CN110563828B

CN110563828B - Chilo suppressalis male specificity lethal associated protein MSL3, coding gene, dsRNA interference sequence and application thereof

Info

Publication number: CN110563828B
Application number: CN201910725667.0A
Authority: CN
Inventors: 马伟华; 金慧慧; 李昌焱; 陈浩; 林拥军
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2019-08-07
Filing date: 2019-08-07
Publication date: 2022-07-08
Anticipated expiration: 2039-08-07
Also published as: CN110563828A

Abstract

The invention belongs to the technical field of agricultural biology, and particularly relates to a chilo suppressalis male specificity lethal associated protein MSL3, and a coding gene, a dsRNA interference sequence and application thereof. The amino acid sequence of the chilo suppressalis male specificity lethal associated protein MSL3 is shown in SEQ ID No. 1. The invention discovers that Male-specific lethal-3(MSL3) gene participates in the growth and development process of Chilo suppressalis, the loss of expression of the gene can obviously improve the death rate of Chilo suppressalis larvae, and finally the development of population is inhibited, so that the gene can be used for developing products for preventing and controlling Chilo suppressalis insects in the family of snout moth.

Description

Chilo suppressalis male specificity lethal associated protein MSL3, coding gene, dsRNA interference sequence and application thereof

Technical Field

The invention belongs to the technical field of agricultural biology, and particularly relates to a chilo suppressalis male specificity lethal associated protein MSL3, and a coding gene, a dsRNA interference sequence and application thereof.

Background

Chilo suppressalis (Chilo supressalis) belongs to the family of lepidoptera snout moth's family, is an important omnivorous agricultural pest, mainly harms various plants such as rice, water bamboo, corn, wheat and the like, and is particularly serious in harm to early-planted, densely-grown fields and hybrid paddy fields. At present, chemical insecticides are mainly applied to the prevention and control of chilo suppressalis, but the problems of environmental stress, drug resistance and the like are caused by long-term use of a large amount of chemical pesticides. In order to change such situations, development and utilization of rice pest pollution-free control measures which accord with the concepts of environmental protection, health, green ecological construction and sustainable development become the current control hotspots.

Male-specific lethal 3(Male-specific lethals-3, MSL-3) is an MRG family gene. The MRG family is involved in transcriptional alarm regulation through histone acetylation and contains 2 domains of the color and one leucine zipper motif. The MRG family has been shown to be of great significance for cellular senescence, proliferation, positive and negative transcriptional regulation, and DNA damage repair.

MSL3 has been studied in plants, crustaceans, mammals and insects, and plays a role in balancing sex differences, but its role in Chilo suppressalis has not been reported.

Disclosure of Invention

The invention aims to provide a chilo suppressalis male specificity lethal related gene MSL 3.

It is still another object of the present invention to provide a protein encoded by the above gene.

It is still another object of the present invention to provide dsRNA interference sequences of the above genes.

It is still another object of the present invention to provide a recombinant expression vector containing the above gene.

It is still another object of the present invention to provide a recombinant strain containing the above gene.

The invention further aims to provide application of the Chilo suppressalis MSL3 gene.

The invention further aims to provide application of the dsRNA interference sequence of Chilo suppressalis MSL3 gene.

The amino acid sequence of the chilo suppressalis male specificity lethal associated protein MSL3 is shown in SEQ ID NO. 1:

MKRSVLHLRLRPVCVGSVCVTTEGETGDTDSSGSGSGSSSAPRSPPPHAHVGRAHIALPSALRDRLTFDYHLVVKRGRLSRLPATPCAAEILESFVKWFARAGAWHPARARHDPPQRPDLLDVSCRLNLVREVADGLRVYFDFVLRGHLLYKQELAQYHDICGQFLRDQEVETGAEMEEGTASQEEALEDDLKSPKIPEYAHLPPDPCDIGDRDETGKTSPLTNNEEEPPKADTEKAKGDSCEESNSTACNQSKPRERAAARPTLARRLRSHKSVVSQSENEEPAPSTSGEQRAFETLSSSVGSSGSSLSEVWARPTRAPAPAPATHTPARTPLSLLLDKVAKWQIIPREGTEHLPCRVYGAIHLARLFVKLPDFLNATQMPDFKLKLILKHIDMFVQYLDEHNEWFGEMYYVADNMSRSH

the nucleotide sequence of the chilo suppressalis male specificity lethal related gene MSL3 provided by the invention is shown in SEQ ID NO. 2:

CAAAAACAATGTTGGCACGCTCGTCGCCTCTGATCACTGTTTTCATATTTATAATATTTATCCACATGTTTCTAGTTTCTATATAGACACAACGTGTTTTAGTTACTTACAAGTGCTAATTACATATGGACTAATAACTTAAATTCAGTAGTGATTTTAATTGAATATTTTGAATATTTATTTAATTTTTCAAATTAAAACTGAACTTAATTGACTGTGTTAACTATCCTTTTCCAGTCCTTTTATTATTTTATTGTAATTATTAATTATTTGCATGCAATTAAAAAATATTTTTAATGATGCTAAAGAAGTATAACTTCTCACGCGGGTACATAAGTTACACGCATCCATTTTTTTTTTAATCTAATTGTGACAAATTAAGCTGTAGAAAACAAAACCATAGAATTGAAACGGATGGCCGGAATCCACGTTTTACGCCACCTAATGTGTTCTCAAAATATGACACGCTCGGTTTTTATACAAGTTGAAACACAGGCGTCATCTACTAGGTGAACAACGCACGAGTCAAAACCGCGGCGGATGGAGGTCGCGCGGTTGTTTATTTGTTTGCACATAGGTACGAAAACTTATTCACATCCGTTTAACCGCGCGGGTGAGCCATACAAATAACATCCGCGCAGCCGCCATCCACCGCGGTTCGCTGCTCGTGCGGTGTGGCACTTAGCACCACATACCTAAATTTAAGTAGAACGAACGTGCTTCAACTTGTATGAAACGGAGCGTTCTTCACCTGAGACTAAGGCCGGTGTGTGTAGGCAGTGTGTGTGTGACGACAGAGGGCGAAACCGGCGACACGGACTCGTCGGGCTCTGGCTCGGGCTCCAGCTCGGCGCCGCGCTCGCCGCCGCCGCACGCGCACGTCGGCAGGGCACACATCGCGCTACCCTCCGCGCTCAGGGATCGTCTCACATTCGACTACCACCTGGTGGTGAAGCGCGGGCGTTTATCCCGGCTGCCGGCGACGCCGTGCGCCGCGGAGATCCTCGAGTCGTTCGTAAAGTGGTTTGCGCGCGCCGGCGCCTGGCATCCGGCCCGCGCGAGACACGACCCGCCACAGCGGCCGGACTTGCTGGACGTGTCTTGCAGGTTGAACCTAGTCCGTGAGGTTGCCGACGGGCTGCGCGTTTACTTCGACTTCGTGCTACGTGGTCATTTACTGTACAAACAAGAACTAGCGCAGTATCACGACATCTGCGGCCAGTTCTTAAGAGATCAGGAAGTGGAGACAGGAGCGGAAATGGAAGAGGGGACGGCTTCTCAAGAGGAGGCTTTAGAGGATGACCTAAAGAGTCCCAAGATACCTGAATACGCGCATCTGCCGCCTGATCCCTGTGACATTGGAGACCGAGATGAAACAGGGAAGACTTCACCTCTGACAAATAACGAAGAGGAACCACCGAAAGCGGACACAGAGAAGGCAAAGGGCGACTCGTGTGAGGAATCGAACTCTACTGCTTGCAACCAATCAAAGCCGCGAGAAAGGGCGGCGGCTCGACCCACACTCGCTAGAAGGCTTCGCTCTCACAAATCGGTGGTGTCACAGTCCGAGAACGAGGAACCAGCGCCGTCAACGTCCGGCGAGCAAAGAGCATTTGAAACCCTATCTTCAAGCGTGGGCAGCAGCGGATCATCATTAAGCGAAGTGTGGGCGCGTCCCACCCGCGCGCCCGCGCCTGCGCCCGCCACCCACACGCCCGCGCGGACGCCGCTCTCCCTGCTGCTGGACAAGGTAGCGAAATGGCAGATTATACCGCGAGAGGGCACAGAGCATTTGCCATGTCGCGTGTATGGTGCAATTCATCTGGCGCGATTATTCGTGAAATTACCAGATTTTTTAAATGCGACGCAGATGCCAGACTTCAAACTGAAACTCATCTTGAAACACATTGATATGTTTGTTCAATACTTAGATGAACACAATGAATGGTTCGGAGAGATGTACTATGTTGCAGACAATATGTCTCGATCGCATTAATTTTTAAGTTAATAATTTTTAATCCCTATATTGTAATCTCACACTCGATCAGGGCCGCATCTAGGGGAGGCATTATGGCACATTGCTCTGCTCCAATAAATAGCATCAATACCATAAATACAACCCTGGCTACGGCTCTGAACTCATTTTATAACATATTTTGTATACCTAACTATAGTGTAGTGTATTAGACAAGACAGTGTTTCAAAAATTACACGTCGGTTTAAAATGCATGCTTTCCTAAATTATAGCATGACCACCTCAACATATTATATGCAGTAATATGCAACATATTTTATATATATATGCATAGATGTATCTGCGAAAATTTACTGTCATTGTATTTTCCCTATTATCGTGTTGGTCATGCTACGTATTAGAGAGATTAGATATCAATGAATGAATGCATTAGATATAACAAACAAAGTCCTTTAGTTTTCTTTTCGTAGTGGTGCTTTCTTTGGGCATCGCAATTTTTTCCCGCGATAACAATAGTGAAATTTAAGGAAAAAATGCATTTGTATGTACCGTCCGTAAGTGATCCCCAATATTGCTTTTTTAATCGCATTTCATAAAATATGTAATGTTAATTTAGGAATAAGATATGAAACGAGTGACTTGCTATAAGCCTTTGCCTACAAAAAATTAAACAGATTATAGTGTTAAAGATTCAAGGTCATGAAAATAAAATATCTTAATTTATAAAATACATATTTTACCAATATTCTAAATCATGTTAAAAATTTGCATTATTTACATAACACAACGTTTTTACAAATTGGAAGGAATTACTATATACTATGTTGTTTGTTATATAAATTAGATTAAATAAAAACTTAATGTTTAATTACTACTCAGCGAAAGTATTTTGCTAAAGGAATTGTTTCTTTTTAAGTGTCGCAAAACGTTTAGTCCAGGCAACGAAAAGGTATAGAGGGAAATGCTTAGAACACAATTTTTGACTTCGTAACTTTGTTAGGACTAGTTAGGAGGTAAACATATCAAAAGTCCCCGCCCGTAGCCCTTAAGCCGGGGGGAAGGGGGGGGATTGAAGGTCCCATTTTTAGGTTTTTCGCATATATTTCGGAAACTATGCATCCTAGCGACATGAGACTTTAACAAAAGTGAAAGCTGATTAAAATTGCTACAAGTCTTATTATGTCAAGATTTTTGATATCCTGTATAGTTTTCAAGATATCCGCTCTTGAAAGTCTGTATTATGGAAAAAAAAATTGCTTCACATTTTTGCTCTATTTGACCGGATAACTCTTCAACAATGCCGGCCGTAGGGTTGTTGGTTCCACCAGTGAGCAGCATGCAGATTTCGGACCAGCCCGCCAAAACAAGGATGGAGCTGACATTGCCAAGCTCACCGATTGGTTTGAGAAATTTCCTCCCTTGCCAGAGACCAGAGACATTATCAAGTCACCAGAAATCCAGAAACCAGCAGCGGTATTTTCACACCCTTTCTCCACCACCACTCAAGTAAAAAAGGCAGGTGAAATCTGCATCTTAAGGTGGTATGGAGCTCCAGCGAAAGAGATTTCCCTCAATGCCTACAGGTACAACTGGTACAAGTCATTCTTGAAATCAGTGGCCACCATCAAGCCTGATATCTCTTGTCTTCCTCCCACCGAGGTAGCAGTAAAACAGCATTCCCAGGAAGTGGTGGCAATTTTTTTTCCATAATTACAGACTTTCGAAAGCGGATATCTCGAAAACTATACAAGATATCAAAAAACTTGACTGAATAAGACTTGTTTGACTTTAATCAGCTTTCACTTTTGTCTCATGTCGCTAGGATGCATAGTTTCCGGGATATACGCGAAAAACCTAAAAAAGGGACCTTCAATCCCCCCCTTCCCCCCGGCTTAAGGGCTACGGGCGGGGACTTTTGATATGTTTACCTCCTAACTAGCCCTAACAAAGTTACGAAGTCAAAAATTGTGTTCCAAGCATTTCCCTCTATACCTGTTTTTGAGCATTCGTTGCCTGGACTAGTTTCCAAACAATATTAATAAAGAATGATCTCACTAGCTTAGATTGTTTAGAATATAAAATAGAACTGACTACGCGCTAGGAATCCACGGTTTAATTTATAAGTATGTAGTTAGTCGTAATGTTTTACTTGATAAAGTTATGAGCAAAC

the total length of the sequence is 4145 bp.

The nucleotide sequence of cDNA of the chilo suppressalis male specificity lethal related gene MSL3 is shown in SEQ ID NO. 3:

ATGAAACGGAGCGTTCTTCACCTGAGACTAAGGCCGGTGTGTGTAGGCAGTGTGTGTGTGACGACAGAGGGCGAAACCGGCGACACGGACTCGTCGGGCTCTGGCTCGGGCTCCAGCTCGGCGCCGCGCTCGCCGCCGCCGCACGCGCACGTCGGCAGGGCACACATCGCGCTACCCTCCGCGCTCAGGGATCGTCTCACATTCGACTACCACCTGGTGGTGAAGCGCGGGCGTTTATCCCGGCTGCCGGCGACGCCGTGCGCCGCGGAGATCCTCGAGTCGTTCGTAAAGTGGTTTGCGCGCGCCGGCGCCTGGCATCCGGCCCGCGCGAGACACGACCCGCCACAGCGGCCGGACTTGCTGGACGTGTCTTGCAGGTTGAACCTAGTCCGTGAGGTTGCCGACGGGCTGCGCGTTTACTTCGACTTCGTGCTACGTGGTCATTTACTGTACAAACAAGAACTAGCGCAGTATCACGACATCTGCGGCCAGTTCTTAAGAGATCAGGAAGTGGAGACAGGAGCGGAAATGGAAGAGGGGACGGCTTCTCAAGAGGAGGCTTTAGAGGATGACCTAAAGAGTCCCAAGATACCTGAATACGCGCATCTGCCGCCTGATCCCTGTGACATTGGAGACCGAGATGAAACAGGGAAGACTTCACCTCTGACAAATAACGAAGAGGAACCACCGAAAGCGGACACAGAGAAGGCAAAGGGCGACTCGTGTGAGGAATCGAACTCTACTGCTTGCAACCAATCAAAGCCGCGAGAAAGGGCGGCGGCTCGACCCACACTCGCTAGAAGGCTTCGCTCTCACAAATCGGTGGTGTCACAGTCCGAGAACGAGGAACCAGCGCCGTCAACGTCCGGCGAGCAAAGAGCATTTGAAACCCTATCTTCAAGCGTGGGCAGCAGCGGATCATCATTAAGCGAAGTGTGGGCGCGTCCCACCCGCGCGCCCGCGCCTGCGCCCGCCACCCACACGCCCGCGCGGACGCCGCTCTCCCTGCTGCTGGACAAGGTAGCGAAATGGCAGATTATACCGCGAGAGGGCACAGAGCATTTGCCATGTCGCGTGTATGGTGCAATTCATCTGGCGCGATTATTCGTGAAATTACCAGATTTTTTAAATGCGACGCAGATGCCAGACTTCAAACTGAAACTCATCTTGAAACACATTGATATGTTTGTTCAATACTTAGATGAACACAATGAATGGTTCGGAGAGATGTACTATGTTGCAGACAATATGTCTCGATCGCATTAA

the invention also provides a recombinant expression vector and a recombinant strain containing the Chilo suppressalis MSL3 gene or the dsRNA interference sequence thereof.

The dsRNA interference sequence of Chilo suppressalis MSL3 gene according to the embodiment of the invention is obtained by amplifying the following specific primer sequences:

upstream primer ds MSL 3-F: 5'-TTTGCCATGTCGCGTGTATG-3'

Downstream primer ds MSL 3-R: 5'-CCCAAAGAAAGCACCACTACG-3' are provided.

The invention provides application of the gene in prevention and treatment of chilo suppressalis insects in the family of the borer moth, which comprises the step of feeding chilo suppressalis with a dsRNA interference sequence of a chilo suppressalis male specificity lethal related gene MSL 3. The interference sequence is a double-stranded RNA molecule, dsRNA of the sequence is synthesized in vitro by using a specific primer, and the sequence is smeared and fed to chilo suppressalis incipient incubation larvae, and the result shows that the sequence can obviously inhibit the expression of a Male-specific lethal-3(MSL3) gene. Further researching the influence of Male-specific lethal-3(MSL3) gene on the death rate of Chilo suppressalis larvae, and finding that the suppression of the expression of MSL3 gene remarkably improves the death rate of larvae and can suppress the development of population.

The invention has the beneficial effects that:

the invention discovers for the first time that the Male-specific lethal-3(MSL3) gene participates in the growth and development process of Chilo suppressalis, and the deletion of Male-specific lethal-3(MSL3) expression obviously improves the death rate of Chilo suppressalis larvae, and finally inhibits the development of population. The gene can be used for developing products for preventing and controlling chilo suppressalis insects in the family of snout moth's larva.

The invention provides an interference sequence of a Chilo suppressalis Male-specific genetic-3 (MSL3), which can obviously inhibit the expression of Male-specific genetic-3 (MSL3) genes, and can be used for interfering the expression of Male-specific genetic-3 (MSL3) genes, inhibiting the growth of Chilo suppressalis and finally controlling the development of Chilo suppressalis populations. Meanwhile, the interference sequence can be used for developing environment-friendly insect-resistant plants, and finally the purpose of green pest control is achieved.

Drawings

FIG. 1 shows the silencing efficiency of Chilo suppressalis MSL3 gene after feeding dsRNA of MSL3 gene;

FIG. 2 shows the effect of dsRNA fed with MSL3 gene on the growth and development of Chilo suppressalis.

Detailed Description

Example 1 cloning and analysis of Chilo suppressalis MSL3 Gene

Taking a chilo suppressalis sample of 20mg, putting the chilo suppressalis sample into a 1.5ml enzyme-free tube, fully grinding the chilo suppressalis sample by using a disposable enzyme-free grinding rod and liquid nitrogen, and extracting total RNA by using an extraction kit.

The total RNA extracted above was synthesized into cDNA templates using a reverse transcription kit.

The nucleic acid sequence (SEQ ID NO: 2) of the Male-specific leader-3 (MSL3) gene was obtained by transcriptome sequencing, and primers were designed to verify the predicted open reading frame. The following primers were designed and synthesized:

the upstream primer sequence MSL 3-F: 5'-ATGAAACGGAGCGTTCTTCACC-3', respectively;

downstream primer sequence MSL 3-R: 5'-TTAATGCGATCGAGACATATTGTCTGC-3' are provided.

The primers MSL3-F and MSL3-R are used for PCR amplification, after the amplification is finished, 1% agarose gel electrophoresis is used for identification, the gel is cut, and the target fragment is recovered by purification.

The PCR product was ligated into pEASY-T1 vector, transformed into E.coli DH 5. alpha. competent cells, screened for positive clones and sequenced.

The full length of the Male-specific lethal-3(MSL3) gene open reading frame is 1266bp, 421 amino acid residues are coded, the amino acid sequence of the MSL3 protein is shown in SEQ ID NO.1, the molecular mass is 46.7KDa, and the theoretical isoelectric point is 6.20.

Example 2 silencing efficiency of genes and Effect on Chilo suppressalis growth and development after feeding dsRNA of MSL3 Gene

2.1 preparation of dsRNA templates

Based on the sequence of Male-specific lethal-3(MSL3) gene obtained in example 1, specific amplification primers (5' -end with appropriate restriction enzyme site) were designed for amplification of dsRNA fragment of Male-specific lethal-3(MSL3) gene, and the specific primers were designed as follows:

upstream primer sequence ds MSL 3-F: tgGAATTCTTTGCCATGTCGCGTGTATG

Downstream primer sequence ds MSL 3-R: tgGGTACCCCCAAAGAAAGCACCACTACG。

Note: the scoring part is an EcoR I enzyme site

PCR amplification was performed using the primers ds MSL3-F and ds MSL3-R described above. After amplification, the target fragment is cut and purified and recovered by a gel recovery kit after 1% agarose gel electrophoresis identification. Finally, it was ligated into pEASY-T1 vector by TA cloning.

2.2 construction of expression vectors

Extracting a plasmid containing the target fragment, carrying out enzyme digestion, and connecting the enzyme-digested target fragment with a pET-2P vector. The recombinant vector was transformed into competent cells HT 115.

2.3 dsRNA for feeding MSL3 Gene

Taking 100ml of the well-expressed bacterial liquid in the escherichia coli, centrifuging for 5min at 5000rpm, discarding the supernatant, and using 5ml (20:1) ddH₂And precipitating the O suspension bacteria liquid, and storing the O suspension bacteria liquid in a refrigerator at 4 ℃ for later use or directly using the O suspension bacteria liquid in a feeding experiment.

Two days ahead, rice seeds MH63 were soaked in absorbent cotton and water, and the seeds germinated when the experiment was fed.

Uniformly coating rice seeds with the concentrated bacterial liquid, placing three MH63 rice seeds in U-shaped tubes, keeping the environment moist, inoculating 40 Chilo suppressalis primary-hatched larvae into each U-shaped tube, and feeding the Chilo suppressalis larvae for 72 hours. Each feeding experiment was set up for 5 replicates, individually with ddH₂O, dsRNA (GFP, MSL 3).

After 72h feeding, a portion of the interfering larvae was collected as a quantitative sample to determine the efficiency of the interference, 3 replicates each were treated, and 15 larvae each.

After 7 days, the mortality rate of the insects is counted, and the experimental results are recorded.

As shown in figure 1, qRT-PCR detection results show that compared with a control group, dsRNA fed with MSL3 gene remarkably inhibits the expression of Male-specific leader-3 (MSL3) in Chilo suppressalis. Therefore, the interference sequence of the chilo suppressalis Male-specific genetic leader-3 (MSL3) gene can obviously inhibit the expression of the Male-specific leader-3 (MSL3) gene.

As shown in FIG. 2, the control group H₂Compared with O, dsRNA treatment by feeding Male-specific lethal-3(MSL3) geneThe death rate of chilo suppressalis of the group is improved by 34.2%; compared with EGFP dsRNA of a control gene, the death rate of chilo suppressalis fed by dsRNA of Male-specific lethal-3(MSL3) gene in the treatment group is improved by 23.3%. Therefore, the RNA interference sequence of the invention can be applied to the development of transgenic Chilo suppressalis resistant plants.

Sequence listing

<110> university of agriculture in Huazhong

<120> chilo suppressalis male specificity lethal associated protein MSL3, coding gene, dsRNA interference sequence and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 421

<212> PRT

<213> Chilo suppersalis

<400> 1

Met Lys Arg Ser Val Leu His Leu Arg Leu Arg Pro Val Cys Val Gly

1 5 10 15

Ser Val Cys Val Thr Thr Glu Gly Glu Thr Gly Asp Thr Asp Ser Ser

20 25 30

Gly Ser Gly Ser Gly Ser Ser Ser Ala Pro Arg Ser Pro Pro Pro His

35 40 45

Ala His Val Gly Arg Ala His Ile Ala Leu Pro Ser Ala Leu Arg Asp

50 55 60

Arg Leu Thr Phe Asp Tyr His Leu Val Val Lys Arg Gly Arg Leu Ser

65 70 75 80

Arg Leu Pro Ala Thr Pro Cys Ala Ala Glu Ile Leu Glu Ser Phe Val

85 90 95

Lys Trp Phe Ala Arg Ala Gly Ala Trp His Pro Ala Arg Ala Arg His

100 105 110

Asp Pro Pro Gln Arg Pro Asp Leu Leu Asp Val Ser Cys Arg Leu Asn

115 120 125

Leu Val Arg Glu Val Ala Asp Gly Leu Arg Val Tyr Phe Asp Phe Val

130 135 140

Leu Arg Gly His Leu Leu Tyr Lys Gln Glu Leu Ala Gln Tyr His Asp

145 150 155 160

Ile Cys Gly Gln Phe Leu Arg Asp Gln Glu Val Glu Thr Gly Ala Glu

165 170 175

Met Glu Glu Gly Thr Ala Ser Gln Glu Glu Ala Leu Glu Asp Asp Leu

180 185 190

Lys Ser Pro Lys Ile Pro Glu Tyr Ala His Leu Pro Pro Asp Pro Cys

195 200 205

Asp Ile Gly Asp Arg Asp Glu Thr Gly Lys Thr Ser Pro Leu Thr Asn

210 215 220

Asn Glu Glu Glu Pro Pro Lys Ala Asp Thr Glu Lys Ala Lys Gly Asp

225 230 235 240

Ser Cys Glu Glu Ser Asn Ser Thr Ala Cys Asn Gln Ser Lys Pro Arg

245 250 255

Glu Arg Ala Ala Ala Arg Pro Thr Leu Ala Arg Arg Leu Arg Ser His

260 265 270

Lys Ser Val Val Ser Gln Ser Glu Asn Glu Glu Pro Ala Pro Ser Thr

275 280 285

Ser Gly Glu Gln Arg Ala Phe Glu Thr Leu Ser Ser Ser Val Gly Ser

290 295 300

Ser Gly Ser Ser Leu Ser Glu Val Trp Ala Arg Pro Thr Arg Ala Pro

305 310 315 320

Ala Pro Ala Pro Ala Thr His Thr Pro Ala Arg Thr Pro Leu Ser Leu

325 330 335

Leu Leu Asp Lys Val Ala Lys Trp Gln Ile Ile Pro Arg Glu Gly Thr

340 345 350

Glu His Leu Pro Cys Arg Val Tyr Gly Ala Ile His Leu Ala Arg Leu

355 360 365

Phe Val Lys Leu Pro Asp Phe Leu Asn Ala Thr Gln Met Pro Asp Phe

370 375 380

Lys Leu Lys Leu Ile Leu Lys His Ile Asp Met Phe Val Gln Tyr Leu

385 390 395 400

Asp Glu His Asn Glu Trp Phe Gly Glu Met Tyr Tyr Val Ala Asp Asn

405 410 415

Met Ser Arg Ser His

420

<210> 2

<211> 4145

<212> DNA

<213> Chilo suppersalis

<400> 2

caaaaacaat gttggcacgc tcgtcgcctc tgatcactgt tttcatattt ataatattta 60

tccacatgtt tctagtttct atatagacac aacgtgtttt agttacttac aagtgctaat 120

tacatatgga ctaataactt aaattcagta gtgattttaa ttgaatattt tgaatattta 180

tttaattttt caaattaaaa ctgaacttaa ttgactgtgt taactatcct tttccagtcc 240

ttttattatt ttattgtaat tattaattat ttgcatgcaa ttaaaaaata tttttaatga 300

tgctaaagaa gtataacttc tcacgcgggt acataagtta cacgcatcca tttttttttt 360

aatctaattg tgacaaatta agctgtagaa aacaaaacca tagaattgaa acggatggcc 420

ggaatccacg ttttacgcca cctaatgtgt tctcaaaata tgacacgctc ggtttttata 480

caagttgaaa cacaggcgtc atctactagg tgaacaacgc acgagtcaaa accgcggcgg 540

atggaggtcg cgcggttgtt tatttgtttg cacataggta cgaaaactta ttcacatccg 600

tttaaccgcg cgggtgagcc atacaaataa catccgcgca gccgccatcc accgcggttc 660

gctgctcgtg cggtgtggca cttagcacca catacctaaa tttaagtaga acgaacgtgc 720

ttcaacttgt atgaaacgga gcgttcttca cctgagacta aggccggtgt gtgtaggcag 780

tgtgtgtgtg acgacagagg gcgaaaccgg cgacacggac tcgtcgggct ctggctcggg 840

ctccagctcg gcgccgcgct cgccgccgcc gcacgcgcac gtcggcaggg cacacatcgc 900

gctaccctcc gcgctcaggg atcgtctcac attcgactac cacctggtgg tgaagcgcgg 960

gcgtttatcc cggctgccgg cgacgccgtg cgccgcggag atcctcgagt cgttcgtaaa 1020

gtggtttgcg cgcgccggcg cctggcatcc ggcccgcgcg agacacgacc cgccacagcg 1080

gccggacttg ctggacgtgt cttgcaggtt gaacctagtc cgtgaggttg ccgacgggct 1140

gcgcgtttac ttcgacttcg tgctacgtgg tcatttactg tacaaacaag aactagcgca 1200

gtatcacgac atctgcggcc agttcttaag agatcaggaa gtggagacag gagcggaaat 1260

ggaagagggg acggcttctc aagaggaggc tttagaggat gacctaaaga gtcccaagat 1320

acctgaatac gcgcatctgc cgcctgatcc ctgtgacatt ggagaccgag atgaaacagg 1380

gaagacttca cctctgacaa ataacgaaga ggaaccaccg aaagcggaca cagagaaggc 1440

aaagggcgac tcgtgtgagg aatcgaactc tactgcttgc aaccaatcaa agccgcgaga 1500

aagggcggcg gctcgaccca cactcgctag aaggcttcgc tctcacaaat cggtggtgtc 1560

acagtccgag aacgaggaac cagcgccgtc aacgtccggc gagcaaagag catttgaaac 1620

cctatcttca agcgtgggca gcagcggatc atcattaagc gaagtgtggg cgcgtcccac 1680

ccgcgcgccc gcgcctgcgc ccgccaccca cacgcccgcg cggacgccgc tctccctgct 1740

gctggacaag gtagcgaaat ggcagattat accgcgagag ggcacagagc atttgccatg 1800

tcgcgtgtat ggtgcaattc atctggcgcg attattcgtg aaattaccag attttttaaa 1860

tgcgacgcag atgccagact tcaaactgaa actcatcttg aaacacattg atatgtttgt 1920

tcaatactta gatgaacaca atgaatggtt cggagagatg tactatgttg cagacaatat 1980

gtctcgatcg cattaatttt taagttaata atttttaatc cctatattgt aatctcacac 2040

tcgatcaggg ccgcatctag gggaggcatt atggcacatt gctctgctcc aataaatagc 2100

atcaatacca taaatacaac cctggctacg gctctgaact cattttataa catattttgt 2160

atacctaact atagtgtagt gtattagaca agacagtgtt tcaaaaatta cacgtcggtt 2220

taaaatgcat gctttcctaa attatagcat gaccacctca acatattata tgcagtaata 2280

tgcaacatat tttatatata tatgcataga tgtatctgcg aaaatttact gtcattgtat 2340

tttccctatt atcgtgttgg tcatgctacg tattagagag attagatatc aatgaatgaa 2400

tgcattagat ataacaaaca aagtccttta gttttctttt cgtagtggtg ctttctttgg 2460

gcatcgcaat tttttcccgc gataacaata gtgaaattta aggaaaaaat gcatttgtat 2520

gtaccgtccg taagtgatcc ccaatattgc ttttttaatc gcatttcata aaatatgtaa 2580

tgttaattta ggaataagat atgaaacgag tgacttgcta taagcctttg cctacaaaaa 2640

attaaacaga ttatagtgtt aaagattcaa ggtcatgaaa ataaaatatc ttaatttata 2700

aaatacatat tttaccaata ttctaaatca tgttaaaaat ttgcattatt tacataacac 2760

aacgttttta caaattggaa ggaattacta tatactatgt tgtttgttat ataaattaga 2820

ttaaataaaa acttaatgtt taattactac tcagcgaaag tattttgcta aaggaattgt 2880

ttctttttaa gtgtcgcaaa acgtttagtc caggcaacga aaaggtatag agggaaatgc 2940

ttagaacaca atttttgact tcgtaacttt gttaggacta gttaggaggt aaacatatca 3000

aaagtccccg cccgtagccc ttaagccggg gggaaggggg gggattgaag gtcccatttt 3060

taggtttttc gcatatattt cggaaactat gcatcctagc gacatgagac tttaacaaaa 3120

gtgaaagctg attaaaattg ctacaagtct tattatgtca agatttttga tatcctgtat 3180

agttttcaag atatccgctc ttgaaagtct gtattatgga aaaaaaaatt gcttcacatt 3240

tttgctctat ttgaccggat aactcttcaa caatgccggc cgtagggttg ttggttccac 3300

cagtgagcag catgcagatt tcggaccagc ccgccaaaac aaggatggag ctgacattgc 3360

caagctcacc gattggtttg agaaatttcc tcccttgcca gagaccagag acattatcaa 3420

gtcaccagaa atccagaaac cagcagcggt attttcacac cctttctcca ccaccactca 3480

agtaaaaaag gcaggtgaaa tctgcatctt aaggtggtat ggagctccag cgaaagagat 3540

ttccctcaat gcctacaggt acaactggta caagtcattc ttgaaatcag tggccaccat 3600

caagcctgat atctcttgtc ttcctcccac cgaggtagca gtaaaacagc attcccagga 3660

agtggtggca attttttttc cataattaca gactttcgaa agcggatatc tcgaaaacta 3720

tacaagatat caaaaaactt gactgaataa gacttgtttg actttaatca gctttcactt 3780

ttgtctcatg tcgctaggat gcatagtttc cgggatatac gcgaaaaacc taaaaaaggg 3840

accttcaatc ccccccttcc ccccggctta agggctacgg gcggggactt ttgatatgtt 3900

tacctcctaa ctagccctaa caaagttacg aagtcaaaaa ttgtgttcca agcatttccc 3960

tctatacctg tttttgagca ttcgttgcct ggactagttt ccaaacaata ttaataaaga 4020

atgatctcac tagcttagat tgtttagaat ataaaataga actgactacg cgctaggaat 4080

ccacggttta atttataagt atgtagttag tcgtaatgtt ttacttgata aagttatgag 4140

caaac 4145

<210> 3

<211> 1266

<212> DNA

<213> Chilo suppersalis

<400> 3

atgaaacgga gcgttcttca cctgagacta aggccggtgt gtgtaggcag tgtgtgtgtg 60

acgacagagg gcgaaaccgg cgacacggac tcgtcgggct ctggctcggg ctccagctcg 120

gcgccgcgct cgccgccgcc gcacgcgcac gtcggcaggg cacacatcgc gctaccctcc 180

gcgctcaggg atcgtctcac attcgactac cacctggtgg tgaagcgcgg gcgtttatcc 240

cggctgccgg cgacgccgtg cgccgcggag atcctcgagt cgttcgtaaa gtggtttgcg 300

cgcgccggcg cctggcatcc ggcccgcgcg agacacgacc cgccacagcg gccggacttg 360

ctggacgtgt cttgcaggtt gaacctagtc cgtgaggttg ccgacgggct gcgcgtttac 420

ttcgacttcg tgctacgtgg tcatttactg tacaaacaag aactagcgca gtatcacgac 480

atctgcggcc agttcttaag agatcaggaa gtggagacag gagcggaaat ggaagagggg 540

acggcttctc aagaggaggc tttagaggat gacctaaaga gtcccaagat acctgaatac 600

gcgcatctgc cgcctgatcc ctgtgacatt ggagaccgag atgaaacagg gaagacttca 660

cctctgacaa ataacgaaga ggaaccaccg aaagcggaca cagagaaggc aaagggcgac 720

tcgtgtgagg aatcgaactc tactgcttgc aaccaatcaa agccgcgaga aagggcggcg 780

gctcgaccca cactcgctag aaggcttcgc tctcacaaat cggtggtgtc acagtccgag 840

aacgaggaac cagcgccgtc aacgtccggc gagcaaagag catttgaaac cctatcttca 900

agcgtgggca gcagcggatc atcattaagc gaagtgtggg cgcgtcccac ccgcgcgccc 960

gcgcctgcgc ccgccaccca cacgcccgcg cggacgccgc tctccctgct gctggacaag 1020

gtagcgaaat ggcagattat accgcgagag ggcacagagc atttgccatg tcgcgtgtat 1080

ggtgcaattc atctggcgcg attattcgtg aaattaccag attttttaaa tgcgacgcag 1140

atgccagact tcaaactgaa actcatcttg aaacacattg atatgtttgt tcaatactta 1200

gatgaacaca atgaatggtt cggagagatg tactatgttg cagacaatat gtctcgatcg 1260

cattaa 1266

Claims

1. The application of the chilo suppressalis male specificity lethal related gene MSL3 in prevention and treatment of chilo suppressalis insects of the family of the borer moth is characterized by comprising the step of feeding the chilo suppressalis with interference dsRNA of the chilo suppressalis male specificity lethal related gene MSL3, wherein the chilo suppressalis male specificity lethal related gene MSL3 codes protein with an amino acid sequence shown as SEQ ID No. 1.

2. The application of the striped rice borer male specificity lethal related gene MSL3 in the prevention and treatment of striped rice borers in the family of the borer moth, according to claim 1, is characterized in that the nucleotide sequence of the striped rice borer male specificity lethal related gene MSL3 is shown in SEQ ID No. 2.

3. The application of the Chilo suppressalis male-specific lethal associated gene MSL3 in prevention and treatment of Chilo suppressalis insects of the family Caryopteraceae according to claim 1, wherein the interfering dsRNA is obtained by amplification of specific primers as follows:

upstream primer ds MSL 3-F: 5'-TTTGCCATGTCGCGTGTATG-3'

Downstream primer ds MSL 3-R: 5'-CCCAAAGAAAGCACCACTACG-3' are provided.