CN110527697A

CN110527697A - RNA based on CRISPR-Cas13a pinpoints editing technique

Info

Publication number: CN110527697A
Application number: CN201810503339.1A
Authority: CN
Inventors: 李轩; 荆新云; 张牛冰
Original assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Current assignee: Center for Excellence in Molecular Plant Sciences of CAS
Priority date: 2018-05-23
Filing date: 2018-05-23
Publication date: 2019-12-03
Anticipated expiration: 2038-05-23
Also published as: CN110527697B

Abstract

The fixed point rna editing technology based on CRISPR-Cas13a that the present invention relates to a kind of.Disclose a kind of RNA fixed point edit methods based on CRISPR-Cas13a.Method of the invention is when RNA is pinpointed and edited, and Cas13a mutant takes the editor that fixed point A to I is completed in the specified position RNA under the guidance of crRNA, by the catalyst structure domain of ADAR2.The Cas13a mutant without ssRNA cleavage activity, there is ssRNA to combine activity, and merged with the catalyst structure domain of adenine deaminase ADAR2.On this basis, the present invention also optimizes crRNA design.

Description

RNA based on CRISPR-Cas13a pinpoints editing technique

Technical field

The invention belongs to genetic modification technical fields, more particularly it relates to the RNA based on CRISPR-Cas13a Pinpoint editing technique.

Background technique

To most of organisms, hereditary information is RNA to be passed to from DNA, then pass to protein from RNA, to complete Control of the hereditary information to individual phenotype.It can be from DNA regulation, RNA regulation and protein regulation three to the regulation of bion Level is started with.Regulation for DNA and RNA the two levels has developed a variety of different technologies and operational instrument.For DNA Operating technology have: what 1) the Red albumen based on bacteriophage and Rac albumen were developed can operate in the bacterial strain of RecBCD- Red/ET DNA recombinant technique.2) the DNA recombinant technique mediated dependent on homing endonuclease (meganuclease). 3) the DNA editing technique based on locus specificity recombination, wherein more commonly used in microorganism is Flp/FRT and Cre/loxP Technology.4) it is based on CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) DNA editing technique.CRISPR is that the short palindrome in interval of regular cluster repeats, and is that one of most of bacteriums and archeobacteria obtain Obtain property immunization ways.CRISPR systematic research is had developed a series of based on CRISPR-cas9, the enzymes such as CRISPR-Cpf1 Gene editing tool.These edit tools make the gene editing to species such as microorganism, animal, plants become simple, easy Row.5) the DNA pointed decoration technology based on CRISPR.The technology loses cleavage activity using dCas9 but still retains it The feature of binding activity, adenine deaminase, cytosine deaminase and methylase is fused on dCas9 albumen, then Adenine is completed to hypoxanthine, cytimidine to thymidine, cytimidine first by the target position that crRNA brings it to DNA Base modification.This technology can complete the editor to DNA, modification the case where not cutting to DNA.

However, with the utilization of these DNA editing techniques, it has been found that they have, and operation is irreversible, grasps to important gene Make it is lethal, miss the target caused by toxic side effect it is big the disadvantages of.In order to solve short slab present in DNA control technique, this field is also opened Have issued for RNA control technique such as: 1) RNA interfere (RNA interference, RNAi) technology.RNA interference is by double Chain RNA induce homologous mRNA efficiently, the technology of selective degradation.RNA perturbation technique have efficiently, it is special and can propagate etc. excellent Gesture.2) RNA pinpoints base editing technique.The technology is that the catalytic subunit of adenine deaminase is fused to the N protein of bacteriophage On.Design has the crRNA of boxB, and the boxB on crRNA takes specific RNA in conjunction with λ N protein and by adenine deaminase Target position, and then complete the deamination reaction to specific site adenine.But the technology is mutually recruiting using double-stranded RNA To come the identification of completing target, therefore has the shortcomings that binding force is low, is easy to miss the target.

The discovery and research of VI type CRISPR system provide new approach for the exploitation of RNA operational instrument.Cas13 family Enzyme there is targeting, such as be used as in vitro from the LshCas13a albumen of cilium bacterium (Leptotrichia shahii) Detection of nucleic acids tool and internal RNA tracer tool；Another albumen of Cas13 family derives from general Salmonella (Prevotella Sp.P5-125 Cas13b) is used as fixed point editor this RNA of animal transcriptional.

However, it is still necessary to further improved genetic modification technologies for this field, to improve the efficiency of gene site-directed editor.

Summary of the invention

It is an object of the invention to overcome the deficiencies of the prior art and provide a kind of fixed point RNA based on CRISPR-Cas13a Editing technique.

In the first aspect of the present invention, the method for RNA fixed point editor based on CRISPR technology a kind of is provided, is included in RNA fixed point editor when, using Cas13a variant as nuclease, also, Cas13a variant described in (1) without ssRNA cleavage activity, There is ssRNA to combine activity；(2) the Cas13a variant described in is merged with the catalyst structure domain of adenine deaminase ADAR2.

In a preferred embodiment, the RNA fixed point editor based on CRISPR technology includes:

(a) fusion is prepared, coding Cas13a variant is merged with the catalyst structure domain of adenine deaminase ADAR2 Fusion protein；

(b) crRNA of preparation targeting target gene (is targeted to the sequence of binding site including cas13a and ADAR2 is edited Function is necessary, forms the matched sequence of editing sites double stranded region)；

(c) fusion and crRNA (b) that (a) is introduced in the cell that need to carry out gene editing, thus to cell Middle target gene carries out fixed point editor.

In another preferred example, the length of the crRNA is 20~100bp；Preferably 28~91bp；Or it is described Containing the base for the design of specific editing sites in crRNA, which is located on crRNA between the 15th~55, preferably On 18th~48.

In another preferred example, the Cas13a variant corresponds to wild type Cas13a, in its amino acid sequence the There are the mutation of amino acid residue, missing or insertions in 1250~1300, so that the Cas13a variant is cut without ssRNA Activity has ssRNA to combine activity；Preferably, the Cas13a variant corresponds to wild type Cas13a, in its amino acid sequence There are the mutation of amino acid residue, missing or insertions in 1260th~1290；Preferably, its amino acid sequence the 1270th~ There are the mutation of amino acid residue, missing or insertions in 1280；Preferably, in its amino acid sequence the 1278th, there are amino The mutation of sour residue.

In another preferred example, the catalyst structure domain of the adenine deaminase ADAR2 has overall length ADAR2 sequence The 299-701 amino acid sequences of (source of people, GenBank:U82120).

In another preferred example, in (2), the Cas13a variant is located at the N-terminal or C-terminal of fusion protein；Or

The catalyst structure domain of the adenine deaminase ADAR2 includes overall length adenine deaminase ADAR2 299-701 The amino acid sequence of position.

In another preferred example, the method for the efficiency of raising RNA fixed point editor does not include: to be to diagnose or treat The method of direct purpose.

In another aspect of this invention, a kind of fusion protein for the RNA fixed point editor based on CRISPR technology, packet Include the catalyst structure domain of Cas13a variant and adenine deaminase ADAR2；Also, the Cas13a variant is cut without ssRNA Activity has ssRNA to combine activity.

In a preferred embodiment, the Cas13a variant corresponds to wild type Cas13a, in its amino acid sequence the There are the mutation of amino acid residue, missing or insertions in 1250~1300, so that the Cas13a variant is cut without ssRNA Activity has ssRNA to combine activity；Preferably, the Cas13a variant corresponds to wild type Cas13a, in its amino acid sequence There are the mutation of amino acid residue, missing or insertions in 1260th~1290；Preferably, its amino acid sequence the 1270th~ There are the mutation of amino acid residue, missing or insertions in 1280；Preferably, in its amino acid sequence the 1278th, there are amino The mutation of sour residue.

In another preferred example, the catalyst structure domain of the adenine deaminase ADAR2 has full length sequence The 299-701 amino acid sequences of (GenBank accession number: U82120).

In another preferred example, the mutation sports alanine by arginine.

In another preferred example, the Cas13a variant is located at the N-terminal or C-terminal of fusion protein；Or

The catalyst structure domain of the adenine deaminase of the adenine deaminase ADAR includes adenine deaminase ADAR2 299-701 amino acid sequences.

In another preferred example, the Cas13a variant is located at the N-terminal of fusion protein.

In another preferred example, in the fusion protein, the catalysis knot of Cas13a variant and adenine deaminase ADAR2 It further include Linker sequence, the length is 3~40aa between structure domain.

In another aspect of this invention, a kind of polynucleotides are provided, aforementioned any fusion protein is encoded.

In another aspect of this invention, a kind of recombinant plasmid is provided, it includes the polynucleotides.

In another aspect of this invention, a kind of host cell is provided, it includes in the recombinant plasmid or its genome Integrate the excellent polynucleotides.

In another aspect of this invention, the front any fusion protein or its encoding gene are provided or melted containing this The purposes of the plasmid of hop protein pinpoints editorial efficiency for improving the RNA based on CRISPR technology.

In a preferred embodiment, the purposes does not include: to diagnose or treat as the purposes of direct purpose.

In another aspect of this invention, a kind of plasmid edited for carrying out the RNA fixed point based on CRISPR technology is provided, The element being operatively connected including the following group: promoter has the leader that can be cut away by self；The DR sequence of Cas13a； CrRNA occupy-place sequence；Ribozyme with 5 ' end cutting functions.

In a preferred embodiment, the promoter is the three type promoters of fission yeast, the crRNA occupy-place sequence For restriction enzyme site.

In another preferred example, for introducing crRNA, the crRNA sequence in the cell that need to carry out gene editing Accurately.

In another aspect of this invention, it provides a kind of for carrying out the reagent of the RNA fixed point editor based on CRISPR technology Box, including any fusion protein in front, the polynucleotides or the recombinant plasmid.

It in a preferred embodiment, further include described in the kit for carrying out the RNA fixed point based on CRISPR technology The plasmid of editor.

Other aspects of the invention are apparent to those skilled in the art due to this disclosure 's.

Detailed description of the invention

Fig. 1, dCas13a-hADAR2d expression vector establishment schematic diagram.

Fig. 2, modified enhanced green fluorescent protein eGFPW58X expression vector construct schematic diagram.

Fig. 3, modified enhanced green fluorescent protein eGFPW58X gene and crRNA expression vector establishment schematic diagram.

Fig. 4, Tf1 mutant and crRNA expression vector establishment schematic diagram.

Fig. 5, the RNA fixed point editing technique based on Crispr-Cas13a are used to restore the green fluorescence protein gene of mutation Transcript.

Fig. 6, the RNA fixed point editing technique based on Crispr-Cas13a are used for the transcription of fission yeast endogenous gene tdh1 This editor.

Fig. 7, the RNA fixed point editing technique based on Crispr-Cas13a have restored turning for fission yeast retrotransposon Seat function.

In each attached drawing, " gRNA " is equal to " crRNA ".

Specific embodiment

The present inventor passes through in-depth study, discloses a kind of RNA fixed point edit methods based on CRISPR-Cas13a. When RNA is pinpointed and edited, using Cas13a variant as nuclease, which cuts without ssRNA and lives method of the invention Property, there is ssRNA to combine activity, and merged with the catalyst structure domain of adenine deaminase ADAR2.On this basis, of the invention Also optimize the plasmid etc. of RNA fixed point editor.

As used herein, described " being operatively connected " or " operability be connected " refer to two or more nucleic acid regions or Functional space arrangement of nucleic acid sequence.Such as: promoter region is placed in the certain bits relative to target gene nucleic acid sequence It sets, so that guidance of the transcription of nucleic acid sequence by the promoter region, thus, promoter region is " operably connected " In the nucleic acid sequence.

As used herein, " element " refers to a series of useful functional nucleic acid of some expression for albumen Sequence, the present invention in, " element " is systematically constructed to form a kind of expression construct.The sequence of " element " Those of can be provided in the present invention, it also include their variant, as long as these variants substantially remain the " member The function of part " by insertion or deletes some base (such as 1-50bp；Preferably 1-30bp, more preferably 1-20bp, more preferably 1-10bp), or random or rite-directed mutagenesis etc. is carried out to obtain.

As used herein, " target gene " refers to an endogenous gene on genome, is interested base Cause namely its be the object of gene editing.

As used herein, described " guiding RNA (crRNA) sequence " is reversed mutually complementary with by editing sites targeting sequence A Duan Xulie.It include cas13a is targeted to binding site sequence and ADAR2 editting function it is necessary, formed edit bit The matched sequence of point double stranded region.CrRNA based on the design can help dCas13a to identify target sequence, and take hADAR2d to this Target position, and double-stranded RNA required for editing sites is provided, instruct hADAR2d to complete the fixed point editor to rna editing.Compared with Goodly, single guiding RNA target sequence length is 20~100bp；Preferably 28~91bp.

The present invention is based on the effect protein Cas13a of VI type CRISPR family, which, which has, combines and cuts ssRNA Function, be prepared for the mutant (dCas13a) of Cas13a on this basis, mutant loss ssRNA cleavage activity but It remains ssRNA and combines activity.

The present invention has also selected a kind of adenine deaminase (ADAR2), which has gland on Catalytic RNA molecules fast Purine deamination simultaneously generates hypoxanthic function.The present inventor has cut away the RNA binding structural domain of the ADAR2 enzyme, and it is fast only to retain gland The catalyst structure domain (ADAR2d) of purine deaminase.Preferably, the RNA binding structural domain cut away is located at the 1-500 amino of ADAR2 Between acid.

The present invention provides a kind of for improving the fusion protein of the RNA fixed point editorial efficiency based on CRISPR technology, RNA binding structural domain including Cas13a variant and adenine deaminase ADAR2；Also, the Cas13a variant is without ssRNA Cleavage activity has ssRNA to combine activity.

As preferred embodiment of the invention, the Cas13a variant corresponds to wild type Cas13a, in its amino acid sequence Arrange in the 1250th~1300 that there are the mutation of amino acid residue, missing or insertions, so that the Cas13a variant is without ssRNA Cleavage activity has ssRNA to combine activity.

It can be connected directly between the RNA binding structural domain of the Cas13a variant and adenine deaminase ADAR2, Or it is connected by polypeptide linker (Linker).Pass through Linker as a kind of preferred mode of the invention, between them Connection.The connexon includes that length is 3~40aa amino acid；Such as 4,6,10,15,20,25,30,35aa.

As a preferred mode, the Cas13a variant is located at the N-terminal of fusion protein；The adenine deamination The RNA binding structural domain of enzyme ADAR2 is located at the C-terminal of fusion protein.Selectively, also the location of interchangeable two kinds of albumen.

On the other hand, the present invention also provides the isolated nucleic acid of the coding fusion protein, it is also possible to its complementation Chain.The DNA sequence dna for encoding fusion protein of the present invention, can be artificial synthesized with complete sequence, it is also possible to which the method for PCR amplification obtains respectively The DNA sequence dna for encoding TAT and LPTS amino acid, is then stitched together, and the DNA sequence for encoding fusion protein of the present invention is formed Column.

After obtaining the DNA sequence dna for encoding fusion protein of the present invention, it is connected into suitable expression vector, then be transferred to Suitable host cell.Therefore, the present invention also provides the carriers of the nucleic acid molecules comprising encoding said fusion protein.Described Carrier also may include the expression regulation sequence being connected with the series of operations of the nucleic acid molecules, in order to the fusion protein Expression.A variety of suitable carriers can use, for example, it is some for bacterium, fungi, yeast and mammalian cell clone With the carrier of expression.For example commercially available carrier of various carriers known in the art can be selected.For example, selecting commercially available carrier, then The nucleotide sequence of the new fusion protein of the coding present invention is operably coupled to expression regulation sequence, forms protein expression vector.

In addition, the recombinant cell of the nucleic acid sequence containing encoding said fusion protein is also included in the present invention.In this hair In bright, term " host cell " includes prokaryotic cell and eukaryocyte.Common prokaryotic host cell includes Escherichia coli, withered grass Bacillus etc..Common eukaryotic host cell includes yeast cells, insect cell and mammalian cell.In preferred reality of the invention It applies in mode, using yeast cells as host cell.It should be understood that the present invention is not limited to the cells defined in embodiment.

In a preferred embodiment of the invention, using fission yeast (Schizosaccharomyces pombe) as one kind Host studies.It is a kind of unicellular eukaryote.Compared with saccharomyces cerevisiae, fission yeast has more similar animals thin The conservative biochemical route of born of the same parents, becomes one mode system.Make scientists in cell cycle regulating, dye the research of fission yeast Chromatin structure, histone modification, cell division etc. achieve important progress.Meanwhile it being developed in yeast some new Genetic manipulation tool be also that tremendous influence has been made in the reach of science.But there is presently no can be inside fission yeast Carry out the tool of fixed point rna editing.Therefore, of the invention that editor's transcription is pinpointed based on the Cas13 enzyme of VI type CRISPR system The tool of group can make up the loophole of this respect using the bad yeast of growing as research tool.

The purposes of fusion protein of the present invention or its encoding gene or the plasmid containing the fusion protein, can be used for It improves the RNA based on CRISPR technology and pinpoints editorial efficiency.

For the compound of CRISPR-Cas13a and crRNA when combining target sequence, crRNA is with one to mispairing Very sensitive region (" seed region "), crRNA and it is non-target between mispairing make CRISPR-Cas13a's and crRNA Compound is very low with the binding force of non-target sequence.Just because of spy of the crRNA in conjunction with target sequence of CRISPR-Cas13a The opposite sex enables the fixed point rna editing technology of the invention based on CRISPR-Cas13a with higher specific, lower It misses the target efficiency.

The compound and target sequence of the CRISPR-Cas13a (being configured to fusion protein) and crRNA that optimize in the present invention Binding force (KD~7nM) is bigger than the binding force (KD~9nM) of independent crRNA and target sequence.This characteristic makes of the invention Fixed point rna editing technology based on CRISPR-Cas13a can editorial efficiency with higher.

Fixed point rna editing technology of the invention can correct into the cell the albumen of mutation in fission yeast, edit multicopy Gene, the diploid phenotype for manufacturing haploid cell etc..

The fixed point rna editing technology based on CRISPR-Cas13a of being somebody's turn to do of the invention has restored yeast retrotransposon Tf1 Transposition activity.The subsequent technology can also be used to be operated and interfered the research of reverse transcription RNA virus, be RNA virus Research provides an effective tool.

The present invention also optimizes the fixed point of the RNA based on CRISPR-Cas13a editor and retrotransposon perturbation technique.This The three type promoters of a fission yeast have been selected in invention, and the RNA which goes out has one section of leader can be by certainly I cuts away.The DR sequence of CRISPR-Cas13a is followed by the promoter and leader.It is accessed after DR sequence CrRNA occupy-place sequence (place holder with BspQI), crRNA can be connected into BspQI restriction enzyme site.It is inserted in crRNA Enter to have connect the ribozyme that can be cut to the 5 ' ends of oneself behind position.The purpose of the design is to generate and have The crRNA of exact sequence.

In a preferred embodiment of the invention, as above change is carried out using pBluescript sk carrier as skeleton plasmid It makes.For the ease of genetic manipulation, preferably, the 1032nd base T of the carrier is also sported base A, by 2114 base A Bases G is sported, pBluescript sk carrier B spQI and BsaI restriction enzyme site is destroyed and is mutated.Used in of the invention most Good crRNA length is between 28-91bp.Base on the corresponding crRNA of editing sites A of the present invention is best on crRNA Position is between 18-48.

Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip Part such as J. Pehanorm Brooker etc. is write, Molecular Cloning:A Laboratory guide, the third edition, Science Press, condition described in 2002, or According to the normal condition proposed by manufacturer.

Embodiment 1, the RNA fixed point editing technique based on Crispr-Cas13a are used to restore the green fluorescent protein of mutation Gene transcripts

One, in fission yeast cell inner expression dCas13a-hADAR2d fusion protein

1, the pDUAL-HFF1-dCas13a-hADAR2d carrier of building expression dCas13a-hADAR2d fusion protein

In following embodiment, the Cas13a variant is known as " dCas13a ", corresponds to its amino acid sequence the 1278th It mutates.

With method for synthesizing gene (Jin Weizhi) synthesis dCas13a-hADAR2d fusion protein, (dCas13a coded sequence is located at 5 ' ends) gene, which includes yeast linker sequence (underscore part), and sequence is following (SEQ ID NO:1):

In above-mentioned sequence, base is mutant site base in wire, and underscore is linker sequence.Wherein 1-1389 Position is dCas13a sequence, and 1406-1808 are hADAR2d sequence.

It utilizes NdeI and NcoI digestion pDUAL-HFF1 plasmid (RIKEN BRC (RDB:6179)).37 DEG C digestion 30 minutes, Glue recycles segment.The gene order of fusion protein is connect with the plasmid through digestion, obtains recombination pDUAL-HFF1-dCas13a- HADAR2d carrier constructs process such as Fig. 1.

2, conversion pDUAL-HFF1-dCas13a-hADAR2d plasmid is into fission yeast

PDUAL-HFF1-dCas13a-hADAR2d plasmid is cut using NotI, 370C, 30 minutes, it is large stretch of that glue recycles DNA Section.Linear pDUAL-HFF1-dCas13a-hADAR2d segment is converted into fission yeast.500ng is converted with the method for lithium acetate The fission yeast cell at linear pDUAL-HFF1-dCas13a-hADAR2d segment logarithmic growth initial stage, and make dCas13a- HADAR2d fusion is integrated into the site leu1 of Yeast genome.

3, dCas13a-hADAR2d fusion protein is expressed

In the present embodiment, using MM culture medium culture fission yeast, it is made to express dCas13a-hADAR2d fusion protein.

Two, in fission yeast cell inner expression eGFPW58X gene

The amplification of 1.Over-lap PCR method obtains eGFPW58X gene

A. GFPW58X gene 5 ' segment is expanded

EGFP-P5 (ATCATGCTAGCGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGT (SEQ ID NO:2)): 1 μ L；

EGFP-mut-P3 (TCAGGGTGGTCACGAGGGTGGGCTAGGGCACGGGCAGCTTGC (SEQ ID NO:3)): 1μL；

PCR reaction is carried out, is obtained amplified production (GFPW58X gene 5 ' segment).

B. 3 ' segment of GFPW58X gene is expanded

eGFP-mut-P5(ACCGGCAAGCTGCCCGTGCCCTAGCCCACCCTCGTGACCACCCTGA(SEQ ID NO: 4)): 1 μ L；

EGFP-P3 (TGTAGTCAGATCTTATCCGGACTTGTACAGCTCGTCCATG (SEQ ID NO:5)): 1 μ L；

PCR reaction is carried out, is obtained amplified production (3 ' segment of GFPW58X gene).

C.Overlap-PCR expands complete eGFPW58X gene

EGFP-P5 (AAGCTCTAGAGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGT (SEQ ID NO:6)): 1 μ L；

EGFP-P3 (TTCGAGCTCAGATCTTTATCCGGACTTGTACAGCTCGTCCATG (SEQ ID NO:7)): 1 μ L；

PCR reaction is carried out, is obtained amplified production (eGFPW58X gene).

2.NheI/BglII digestion eGFPW58X gene PCR product.

3.NheI and BglII digestion pDUAL-HFF1 plasmid.

4. the pDUAL-HFF1 plasmid after digestion is attached with the eGFPW58X gene after digestion, recombination pDUAL- is obtained HFF1-eGFPW58X plasmid constructs process such as Fig. 2.

PDUAL-HFF1-eGFPW58X plasmid is converted into fission yeast cell, to express eGFPW58X base in the cell Cause.

Three, in the crRNA of the CRISPR-Cas13a of fission yeast cell inner expression targeting eGFPW58X gene transcripts

1, pSK-crRNA- skeleton plasmid is constructed

It is basic plasmid with pBluescript sk carrier, artificial synthesized sequence is inserted into its ClaI/EcoRV such as Under: TTTTGCTTATGTTGGTGGTAGTTGGCATGCGTAGACTGATGACTAGTCAGCAAGGA GCGTAGAACAGTCACAC TCGTTATATATGTGCTTCCAAGAAAACTCAAGAATTTACCATTAGCAAACACTTTTTTGAAATGTTAGACATTTAA ATGACGAAGGCATATAGAAGCTTTGAATAGGTGTTGTAAAGTGTTGATTTATGTGACGCTGAGGGTGCGCATGAAA GGAATGTTGGGTCACGATTATTAAACAGTTTGCTAGCTTGGACACTTGAGTATTGGAAGTTGTTGAATTCTAAAAA ACTTTCAGTTGATTTGAATAGTTGCTGTTGCCAAAAAACATAACCTGTACCGAAGAAccaccccaatatcgaaggg gactaaaacAGAAGAGCTGAATTCAGCTCTTCAGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAA CATGCTTCGGCATGGCGAATGGGACagagacctgaattcaggtctcaCCTGTCACCGGATGTGCTTTCCGGTCTGA TGAGTCCGTGAGGACGAAACAGG(SEQ ID NO:8)

In above-mentioned sequence, the 1-358 three type promoters (containing leader sequence) for fission yeast, the promoter turns There is the RNA recorded out one section of leader can be cut away by self；The 359-386 DR (weights in the same direction for CRISPR-Cas13a It is multiple) sequence.After DR sequence, 387-410 are crRNA occupy-place sequence (place holder with BspQI), crRNA BspQI restriction enzyme site can be connected into；After the insertion position crRNA, 411-478 carry out for that can hold to oneself 5 ' The ribozyme of cutting.Meanwhile 1032 base T on pBluescript sk carrier are sported into base A with point mutation kit, 2114 base A are sported into bases G, destroy BspQI the and BsaI digestion position of corresponding position on pBluescript sk carrier Point.Obtain pSK-crRNA- skeleton plasmid.

2, the primer of the crRNA (crRNA (eGFPW58X)) of design targeting eGFPW58X gene, the following (capital letter of sequence Matrix shows crRNA sequence):

eGFPW58X-crRNA-P5:aacGGTGGTCACGAGGGTGGGCCAGGGCACGGGCAG CTTGCCGGTGGTG CAGATGAACTTCAGGGTCA(SEQ ID NO:9)

eGFPW58X-crRNA-P3:gccTGACCCTGAAGTTCATCTGCACCACCGGCAAGCT GCCCGTGCCCTGGCCCACCCTCGTGACCACC(SEQ ID NO:10)

3, plasmid pSK-crRNA (eGFPW58X) is constructed, the specific operation method is as follows:

A., eGFPW58X-crRNA-P5 and eGFPW58X-crRNA-P3 primer is dissolved into 10 μM of mother liquor with water, is respectively taken 10 μ L addition, 80 0.5 × TE of μ L (PH8.0) are inner, and final concentration of 1 μM；It is placed on handling 3 minutes for 98 DEG C in PCR instrument, it is natural It is cooled to room temperature.

B.BspQI digestion pSK-crRNA- skeleton plasmid.

C. the pSK-crRNA- skeleton carrier after digestion is connect with eGFPW58X crRNA primer after annealing.22 DEG C of connections 30min, conversion generate pSK-crRNA (eGFPW58X).

4, the expression cassette of target crRNA is cloned on yeast pDUAL-HFF1-eGFPW58X carrier, generates pDUAL- HFF1-eGFPW58X-crRNA (eGFPW58X):

The expression cassette of A.PCR amplification target crRNA: with pSK-crRNA (eGFPW58X) for template, with pDUAL-SpeI- T3 (CGCTAGGGATAACAGGGTAATATAATTAACCCTCACTAAAGG (S EQ ID NO:11)) and pDUAL-PspXI-T7 (CCTCCAATCTTGTGTTCTTCAAATAATACG ACTCACTATAGG (SEQ ID NO:12)) is primer, carries out PCR expansion Increase, obtains the crRNA expression cassette of targeting eGFPW58X gene.

B.SpeI/PspXI digestion pDUAL-HFF1-eGFPW58X carrier.Glue recycles segment.

C. homologous recombination is reacted:

37 DEG C of connection 30min, conversion generate pDUAL-HFF1-eGFPW58X-crRNA (eGFPW58X), and building process is such as Fig. 3.

5, conversion pDUAL-HFF1-eGFPW58X-crRNA (eGFPW58X) plasmid is to fission yeast (containing integrant expression DCas13a-hADAR2d in).100ng pDUAL-HFF1-eGFPW58X-crRNA is converted with the method for lithium acetate (eGFPW58X) plasmid makes plasmid is free to exist to the fission yeast cell at logarithmic growth initial stage.

Four, fission yeast cell is cultivated, the editorial efficiency of the particular bases A of target spot RNA is detected

1, the transgenosis of 32 DEG C of MM culture medium culture integrant expression dCas13a-hADAR2d, free expression crRNA- target Fission yeast cell makes it reach logarithmic growth phase.

2, fission yeast cell is collected by centrifugation.

3, Qiagen kit extracts RNA, carries out RT-PCR and expands target sequence；Reverse transcription obtains cDNA；And then to draw Object eGFP-RT-p5 (CAAGGGCGAGGAGGATAACA) and eGFP-RT-p3 (AACTCCA GCAGGACCATGTGAT) amplification, Obtain amplified production.

4. sequencing calculates the efficiency of rna editing according to peak height.

The calculation method of rna editing efficiency is the corresponding peak height H of specific position base A in measurement sequencing peak figure_A, bases G Corresponding peak height H_G.Calculate H_G/(H_G+H_A) ratio be editorial efficiency.

Negative control is eGFPW58X gene transcripts sequencing peak figure in the present embodiment, and positive control is that eGFP gene transcripts are surveyed Sequence peak figure.Experimental group is eGFPW58X gene transcripts after dCas13a-hADAR2d and crRNA collective effect, and RT-PCR is surveyed Sequence peak figure, as shown in Figure 5.Negative control includes the only negative control of dCas13a, only the negative control of hADAR2d and is had Three kinds of negative controls such as dCas13a-hADAR2d.The experimental results showed that individual dCas13a, hADAR2d, dCas13a-hADAR2d Cannot allow editor eGFPW58X gene transcripts, only dCas13a-hADAR2d and crRNA it is common in the presence of, eGFPW58X base Because transcript can be edited.

Embodiment 2, the RNA fixed point editing technique based on Crispr-Cas13a turn for fission yeast endogenous gene tdh1 Record is originally

One, in fission yeast cell inner expression dCas13a-hADAR2d fusion protein

Using such as identical method of embodiment 1, in fission yeast cell inner expression dCas13a-hADAR2d fusion protein.

Two, in the crRNA of the CRISPR-Cas13a of fission yeast cell inner expression targeting tdh1 gene transcripts

1. the primer of the crRNA of design targeting tdh1 gene, sequence is following (capitalization indicates crRNA):

tdh1-crRNA-P5:aacGAATTGCCATTTTGAATCAAGTGTAAATCAATACCATGG ATGAATGATCTATACAGAAGCGATGC(SEQ ID NO:13)；

tdh1-crRNA-P3:gccGCATCGCTTCTGTATAGATCATTCATCCATGGTATTGAT TTACACTTGATTCAAAATGGCAATTC(SEQ ID NO:14)；

2. constructing plasmid pSK-crRNA (tdh1), the specific operation method is as follows:

A., tdh1-crRNA-P5 and tdh1-crRNA-P3 primer is dissolved into 10 μM of mother liquor with water, 10 μ L is respectively taken to be added 80 0.5 × TE of μ L (PH8.0) are inner, and final concentration of 1 μM；It is placed on handling 3 minutes for 98 DEG C in PCR instrument, naturally cools to room Temperature.

B.BspQI digestion pSK-crRNA- skeleton plasmid.

C. the pSK-crRNA- skeleton carrier after digestion is connect with tdh1crRNA primer after annealing.22 DEG C of connections 30min, conversion generate pSK-crRNA (tdh1).

3. the expression cassette of target crRNA is cloned on yeast pDUAL-HFF1 carrier, pDUAL-HFF1- is generated eGFPW58X-crRNA-(tdh1)。

The expression cassette of A.PCR amplification target crRNA: with pSK-crRNA (tdh1) for template, with pDUAL-SpeI-T3 (C GCTAGGGATAACAGGGTAATATAATTAACCCTCACTAAAGG (SEQ ID NO:15)) and pDUAL-PspXI-T7 (CCTCCAATCTTGTGTTCTTCAAA TAATACGACTCACTATA GG (SEQ ID NO:16)) is primer, is targeted The crRNA expression cassette of tdh1 gene.

B.SpeI/PspXI digestion pDUAL-HFF1 carrier.Glue recycles segment.

C. homologous recombination is reacted.

37 DEG C of connection 30min, conversion generate pDUAL-HFF1-crRNA-tdh1.

4. converting pDUAL-HFF1-crRNA (tdh1) plasmid to fission yeast (dCas13a-ADARD containing integrant expression) In.The fission yeast of 100ng pDUAL-HFF1-crRNA (tdh1) plasmid to logarithmic growth initial stage is converted with the method for lithium acetate Cell makes plasmid is free to exist.

Three, fission yeast cell is cultivated, the editorial efficiency of the particular bases A of target spot RNA is detected

The transgenosis of 32 DEG C of 1.MM culture medium culture integrant expression dCas13a-hADAR2d, free expression crRNA- target Fission yeast cell makes it reach logarithmic growth phase.

2. fission yeast cell is collected by centrifugation.

3.Qiagen kit extracts RNA, does RT-PCR amplification target sequence；Reverse transcription obtains cDNA；And then with primer Tdh1-79-RT-p5 (TGCCTAGCATCGCTTCTGTA (SEQ ID NO:17)) and tdh1-79-RT-p3 (CATCAATGACGAGCTTACCAT (SEQ ID NO:18)) amplification, obtains amplified production.

Peak figure such as Fig. 6 (position of asterisk mark is 79) institute is sequenced in tdh1 gene transcripts RT-PCR in the present embodiment Show, the editorial efficiency of 79 bit base A to G of the tdh1 gene transcripts is 59%.

Embodiment 3, the RNA fixed point editing technique based on Crispr-Cas13a are for restoring fission yeast retrotransposition The swivel base function of son

One, in fission yeast cell inner expression dCas13a-hADAR2d fusion protein

Two, in the retrotransposon TF1 (G1165A) of fission yeast cell inner expression mutation

The amplification of 1.Over-lap PCR method obtains Tf1 (G1165A) gene

A. Tf1 (G1165A) gene 5 ' segment is expanded

With pHL414 (Professor Henry L.Levin ' s lab) for template, with TF1-XhoI-nmt1-P5 (ATC ATCATATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGT (SEQ ID NO:19)) and Tf1-1165-mutant-P3 (TCAGGGTGGTCACGAGGGTGGGCTAGGGCACGGGCAG C TTGCCGGT (SEQ ID NO:20)) is primer, is carried out PCR amplification obtains Tf1 (G1165A) gene 5 ' segment.

B. using pHL414 as template, Tf1-1165-mutant-P5 (ACCGGCAAGCTGCCCGTGC CCTAGCCCACCCTCGTGACCACCCTGA (SEQ ID NO:21)) and neo-P3 (TGT AGTCCATGGTTATCCGGACTT GTACAGCTCGTCCATG (SEQ ID NO:22)) it is primer, PCR amplification is carried out, amplification 3 ' piece of Tf1 (G1165A) gene is obtained Section.

C.Overlap-PCR expands complete Tf1 (G1165A) gene.

TF1-XhoI-nmt1-P5(ATCATCATATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGT(SEQ ID NO:23)): 1 μ L；

neo-P3(TGTAGTCCATGGTTATCCGGACTTGTACAGCTCGTCCATG(SEQ ID NO:24))1μL；

PCR reaction is carried out, is obtained amplified production (Tf1 (G1165A) gene).

2.XhoI digestion pHL414 plasmid.

3. homologous recombination connection reaction, the pHL414 plasmid after digestion is connect with Tf1 (G1165A) gene.370C connection 30min, conversion generate pHL414-Tf1 (G1165A).

PHL414-Tf1 (G1165A) plasmid is converted into fission yeast cell, to express Tf1 (G1165A) in the cell Gene.

Three, the CRISPR-Cas13a's of fission yeast cell inner expression targeting Tf1 (G1165A) gene transcripts crRNA

1. the primer of the crRNA of design targeting Tf1 (G1165A) gene, sequence is following (capitalization is crRNA sequence):

Tf1(G1165A)-crRNA-P5:aacTGTCGTTCTCCTTTAAAAACTTATTGTTTTTCCA ATTGCTTCCAGTCTTTGTTTTTAAAAGATTC(SEQ ID NO:25)

Tf1(G1165A)-crRNA-P3:gccGAATCTTTTAAAAACAAAGACTGGAAGCAATTG GAAAAACAAT AAGTTTTTAAAGGAGAACGACA(SEQ ID NO:26)

2. constructing plasmid pSK-crRNA (Tf1 (G1165A)), the specific operation method is as follows.

A., Tf1 (G1165A)-crRNA-P5 and Tf1 (G1165A)-crRNA-P3 primer is dissolved into 10 μM of mother with water Liquid respectively takes 10 μ L addition, 80 0.5 × TE of μ L (PH8.0) inner, and final concentration of 1 μM；It is placed on handling 3 points for 98 DEG C in PCR instrument Clock, cooled to room temperature.

B.BspQI digestion pSK-crRNA- skeleton plasmid.

C. the pSK-crRNA- skeleton carrier after digestion is connect with Tf1 (G1165A) crRNA primer after annealing.22 DEG C of companies 30min is met, conversion generates pSK-crRNA (Tf1 (G1165A)).

3. the expression cassette of target crRNA is cloned on yeast pHL414-Tf1 (G1165A) carrier, pHL414- is generated Tf1 (G1165A)-crRNA (Tf1 (G1165A)):

The expression cassette of A.PCR amplification target crRNA: with pSK-crRNA (Tf1 (G1165A)) for template, with pDUAL- SpeI-T3 (CGCTAGGGATAACAGGGTAATATAATTAACCCTCACTAAAGG (SEQ ID NO:27)) and pDUAL- PspXI-T7 (CCTCCAATCTTGTGTTCTTCAAATAATACGACTCACTATAGG (SEQ ID NO:28)) is primer, is carried out PCR amplification obtains the crRNA expression cassette of targeting Tf1 (G1165A) gene.

B.NheI digestion pHL414-Tf1 (G1165A) carrier.

C. by pHL414-Tf1 (G1165A) plasmid after digestion, (the crRNA expression cassette of G1165A gene connects with targeting Tf1 It connects.22 DEG C of connection 30min, conversion generate pHL414-Tf1 (G1165A)-crRNA (Tf1 (G1165A)), and building process is as schemed 4。

7. converting pHL414-Tf1 (G1165A)-crRNA (Tf1 (G1165A)) plasmid to fission yeast (contains integrant expression DCas13a-hADAR2d) in.100ng pHL414-Tf1 (G1165A)-crRNA (Tf1 is converted with the method for lithium acetate (G1165A)) plasmid makes plasmid is free to exist to the fission yeast cell at logarithmic growth initial stage.

2. fission yeast cell is collected by centrifugation.

3.Qiagen kit extracts RNA, does RT-PCR amplification target sequence；Reverse transcription obtains cDNA；And then with primer Tf1-RT-p5(AtccaactaggtttaccattcttcttaatagttcatccCaagtaagagaagaa tcttgacaaaag (SEQ ID NO:29)) and Tf1-RT-p3 (tcgagcacataaacttcctaccagaccttGgttaca aagtgtgatatacggtggagtttatccaa(SEQ ID NO:30)) amplification, obtain amplified production.

As a result such as Fig. 7, negative control expression is having dCas13a-hADAR2d, when not having crRNA, from tf1-1165 (G-A) base Because can be seen that negative control at 1165 sites (black asterisk) without the generation of rna editing phenomenon in the sequencing peak figure of transcript. Experimental group indicate dCas13a-hADAR2d and crRNA all in the presence of, the sequencing peak figure of tf1-1165 (G-A) gene transcripts It is above it can be seen that apparent bimodal (red asterisk) in 1165 sites, that is, rna editing, editorial efficiency 48.2% has occurred.Together When detection negative control and positive control in, the swivel base situation of tf1-1165 (G-A), the results showed that there is no swivel bases for negative control, and Apparent swivel base, transposition efficiency 1.65x10 has occurred in sample group^-4。

All references mentioned in the present invention is incorporated herein by reference, independent just as each document It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims It encloses.

Sequence table

<110>Shanghai Inst. of Life Science, CAS

<120>RNA based on CRISPR-Cas13a pinpoints editing technique

<130> 183384

<160> 30

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1808

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 1

Met Gly Asn Leu Phe Gly His Lys Arg Trp Tyr Glu Val Arg Asp Lys

1 5 10 15

Lys Asp Phe Lys Ile Lys Arg Lys Val Lys Val Lys Arg Asn Tyr Asp

20 25 30

Gly Asn Lys Tyr Ile Leu Asn Ile Asn Glu Asn Asn Asn Lys Glu Lys

35 40 45

Ile Asp Asn Asn Lys Phe Ile Arg Lys Tyr Ile Asn Tyr Lys Lys Asn

50 55 60

Asp Asn Ile Leu Lys Glu Phe Thr Arg Lys Phe His Ala Gly Asn Ile

65 70 75 80

Leu Phe Lys Leu Lys Gly Lys Glu Gly Ile Ile Arg Ile Glu Asn Asn

85 90 95

Asp Asp Phe Leu Glu Thr Glu Glu Val Val Leu Tyr Ile Glu Ala Tyr

100 105 110

Gly Lys Ser Glu Lys Leu Lys Ala Leu Gly Ile Thr Lys Lys Lys Ile

115 120 125

Ile Asp Glu Ala Ile Arg Gln Gly Ile Thr Lys Asp Asp Lys Lys Ile

130 135 140

Glu Ile Lys Arg Gln Glu Asn Glu Glu Glu Ile Glu Ile Asp Ile Arg

145 150 155 160

Asp Glu Tyr Thr Asn Lys Thr Leu Asn Asp Cys Ser Ile Ile Leu Arg

165 170 175

Ile Ile Glu Asn Asp Glu Leu Glu Thr Lys Lys Ser Ile Tyr Glu Ile

180 185 190

Phe Lys Asn Ile Asn Met Ser Leu Tyr Lys Ile Ile Glu Lys Ile Ile

195 200 205

Glu Asn Glu Thr Glu Lys Val Phe Glu Asn Arg Tyr Tyr Glu Glu His

210 215 220

Leu Arg Glu Lys Leu Leu Lys Asp Asp Lys Ile Asp Val Ile Leu Thr

225 230 235 240

Asn Phe Met Glu Ile Arg Glu Lys Ile Lys Ser Asn Leu Glu Ile Leu

245 250 255

Gly Phe Val Lys Phe Tyr Leu Asn Val Gly Gly Asp Lys Lys Lys Ser

260 265 270

Lys Asn Lys Lys Met Leu Val Glu Lys Ile Leu Asn Ile Asn Val Asp

275 280 285

Leu Thr Val Glu Asp Ile Ala Asp Phe Val Ile Lys Glu Leu Glu Phe

290 295 300

Trp Asn Ile Thr Lys Arg Ile Glu Lys Val Lys Lys Val Asn Asn Glu

305 310 315 320

Phe Leu Glu Lys Arg Arg Asn Arg Thr Tyr Ile Lys Ser Tyr Val Leu

325 330 335

Leu Asp Lys His Glu Lys Phe Lys Ile Glu Arg Glu Asn Lys Lys Asp

340 345 350

Lys Ile Val Lys Phe Phe Val Glu Asn Ile Lys Asn Asn Ser Ile Lys

355 360 365

Glu Lys Ile Glu Lys Ile Leu Ala Glu Phe Lys Ile Asp Glu Leu Ile

370 375 380

Lys Lys Leu Glu Lys Glu Leu Lys Lys Gly Asn Cys Asp Thr Glu Ile

385 390 395 400

Phe Gly Ile Phe Lys Lys His Tyr Lys Val Asn Phe Asp Ser Lys Lys

405 410 415

Phe Ser Lys Lys Ser Asp Glu Glu Lys Glu Leu Tyr Lys Ile Ile Tyr

420 425 430

Arg Tyr Leu Lys Gly Arg Ile Glu Lys Ile Leu Val Asn Glu Gln Lys

435 440 445

Val Arg Leu Lys Lys Met Glu Lys Ile Glu Ile Glu Lys Ile Leu Asn

450 455 460

Glu Ser Ile Leu Ser Glu Lys Ile Leu Lys Arg Val Lys Gln Tyr Thr

465 470 475 480

Leu Glu His Ile Met Tyr Leu Gly Lys Leu Arg His Asn Asp Ile Asp

485 490 495

Met Thr Thr Val Asn Thr Asp Asp Phe Ser Arg Leu His Ala Lys Glu

500 505 510

Glu Leu Asp Leu Glu Leu Ile Thr Phe Phe Ala Ser Thr Asn Met Glu

515 520 525

Leu Asn Lys Ile Phe Ser Arg Glu Asn Ile Asn Asn Asp Glu Asn Ile

530 535 540

Asp Phe Phe Gly Gly Asp Arg Glu Lys Asn Tyr Val Leu Asp Lys Lys

545 550 555 560

Ile Leu Asn Ser Lys Ile Lys Ile Ile Arg Asp Leu Asp Phe Ile Asp

565 570 575

Asn Lys Asn Asn Ile Thr Asn Asn Phe Ile Arg Lys Phe Thr Lys Ile

580 585 590

Gly Thr Asn Glu Arg Asn Arg Ile Leu His Ala Ile Ser Lys Glu Arg

595 600 605

Asp Leu Gln Gly Thr Gln Asp Asp Tyr Asn Lys Val Ile Asn Ile Ile

610 615 620

Gln Asn Leu Lys Ile Ser Asp Glu Glu Val Ser Lys Ala Leu Asn Leu

625 630 635 640

Asp Val Val Phe Lys Asp Lys Lys Asn Ile Ile Thr Lys Ile Asn Asp

645 650 655

Ile Lys Ile Ser Glu Glu Asn Asn Asn Asp Ile Lys Tyr Leu Pro Ser

660 665 670

Phe Ser Lys Val Leu Pro Glu Ile Leu Asn Leu Tyr Arg Asn Asn Pro

675 680 685

Lys Asn Glu Pro Phe Asp Thr Ile Glu Thr Glu Lys Ile Val Leu Asn

690 695 700

Ala Leu Ile Tyr Val Asn Lys Glu Leu Tyr Lys Lys Leu Ile Leu Glu

705 710 715 720

Asp Asp Leu Glu Glu Asn Glu Ser Lys Asn Ile Phe Leu Gln Glu Leu

725 730 735

Lys Lys Thr Leu Gly Asn Ile Asp Glu Ile Asp Glu Asn Ile Ile Glu

740 745 750

Asn Tyr Tyr Lys Asn Ala Gln Ile Ser Ala Ser Lys Gly Asn Asn Lys

755 760 765

Ala Ile Lys Lys Tyr Gln Lys Lys Val Ile Glu Cys Tyr Ile Gly Tyr

770 775 780

Leu Arg Lys Asn Tyr Glu Glu Leu Phe Asp Phe Ser Asp Phe Lys Met

785 790 795 800

Asn Ile Gln Glu Ile Lys Lys Gln Ile Lys Asp Ile Asn Asp Asn Lys

805 810 815

Thr Tyr Glu Arg Ile Thr Val Lys Thr Ser Asp Lys Thr Ile Val Ile

820 825 830

Asn Asp Asp Phe Glu Tyr Ile Ile Ser Ile Phe Ala Leu Leu Asn Ser

835 840 845

Asn Ala Val Ile Asn Lys Ile Arg Asn Arg Phe Phe Ala Thr Ser Val

850 855 860

Trp Leu Asn Thr Ser Glu Tyr Gln Asn Ile Ile Asp Ile Leu Asp Glu

865 870 875 880

Ile Met Gln Leu Asn Thr Leu Arg Asn Glu Cys Ile Thr Glu Asn Trp

885 890 895

Asn Leu Asn Leu Glu Glu Phe Ile Gln Lys Met Lys Glu Ile Glu Lys

900 905 910

Asp Phe Asp Asp Phe Lys Ile Gln Thr Lys Lys Glu Ile Phe Asn Asn

915 920 925

Tyr Tyr Glu Asp Ile Lys Asn Asn Ile Leu Thr Glu Phe Lys Asp Asp

930 935 940

Ile Asn Gly Cys Asp Val Leu Glu Lys Lys Leu Glu Lys Ile Val Ile

945 950 955 960

Phe Asp Asp Glu Thr Lys Phe Glu Ile Asp Lys Lys Ser Asn Ile Leu

965 970 975

Gln Asp Glu Gln Arg Lys Leu Ser Asn Ile Asn Lys Lys Asp Leu Lys

980 985 990

Lys Lys Val Asp Gln Tyr Ile Lys Asp Lys Asp Gln Glu Ile Lys Ser

995 1000 1005

Lys Ile Leu Cys Arg Ile Ile Phe Asn Ser Asp Phe Leu Lys Lys Tyr

1010 1015 1020

Lys Lys Glu Ile Asp Asn Leu Ile Glu Asp Met Glu Ser Glu Asn Glu

1025 1030 1035 1040

Asn Lys Phe Gln Glu Ile Tyr Tyr Pro Lys Glu Arg Lys Asn Glu Leu

1045 1050 1055

Tyr Ile Tyr Lys Lys Asn Leu Phe Leu Asn Ile Gly Asn Pro Asn Phe

1060 1065 1070

Asp Lys Ile Tyr Gly Leu Ile Ser Asn Asp Ile Lys Met Ala Asp Ala

1075 1080 1085

Lys Phe Leu Phe Asn Ile Asp Gly Lys Asn Ile Arg Lys Asn Lys Ile

1090 1095 1100

Ser Glu Ile Asp Ala Ile Leu Lys Asn Leu Asn Asp Lys Leu Asn Gly

1105 1110 1115 1120

Tyr Ser Lys Glu Tyr Lys Glu Lys Tyr Ile Lys Lys Leu Lys Glu Asn

1125 1130 1135

Asp Asp Phe Phe Ala Lys Asn Ile Gln Asn Lys Asn Tyr Lys Ser Phe

1140 1145 1150

Glu Lys Asp Tyr Asn Arg Val Ser Glu Tyr Lys Lys Ile Arg Asp Leu

1155 1160 1165

Val Glu Phe Asn Tyr Leu Asn Lys Ile Glu Ser Tyr Leu Ile Asp Ile

1170 1175 1180

Asn Trp Lys Leu Ala Ile Gln Met Ala Arg Phe Glu Arg Asp Met His

1185 1190 1195 1200

Tyr Ile Val Asn Gly Leu Arg Glu Leu Gly Ile Ile Lys Leu Ser Gly

1205 1210 1215

Tyr Asn Thr Gly Ile Ser Arg Ala Tyr Pro Lys Arg Asn Gly Ser Asp

1220 1225 1230

Gly Phe Tyr Thr Thr Thr Ala Tyr Tyr Lys Phe Phe Asp Glu Glu Ser

1235 1240 1245

Tyr Lys Lys Phe Glu Lys Ile Cys Tyr Gly Phe Gly Ile Asp Leu Ser

1250 1255 1260

Glu Asn Ser Glu Ile Asn Lys Pro Glu Asn Glu Ser Ile Ala Asn Tyr

1265 1270 1275 1280

Ile Ser His Phe Tyr Ile Val Arg Asn Pro Phe Ala Asp Tyr Ser Ile

1285 1290 1295

Ala Glu Gln Ile Asp Arg Val Ser Asn Leu Leu Ser Tyr Ser Thr Arg

1300 1305 1310

Tyr Asn Asn Ser Thr Tyr Ala Ser Val Phe Glu Val Phe Lys Lys Asp

1315 1320 1325

Val Asn Leu Asp Tyr Asp Glu Leu Lys Lys Lys Phe Lys Leu Ile Gly

1330 1335 1340

Asn Asn Asp Ile Leu Glu Arg Leu Met Lys Pro Lys Lys Val Ser Val

1345 1350 1355 1360

Leu Glu Leu Glu Ser Tyr Asn Ser Asp Tyr Ile Lys Asn Leu Ile Ile

1365 1370 1375

Glu Leu Leu Thr Lys Ile Glu Asn Thr Asn Asp Thr Leu Lys Ser Gly

1380 1385 1390

Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Leu His Leu

1395 1400 1405

Asp Gln Thr Pro Ser Arg Gln Pro Ile Pro Ser Glu Gly Leu Gln Leu

1410 1415 1420

His Leu Pro Gln Val Leu Ala Asp Ala Val Ser Arg Leu Val Leu Gly

1425 1430 1435 1440

Lys Phe Gly Asp Leu Thr Asp Asn Phe Ser Ser Pro His Ala Arg Arg

1445 1450 1455

Lys Val Leu Ala Gly Val Val Met Thr Thr Gly Thr Asp Val Lys Asp

1460 1465 1470

Ala Lys Val Ile Ser Val Ser Thr Gly Thr Lys Cys Ile Asn Gly Glu

1475 1480 1485

Tyr Met Ser Asp Arg Gly Leu Ala Leu Asn Asp Cys His Ala Glu Ile

1490 1495 1500

Ile Ser Arg Arg Ser Leu Leu Arg Phe Leu Tyr Thr Gln Leu Glu Leu

1505 1510 1515 1520

Tyr Leu Asn Asn Lys Asp Asp Gln Lys Arg Ser Ile Phe Gln Lys Ser

1525 1530 1535

Glu Arg Gly Gly Phe Arg Leu Lys Glu Asn Val Gln Phe His Leu Tyr

1540 1545 1550

Ile Ser Thr Ser Pro Cys Gly Asp Ala Arg Ile Phe Ser Pro His Glu

1555 1560 1565

Pro Ile Leu Glu Glu Pro Ala Asp Arg His Pro Asn Arg Lys Ala Arg

1570 1575 1580

Gly Gln Leu Arg Thr Lys Ile Glu Ser Gly Glu Gly Thr Ile Pro Val

1585 1590 1595 1600

Arg Ser Asn Ala Ser Ile Gln Thr Trp Asp Gly Val Leu Gln Gly Glu

1605 1610 1615

Arg Leu Leu Thr Met Ser Cys Ser Asp Lys Ile Ala Arg Trp Asn Val

1620 1625 1630

Val Gly Ile Gln Gly Ser Leu Leu Ser Ile Phe Val Glu Pro Ile Tyr

1635 1640 1645

Phe Ser Ser Ile Ile Leu Gly Ser Leu Tyr His Gly Asp His Leu Ser

1650 1655 1660

Arg Ala Met Tyr Gln Arg Ile Ser Asn Ile Glu Asp Leu Pro Pro Leu

1665 1670 1675 1680

Tyr Thr Leu Asn Lys Pro Leu Leu Ser Gly Ile Ser Asn Ala Glu Ala

1685 1690 1695

Arg Gln Pro Gly Lys Ala Pro Asn Phe Ser Val Asn Trp Thr Val Gly

1700 1705 1710

Asp Ser Ala Ile Glu Val Ile Asn Ala Thr Thr Gly Lys Asp Glu Leu

1715 1720 1725

Gly Arg Ala Ser Arg Leu Cys Lys His Ala Leu Tyr Cys Arg Trp Met

1730 1735 1740

Arg Val His Gly Lys Val Pro Ser His Leu Leu Arg Ser Lys Ile Thr

1745 1750 1755 1760

Lys Pro Asn Val Tyr His Glu Ser Lys Leu Ala Ala Lys Glu Tyr Gln

1765 1770 1775

Ala Ala Lys Ala Arg Leu Phe Thr Ala Phe Ile Lys Ala Gly Leu Gly

1780 1785 1790

Ala Trp Val Glu Lys Pro Thr Glu Gln Asp Gln Phe Ser Leu Thr Pro

1795 1800 1805

<210> 2

<211> 43

<212> DNA

<213>primer (Primer)

<400> 2

atcatgctag cgtgagcaag ggcgaggagc tgttcaccgg ggt 43

<210> 3

<211> 42

<212> DNA

<213>primer (Primer)

<400> 3

tcagggtggt cacgagggtg ggctagggca cgggcagctt gc 42

<210> 4

<211> 46

<212> DNA

<213>primer (Primer)

<400> 4

accggcaagc tgcccgtgcc ctagcccacc ctcgtgacca ccctga 46

<210> 5

<211> 40

<212> DNA

<213>primer (Primer)

<400> 5

tgtagtcaga tcttatccgg acttgtacag ctcgtccatg 40

<210> 6

<211> 42

<212> DNA

<213>primer (Primer)

<400> 6

aagctctaga gtgagcaagg gcgaggagct gttcaccggg gt 42

<210> 7

<211> 43

<212> DNA

<213>primer (Primer)

<400> 7

ttcgagctca gatctttatc cggacttgta cagctcgtcc atg 43

<210> 8

<211> 552

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

ttttgcttat gttggtggta gttggcatgc gtagactgat gactagtcag caaggagcgt 60

agaacagtca cactcgttat atatgtgctt ccaagaaaac tcaagaattt accattagca 120

aacacttttt tgaaatgtta gacatttaaa tgacgaaggc atatagaagc tttgaatagg 180

tgttgtaaag tgttgattta tgtgacgctg agggtgcgca tgaaaggaat gttgggtcac 240

gattattaaa cagtttgcta gcttggacac ttgagtattg gaagttgttg aattctaaaa 300

aactttcagt tgatttgaat agttgctgtt gccaaaaaac ataacctgta ccgaagaacc 360

accccaatat cgaaggggac taaaacagaa gagctgaatt cagctcttca ggccggcatg 420

gtcccagcct cctcgctggc gccggctggg caacatgctt cggcatggcg aatgggacag 480

agacctgaat tcaggtctca cctgtcaccg gatgtgcttt ccggtctgat gagtccgtga 540

ggacgaaaca gg 552

<210> 9

<211> 68

<212> DNA

<213>primer (Primer)

<400> 9

aacggtggtc acgagggtgg gccagggcac gggcagcttg ccggtggtgc agatgaactt 60

cagggtca 68

<210> 10

<211> 68

<212> DNA

<213>primer (Primer)

<400> 10

gcctgaccct gaagttcatc tgcaccaccg gcaagctgcc cgtgccctgg cccaccctcg 60

tgaccacc 68

<210> 11

<211> 42

<212> DNA

<213>primer (Primer)

<400> 11

cgctagggat aacagggtaa tataattaac cctcactaaa gg 42

<210> 12

<211> 42

<212> DNA

<213>primer (Primer)

<400> 12

cctccaatct tgtgttcttc aaataatacg actcactata gg 42

<210> 13

<211> 68

<212> DNA

<213>primer (Primer)

<400> 13

aacgaattgc cattttgaat caagtgtaaa tcaataccat ggatgaatga tctatacaga 60

agcgatgc 68

<210> 14

<211> 68

<212> DNA

<213>primer (Primer)

<400> 14

gccgcatcgc ttctgtatag atcattcatc catggtattg atttacactt gattcaaaat 60

ggcaattc 68

<210> 15

<211> 42

<212> DNA

<213>primer (Primer)

<400> 15

cgctagggat aacagggtaa tataattaac cctcactaaa gg 42

<210> 16

<211> 42

<212> DNA

<213>primer (Primer)

<400> 16

cctccaatct tgtgttcttc aaataatacg actcactata gg 42

<210> 17

<211> 20

<212> DNA

<213>primer (Primer)

<400> 17

tgcctagcat cgcttctgta 20

<210> 18

<211> 21

<212> DNA

<213>primer (Primer)

<400> 18

catcaatgac gagcttacca t 21

<210> 19

<211> 43

<212> DNA

<213>primer (Primer)

<400> 19

atcatcatat ggtgagcaag ggcgaggagc tgttcaccgg ggt 43

<210> 20

<211> 46

<212> DNA

<213>primer (Primer)

<400> 20

tcagggtggt cacgagggtg ggctagggca cgggcagctt gccggt 46

<210> 21

<211> 46

<212> DNA

<213>primer (Primer)

<400> 21

accggcaagc tgcccgtgcc ctagcccacc ctcgtgacca ccctga 46

<210> 22

<211> 40

<212> DNA

<213>primer (Primer)

<400> 22

tgtagtccat ggttatccgg acttgtacag ctcgtccatg 40

<210> 23

<211> 43

<212> DNA

<213>primer (Primer)

<400> 23

atcatcatat ggtgagcaag ggcgaggagc tgttcaccgg ggt 43

<210> 24

<211> 40

<212> DNA

<213>primer (Primer)

<400> 24

tgtagtccat ggttatccgg acttgtacag ctcgtccatg 40

<210> 25

<211> 68

<212> DNA

<213>primer (Primer)

<400> 25

aactgtcgtt ctcctttaaa aacttattgt ttttccaatt gcttccagtc tttgttttta 60

aaagattc 68

<210> 26

<211> 68

<212> DNA

<213>primer (Primer)

<400> 26

gccgaatctt ttaaaaacaa agactggaag caattggaaa aacaataagt ttttaaagga 60

gaacgaca 68

<210> 27

<211> 42

<212> DNA

<213>primer (Primer)

<400> 27

cgctagggat aacagggtaa tataattaac cctcactaaa gg 42

<210> 28

<211> 42

<212> DNA

<213>primer (Primer)

<400> 28

cctccaatct tgtgttcttc aaataatacg actcactata gg 42

<210> 29

<211> 65

<212> DNA

<213>primer (Primer)

<400> 29

atccaactag gtttaccatt cttcttaata gttcatccca agtaagagaa gaatcttgac 60

aaaag 65

<210> 30

<211> 65

<212> DNA

<213>primer (Primer)

<400> 30

tcgagcacat aaacttccta ccagaccttg gttacaaagt gtgatatacg gtggagttta 60

tccaa 65

Claims

1. a kind of method of the RNA fixed point editor based on CRISPR technology, which is characterized in that when being included in RNA fixed point editor, with Cas13a variant as nuclease, also,

(1) Cas13a variant described in without ssRNA cleavage activity, there is ssRNA to combine activity；

(2) the Cas13a variant described in is merged with the catalyst structure domain of adenine deaminase ADAR2.

2. the method as described in claim 1, which is characterized in that the RNA fixed point based on CRISPR technology, which is edited, includes:

(a) fusion, the fusion that coding Cas13a variant is merged with the catalyst structure domain of adenine deaminase ADAR2 are prepared Albumen；

(b) crRNA of preparation targeting target gene；

(c) fusion and crRNA (b) that (a) is introduced in the cell that need to carry out gene editing, thus to mesh in cell Mark gene carries out fixed point editor.

3. method according to claim 2, which is characterized in that the length of the crRNA is 20~100bp；Preferably 28~91bp；Or

Containing the base for the design of specific editing sites in the crRNA, which is located on crRNA between the 15th~55 Position, preferably on the 18th~48；Or

The crRNA of the targeting target gene includes that cas13a is targeted to the sequence of binding site and ADAR2 editting function must Palpus, formation editing sites double stranded region matched sequence.

4. the method as described in claim 1, which is characterized in that the Cas13a variant corresponds to wild type Cas13a, In There are the mutation of amino acid residue, missing or insertions in its amino acid sequence the 1250th~1300, so that the Cas13a Variant without ssRNA cleavage activity, have ssRNA combine activity；Preferably, the Cas13a variant corresponds to wild type Cas13a, there are the mutation of amino acid residue, missing or insertions in its amino acid sequence the 1260th~1290；Preferably, There are the mutation of amino acid residue, missing or insertions in its amino acid sequence the 1270th~1280；Preferably, its amino acid There are the mutation of amino acid residue in sequence the 1278th.

5. method as claimed in claim 4, which is characterized in that the catalyst structure domain of the adenine deaminase ADAR2 has There are 299-701 amino acid sequences of overall length ADAR2 sequence.

6. the method as described in claim 1, which is characterized in that (2) in, the Cas13a variant is located at the N of fusion protein End or C-terminal；Or

The catalyst structure domain of the adenine deaminase ADAR2 includes overall length adenine deaminase ADAR2 299-701 Amino acid sequence.

7. a kind of fusion protein for the RNA fixed point editor based on CRISPR technology, which is characterized in that it includes that Cas13a becomes The catalyst structure domain of body and adenine deaminase ADAR2；Also, the Cas13a variant without ssRNA cleavage activity, have SsRNA combines activity.

8. fusion protein as claimed in claim 7, which is characterized in that the Cas13a variant corresponds to wild type Cas13a, there are the mutation of amino acid residue, missing or insertions in its amino acid sequence the 1250th~1300, so that described Cas13a variant without ssRNA cleavage activity, have ssRNA combine activity；Preferably, the Cas13a variant is corresponding to wild Type Cas13a, there are the mutation of amino acid residue, missing or insertions in its amino acid sequence the 1260th~1290；Preferably Ground, there are the mutation of amino acid residue, missing or insertions in its amino acid sequence the 1270th~1280；Preferably, its ammonia There are the mutation of amino acid residue in base acid sequence the 1278th.

9. fusion protein as claimed in claim 7, which is characterized in that the catalytic structure of the adenine deaminase ADAR2 Domain has 299-701 amino acid sequences of full length sequence.

10. fusion protein as claimed in claim 8, which is characterized in that the Cas13a variant is located at the N-terminal of fusion protein Or C-terminal；Or

The catalyst structure domain of the adenine deaminase of the adenine deaminase ADAR includes adenine deaminase ADAR2 the 299-701 amino acid sequences.

11. a kind of polynucleotides, any fusion protein of coding claim 7~10.

12. a kind of recombinant plasmid, it includes the polynucleotides described in claim 11.

13. a kind of host cell, it includes integrate excellent claim in the recombinant plasmid or its genome described in claim 12 Polynucleotides described in 11.

14. the use of claim 7~the 10 any fusion protein or its encoding gene or the plasmid containing the fusion protein On the way, editorial efficiency is pinpointed for improving the RNA based on CRISPR technology.

15. a kind of for carrying out the plasmid of the RNA fixed point editor based on CRISPR technology, which is characterized in that operated including the following group Property connection element:

Promoter has the leader that can be cut away by self；

The DR sequence of Cas13a；

CrRNA occupy-place sequence；

Ribozyme with 5 ' end cutting functions.

16. the purposes of plasmid described in claim 15, described for introducing crRNA in the cell that need to carry out gene editing CrRNA sequence it is accurate.

17. a kind of for carrying out the kit of the RNA fixed point editor based on CRISPR technology, which is characterized in that including: power Benefit requires 7~10 any fusion proteins, recombination described in polynucleotides described in claim 11 or claim 12 Plasmid.

18. kit as claimed in claim 17, which is characterized in that wherein further include: described in claim 15 for into The plasmid of RNA fixed point editor of the row based on CRISPR technology.