtgtaag gtcttccggg 60

<210> 10

<211> 60

<212> DNA

<213> Artificial sequence (sh-n-F)

<400> 10

gatcccctcc gaacgtgtca cgtttcttca agagagaaac gtgacacgtt cggattttta 60

<210> 11

<211> 60

<212> DNA

<213> Artificial sequence (sh-n-R)

<400> 11

agcttaaaaa tccgaacgtg tcacgtttct ctcttgaaga aacgtgacac gttcggaggg 60

<210> 12

<211> 445

<212> PRT

<213> eIF3e(eIF3e)

<400> 12

Met Ala Glu Tyr Asp Leu Thr Thr Arg Ile Ala His Phe Leu Asp Arg

1 5 10 15

His Leu Val Phe Pro Leu Leu Glu Phe Leu Ser Val Lys Glu Ile Tyr

20 25 30

Asn Glu Lys Glu Leu Leu Gln Gly Lys Leu Asp Leu Leu Ser Asp Thr

35 40 45

Asn Met Val Asp Phe Ala Met Asp Val Tyr Lys Asn Leu Tyr Ser Asp

50 55 60

Asp Ile Pro His Ala Leu Arg Glu Lys Arg Thr Thr Val Val Ala Gln

65 70 75 80

Leu Lys Gln Leu Gln Ala Glu Thr Glu Pro Ile Val Lys Met Phe Glu

85 90 95

Asp Pro Glu Thr Thr Arg Gln Met Gln Ser Thr Arg Asp Gly Arg Met

100 105 110

Leu Phe Asp Tyr Leu Ala Asp Lys His Gly Phe Arg Gln Glu Tyr Leu

115 120 125

Asp Thr Leu Tyr Arg Tyr Ala Lys Phe Gln Tyr Glu Cys Gly Asn Tyr

130 135 140

Ser Gly Ala Ala Glu Tyr Leu Tyr Phe Phe Arg Val Leu Val Pro Ala

145 150 155 160

Thr Asp Arg Asn Ala Leu Ser Ser Leu Trp Gly Lys Leu Ala Ser Glu

165 170 175

Ile Leu Met Gln Asn Trp Asp Ala Ala Met Glu Asp Leu Thr Arg Leu

180 185 190

Lys Glu Thr Ile Asp Asn Asn Ser Val Ser Ser Pro Leu Gln Ser Leu

195 200 205

Gln Gln Arg Thr Trp Leu Ile His Trp Ser Leu Phe Val Phe Phe Asn

210 215 220

His Pro Lys Gly Arg Asp Asn Ile Ile Asp Leu Phe Leu Tyr Gln Pro

225 230 235 240

Gln Tyr Leu Asn Ala Ile Gln Thr Met Cys Pro His Ile Leu Arg Tyr

245 250 255

Leu Thr Thr Ala Val Ile Thr Asn Lys Asp Val Arg Lys Arg Arg Gln

260 265 270

Val Leu Lys Asp Leu Val Lys Val Ile Gln Gln Glu Ser Tyr Thr Tyr

275 280 285

Lys Asp Pro Ile Thr Glu Phe Val Glu Cys Leu Tyr Val Asn Phe Asp

290 295 300

Phe Asp Gly Ala Gln Lys Lys Leu Arg Glu Cys Glu Ser Val Leu Val

305 310 315 320

Asn Asp Phe Phe Leu Val Ala Cys Leu Glu Asp Phe Ile Glu Asn Ala

325 330 335

Arg Leu Phe Ile Phe Glu Thr Phe Cys Arg Ile His Gln Cys Ile Ser

340 345 350

Ile Asn Met Leu Ala Asp Lys Leu Asn Met Thr Pro Glu Glu Ala Glu

355 360 365

Arg Trp Ile Val Asn Leu Ile Arg Asn Ala Arg Leu Asp Ala Lys Ile

370 375 380

Asp Ser Lys Leu Gly His Val Val Met Gly Asn Asn Ala Val Ser Pro

385 390 395 400

Tyr Gln Gln Val Ile Glu Lys Thr Lys Ser Leu Ser Phe Arg Ser Gln

405 410 415

Met Leu Ala Met Asn Ile Glu Lys Lys Leu Asn Gln Asn Ser Arg Ser

420 425 430

Glu Ala Pro Asn Trp Ala Thr Gln Asp Ser Gly Phe Tyr

435 440 445

Claims

1. The application of a specific marker closely related to the occurrence and development of primary hepatocellular carcinoma in the preparation of a kit for detecting hepatocellular carcinoma is characterized in that: the specific marker is an expression product of eIF3e gene and/or eIF3e gene.

2. The use of the specific marker closely related to the occurrence and development of primary hepatocellular carcinoma in the preparation of a kit for detecting hepatocellular carcinoma as claimed in claim 1, wherein: the kit comprises a qRT-PCR detection kit or a protein immunoassay kit.

3. The use of the specific marker closely related to the occurrence and development of primary hepatocellular carcinoma in the preparation of a kit for detecting hepatocellular carcinoma as claimed in claim 2, wherein: the qRT-PCR detection kit comprises a primer for amplifying an eIF3e gene fragment, and the primer sequence is shown in SEQ ID NO.2 and SEQ ID NO. 3.

4. The use of the specific marker closely related to the occurrence and development of primary hepatocellular carcinoma in the preparation of a kit for detecting hepatocellular carcinoma according to claim 2, wherein: the protein immunoassay kit comprises an antibody specifically bound to the eIF3e protein.