CN110462064A - The method and its application of microorganism detection are carried out based on excretion body nucleic acid - Google Patents

Abstract

The present invention provides the method and its application that microorganism detection is carried out based on excretion body nucleic acid.The described method includes: (a) separation from sample to be tested obtains excretion body nucleic acid, the sample to be tested is from the first species；(b) the excretion body nucleic acid is sequenced, obtains sequencing result；(c) nucleic acid sequence for corresponding to first species is excluded from the sequencing result, to obtain the sequence data through removal processing；(d) sequence data through removal processing is compared with the nucleic acid sequence in microbiological data library, obtains the microorganism detection result in the sample.

Description

Method for detecting microorganisms based on exosome nucleic acid and application thereof

This application claims the benefit of a chinese patent application No. 201710254374.X filed on 18/04/2017 and is incorporated herein in its entirety.

Technical Field

The invention relates to the technical field of microbial detection, in particular to a method for detecting microorganisms based on exosome nucleic acid.

Background

Human infection, which is caused by invasion of human tissues by pathogenic microorganisms directly or indirectly causing damage to human body, is one of the important causes; these pathogenic microorganisms include bacteria, fungi, viruses, parasites, and the like. Currently, the burden of diseases caused by unknown and new pathogens is increasing, which poses an increasing threat to the health and safety of human beings. The realization of the rapid and accurate detection of unknown pathogenic microorganisms is the key importance of the accurate identification of the clinical pathogenic microorganisms for the clinical accurate diagnosis and effective prevention and treatment, and pregnancy infection (such as the TORCH screening widely carried out in the pre-pregnancy stage in China) is an important factor of common diseases such as premature birth, abortion, pregnancy hypertension and the like.

The traditional pathogenic microorganism identification technology is mainly divided into two types, namely methods based on cell culture such as morphological observation, cell physiological and biochemical characteristics, bacterial culture typing, gene chips, automated microorganism analysis systems and the like, and methods based on specific primers/probes/antibodies such as antigen-antibody reaction, PCR reaction detection and rapid detection systems of pathogenic microorganisms with various specificities. The technologies play an important role in the daily confirmation of pathogenic microorganisms, but have certain defects, such as the requirement of the former on culture, long period and low identification precision, and the requirement of the latter on certain prior knowledge of microorganism sequences, incapability of coping with unknown or mutant pathogens and the like.

Traditionally, pathogenic microorganisms are identified mainly by technologies such as isolated culture and PCR (polymerase chain reaction), but the technologies have the limitations of long time consumption, limited identification number and the like, and the pathogenic identification through high-throughput sequencing overcomes the limitations to a certain extent. With the improvement of sequencing technology and the reduction of cost, the high-throughput sequencing technology is increasingly popular for the metagenomic identification of pathogenic microorganisms in clinical samples. Macrogenomics is a research technology and method for the genome assembly of all microorganisms in the environment. Depending on the research methods, metagenomics can be divided into classification and identification of ribosomal rDNA, and analytical identification of the entire metagenomic DNA sequence.

The sample for pathogen identification is of various types, such as nasopharyngeal swab, sputum, urine, blood (whole blood, serum, plasma) and the like, while compared with nasopharyngeal swab, sputum and urine, blood is less interfered by external environment, has less possibility of pollution, and is more suitable for serving as a sample for pathogen identification. The method for identifying the pathogeny in blood usually comprises extracting free DNA in plasma, performing PCR amplification, and sequencing the free DNA by a high-throughput sequencing method. As the data contains sequences of a plurality of people, the sequences of people need to be removed, the interference on the classification of the next step of microorganisms is reduced, the processed sequence result is compared with the existing microorganism database (such as bacteria, viruses, fungi and the like), the microorganism level identification is carried out according to the comparison annotation result, and the judgment of pathogenic microorganisms is carried out.

Thus, there is still a need for further improvements in the means of detection of microorganisms in individuals.

Disclosure of Invention

The inventor of the invention finds out in the research process that: by means of high-throughput sequencing technology, pathogen identification is carried out by using blood samples, and because the proportion of microbial sequences in blood is much lower than that of sequences for detecting individuals (such as human beings), the problems that the proportion of human beings is higher, the proportion of microorganisms is lower and the sequencing saturation is far from enough in a sequencing result often occur. Based on this, the invention aims to provide a pathogenic microorganism detection method based on exosome DNA with high accuracy and high sensitivity. The method can enrich the sequence of the microorganism to a certain extent, thereby obviously improving the accuracy of the sequencing information of the microorganism in the sequencing process and improving the accuracy of the detection result of the microorganism to a great extent. Moreover, the enrichment can be realized by using exosome, and the method is simple and convenient.

In a first aspect of the invention, there is provided a method of detecting a microorganism in a sample to be tested, the method comprising the steps of:

(a) separating the test sample to obtain exosome nucleic acids, wherein the test sample is from a first species;

(b) sequencing the exosome nucleic acid to obtain a sequencing result consisting of nucleic acid sequence data;

(c) excluding from the sequencing results a nucleic acid sequence corresponding to the first species based on the nucleic acid sequence information of the first species, thereby obtaining de-processed sequence data; and

(d) and comparing the sequence data subjected to the removal processing with the nucleic acid sequence of a microorganism database, and carrying out microorganism species classification, thereby obtaining a microorganism detection result in the sample.

The microbial database is derived from the existing microbial database, and the databases are not invariable and can be continuously supplemented and perfected along with the development of the technology. The microbial database may use Refseq data from NCBI, including bacterial/archaeal data, viral data, fungal data, protozoal data, plasmid data, etc., as desired.

The method for detecting microorganisms in a sample to be tested using the present invention can be used to determine microorganisms in a certain individual or a certain species. The method can be used for detecting pathogenic microorganisms and beneficial microorganisms in individuals or species, and provides reference and reference for improving or adjusting physical conditions or constitutions of individuals.

In another preferred embodiment, the exosome nucleic acid is selected from the group consisting of: exosome DNA, exosome RNA, or a combination thereof; preferably exosome DNA.

In another preferred embodiment, the first species is selected from the group consisting of: a mammal, a bird, or a reptile, more preferably the mammal is a human. When the first species is human, the human nucleic acid sequence information can be removed by reference to hg19, the refMrna database in UCSC, and/or the swellin database, among others.

In another preferred embodiment, the sample is a sample from a human (including both male and female).

In another preferred example, the sample to be tested is a sample from a normal individual.

In another preferred example, the sample to be tested is a sample from a heat-generating individual.

In another preferred example, the sample to be tested is a sample from a pregnant individual.

In another preferred example, the exosome nucleic acid comprises a maternal-derived exosome nucleic acid, a fetal-derived exosome nucleic acid of the maternal host, or a combination thereof. When the sample to be detected is a sample from a pregnant individual, the obtained exosome nucleic acid not only contains exosome nucleic acid from the pregnant woman, but also contains exosome nucleic acid from a fetus in the pregnant woman, so that the judgment of the pathogen infection conditions of the pregnant woman and the fetus can be realized by analyzing the exosome nucleic acid in the pregnant woman.

In another preferred embodiment, the exosome nucleic acid comprises fetal-derived exosome DNA.

In another preferred embodiment, the exosome nucleic acid is exosome DNA derived from placenta and gestational tissue.

In another preferred embodiment, the microorganism is selected from the group consisting of: a virus, a bacterium, a fungus, a parasite, a chlamydia, a mycoplasma, or a combination thereof.

In another preferred example, the microorganism detection result includes the kind of microorganism and the number or abundance of the microorganism.

In another preferred embodiment, the sample to be tested is selected from the group consisting of: a blood sample, or a body fluid sample.

In another preferred embodiment, the blood sample is selected from the group consisting of: plasma, serum, or a combination thereof.

In another preferred embodiment, the body fluid sample is selected from the group consisting of: urine, saliva, pleural effusion, cerebrospinal fluid, sweat, amniotic fluid, cell culture fluid, or a combination thereof.

In another preferred example, the blood sample is a pre-treated blood sample.

In another preferred embodiment, the blood sample is a supernatant collected after centrifugation of the blood sample.

In another preferred embodiment, the supernatant is prepared by a two-step method:

(1) collecting a blood sample using a collection device, wherein the collection device comprises an anticoagulant, an

(2) Subjecting the sample to high speed centrifugation, thereby obtaining the supernatant.

In another preferred embodiment, step (a) comprises isolating exosomes from the test sample and then obtaining or preparing exosome nucleic acids from the exosomes.

In another preferred example, in the step (a), the separation comprises the steps of:

(a1) separating exosomes from the sample to be tested; and

(a2) extracting nucleic acids from the isolated exosomes.

In another preferred embodiment, the separation is performed by magnetic bead separation, affinity separation, or a combination thereof.

In another preferred example, the magnetic bead separation method uses magnetic beads with surfaces labeled with CD63 antibodies or PLAP antibodies for separation.

In another preferred embodiment, the isolating comprises sorting or capturing using specific antibodies against at least one of the following antigens: PLAP, CD9, CD63, or CD 81.

In another preferred embodiment, in step (b), the sequencing comprises high throughput sequencing, more preferably sequencing using a BGISEQ series or MGISEQ series sequencing platform.

In another preferred embodiment, in step (c), the following sub-steps are included:

(c1) comparing the sequencing result with the nucleic acid sequence information of the first species according to a preset comparison parameter, and removing the compared sequence, thereby obtaining the non-compared sequence and further obtaining first pretreatment sequence data;

(c2) according to a preset fault tolerance rate, the first preprocessing sequence data is compared with a sequencing joint sequence, so that a joint sequence in the sequence is cut from the first preprocessing sequence data, and further second preprocessing sequence data is obtained; and

(c3) removing sequences with length less than L from the second pre-processed sequence data according to length L as a standard, thereby obtaining the removed processed sequence data, wherein L is a positive integer from 18 to 25.

In another preferred example, in step (c1), the predetermined alignment parameter is a maximum tolerance of 3 bases, or a maximum allowable insertion or deletion of 3 bases.

In another preferred example, in the step (c2), the predetermined fault tolerance is 15% -25%.

In another preferred example, in step (c), when the first species is a human, the nucleic acid sequence information of the first species is Hg19 genomic sequence.

In another preferred embodiment, in step (d), the microorganism species is classified using the Kraken method (e.g., Kraken-0.10.5-beta version).

In another preferred embodiment, in step (d), the classification of the microbial species using the Kraken method comprises:

(d1) constructing a K-mer database according to the known genome data;

(d2) based on the de-processed sequence data obtained in step (c), breaking each of the sequences into segments of predetermined length K-mers;

(d3) and comparing the fragments of the predetermined length K-mers with a K-mer database, and further performing species classification on the sequences according to the principle of the nearest common ancestor.

In another preferred example, the K-mer database comprises sequence data from the following species: human genome, bacteria/archaea, viruses, fungi, protozoa, plasmids.

In another preferred example, the method further comprises: for step (c), further performing genetic testing analysis on said excluded nucleic acid sequences corresponding to said first species, thereby obtaining a genetic test result corresponding to the first species.

In another preferred example, the gene test result corresponding to the first species comprises: non-invasive prenatal gene detection results. The non-invasive prenatal gene detection result can reflect the condition of fetal chromosome genetic abnormality in the abdomen of the pregnant woman, such as fetal chromosome aneuploidy, fetal chromosome microdeletion, fetal chromosome microreplication and the like.

According to a second aspect of the invention, there is provided a system for determining a microorganism in a sample to be tested. The system comprises: a nucleic acid separation device for separating the sample to be tested to obtain exosome nucleic acid, wherein the sample to be tested is from a first species; the sequencing device is connected with the exosome nucleic acid separation device and is used for sequencing the exosome nucleic acid to obtain a sequencing result consisting of nucleic acid sequence data; a data screening device coupled to the sequencing device, the data screening device excluding a nucleic acid sequence corresponding to the first species from the sequencing results based on nucleic acid sequence information of the first species, thereby obtaining de-processed sequence data; and the data analysis device is connected with the data screening device, compares the sequence data subjected to the removal processing with the nucleic acid sequence of a microorganism database, and classifies microorganism species so as to obtain a microorganism detection result in the sample.

In a preferred embodiment, the exosome nucleic acid is selected from the group consisting of: exosome DNA, exosome RNA, or a combination thereof; preferably exosome DNA.

In a preferred embodiment, the first species is selected from the group consisting of: mammals, birds or reptiles. The mammal is preferably a human.

In a preferred example, the sample to be tested is a sample from a normal individual, a sample from a febrile individual or a sample from a pregnant individual.

In a preferred embodiment, the exosome nucleic acids comprise maternal-derived exosome nucleic acids, or a combination thereof.

In a preferred embodiment, the exosome nucleic acid comprises fetal-derived exosome DNA.

In a preferred embodiment, the exosome nucleic acid is exosome DNA derived from placenta and gestational tissue.

In a preferred embodiment, the microorganism is selected from the group consisting of: a virus, a bacterium, a fungus, a parasite, a chlamydia, a mycoplasma, or a combination thereof.

In a preferred embodiment, the sample to be tested is selected from the group consisting of: a blood sample, or a body fluid sample.

In a preferred embodiment, the blood sample is selected from the group consisting of: plasma, serum, or a combination thereof.

In a preferred embodiment, the body fluid sample is selected from the group consisting of: urine, saliva, pleural effusion, cerebrospinal fluid, sweat, amniotic fluid, cell culture fluid, or a combination thereof.

In a preferred embodiment, the nucleic acid isolation apparatus comprises:

the exosome separation unit is used for separating exosomes from the sample to be detected; and

a nucleic acid extraction unit connected to the exosome separation unit, the nucleic acid extraction unit extracting nucleic acids from the separated exosomes.

In a preferred embodiment, the exosome separation unit separates exosomes from the sample to be detected by adopting the following group of methods: magnetic bead separation, affinity separation, or a combination thereof.

In a preferred embodiment, the isolating comprises sorting or capturing using antibodies specific for at least one of the following antigens: PLAP, CD9, CD63, or CD 81.

In a preferred embodiment, the magnetic bead separation method uses magnetic beads with surfaces labeled with CD63 antibodies or PLAP antibodies for separation.

In a preferred embodiment, the sequencing device comprises a high-throughput sequencing device; preferably, the sequencing device comprises a BGISEQ series or MGISEQ series sequencing device.

In a preferred example, the data screening apparatus includes:

a species data removing unit, which compares the sequencing result with the nucleic acid sequence information of the first species according to a preset comparison parameter, removes the sequence on the comparison, thereby obtaining the sequence not on the comparison, and further obtains a first preprocessing sequence data;

the joint data removing unit is connected with the species data removing unit and compares the first preprocessing sequence data with a sequencing joint sequence according to a preset fault tolerance rate, so that the joint sequence in the sequence is cut from the first preprocessing sequence data, and further second preprocessing sequence data is obtained; and

a short sequence removal unit that removes sequences having a length smaller than L from the second preprocessed sequence data based on the length L as a criterion, thereby obtaining the removal-processed sequence data, wherein L is a positive integer from 18 to 25.

In a preferred embodiment, the predetermined alignment parameter in the species data removing unit is a maximum tolerance of 3 bases, or a maximum allowable insertion or deletion of 3 bases.

In a preferred embodiment, the predetermined fault tolerance in the joint data removing unit is 15% to 25%.

In a preferred embodiment, when the first species is a human, the nucleic acid sequence information of said first species is Hg19 genomic sequence.

In a preferred embodiment, in the data analysis device, the species of the microorganism is classified by a Kraken method.

In a preferred embodiment, the microorganism species classification by the Kraken method comprises the following units:

a database construction unit which constructs a K-mer database according to known genome data;

the fragment generating unit is connected with the K-mer database constructing unit and is used for breaking each sequence into fragments of K-mers with preset lengths based on the sequence data subjected to the removal processing and obtained by the data screening unit;

and the fragment comparison unit is connected with the fragment generation unit and compares the fragments of the preset length K-mer with a K-mer database, and further performs species classification on the sequence according to the principle of the nearest common ancestor.

In a preferred embodiment, the K-mer database comprises sequence data from the following species: human genome, bacteria/archaea, viruses, fungi, protozoa, plasmids.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

Figure 1 provides a flow diagram for exosome non-human sequence analysis according to an embodiment of the present invention.

FIG. 2 provides a schematic illustration of reverse blending according to an embodiment of the present invention.

Fig. 3 is a schematic diagram of a system for determining microorganisms in a sample to be tested according to an embodiment of the present invention.

Fig. 4 is a schematic diagram of the data screening apparatus according to an embodiment of the present invention.

Fig. 5 is a schematic structural diagram of microbe classification by using the Kraken method according to an embodiment of the present invention.

Detailed Description

In the present invention, unless otherwise expressly stated or limited, the terms "mounted," "connected," "secured," and the like are to be construed broadly and can, for example, be fixedly connected, detachably connected, or integrally formed; may be mechanically coupled, may be electrically coupled or may be in communication with each other; they may be directly connected or indirectly connected through intervening media, or they may be connected internally or in any other suitable relationship, unless expressly stated otherwise. The specific meanings of the above terms in the present invention can be understood by those skilled in the art according to specific situations.

Furthermore, the terms "first", "second" and "first" are used for descriptive purposes only and are not to be construed as indicating or implying relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one such feature. In the description of the present invention, "a plurality" means at least two, e.g., two, three, etc., unless specifically limited otherwise.

In the present invention, unless otherwise expressly stated or limited, the first feature "on" or "under" the second feature may be directly contacting the first and second features or indirectly contacting the first and second features through an intermediate. Also, a first feature "on," "over," and "above" a second feature may be directly or diagonally above the second feature, or may simply indicate that the first feature is at a higher level than the second feature. A first feature being "under," "below," and "beneath" a second feature may be directly under or obliquely under the first feature, or may simply mean that the first feature is at a lesser elevation than the second feature.

The present invention has been completed based on the following findings of the inventors: the inventor of the invention has conducted extensive and intensive studies and surprisingly found for the first time that various pathogenic microorganisms (bacteria, fungi, viruses, parasites and the like) can be detected by separating or enriching the gestational exosome DNA, and compared with the conventional plasma cfDNA (cell free DNA) method, the exosome DNA-based method of the invention has the advantages of more detection types and higher abundance. Information for the detection of unknown pathogenic microorganisms in clinical patients, such as in febrile or pregnant populations, can be accurately provided by, for example, high throughput sequencing. The present invention has been completed based on this finding.

According to one embodiment of the present invention, the present invention provides a method for identifying a microorganism in a biological individual, which comprises the steps of: (a) isolating exosome nucleic acids containing genetic information of the individual and microbial genetic information from the biological individual; (b) sequencing the exosome nucleic acid to obtain a sequencing result consisting of nucleic acid sequence data; (c) excluding a nucleic acid sequence corresponding to the individual from the sequencing results based on nucleic acid sequence information of the biological individual, thereby obtaining de-processed sequence data; and (d) comparing the data of the removed sequence with the nucleic acid sequences of a microbial database, and classifying the species of the microbe, thereby obtaining a result of detecting the microbe in the sample.

In the present invention, whether expressed as a first species or as a biological individual, or as a biological sample, or as an individual, means that the present invention can diagnose and confirm microorganisms present in a living body.

Exosomes

As used herein, the term "exosome" refers to an extracellular nanoscale vesicle (30-100nm) formed by a series of regulation processes such as "endocytosis-fusion-efflux" of a living cell endosome, carries an inclusion such as RNA, protein and lipid, has the functions of regulating gene transcription and expression, and can realize signal transduction between cells and between individuals. Almost all types of cells are able to secrete exosomes, including: serum, plasma, urine, cell culture supernatant (immune system cells, tumor cells), milk, saliva, ascites fluid, amniotic fluid, tracheal alveolar lavage fluid, joint synovial fluid. The exosome can be separated by density gradient centrifugation, and a special cup-shaped structure of the exosome can be observed under a transmission electron microscope.

Changes in exosome content during pregnancy are correlated with the gestation week: compared with a control of a non-pregnant woman, the content of exosomes in peripheral blood of a pregnant woman in normal pregnancy is remarkably increased by about 20-50 times, and the content of exosomes continuously rises along with the increase of the content of exosomes in the pregnant woman in the gestational period. Through quantitative discovery of PLAP on the surface of the exosome, exosomes derived from the fetus in the peripheral blood of a pregnant woman can be detected when the pregnant woman is pregnant for 5-6 weeks, and the quantity also rapidly rises along with the increase of the pregnant week, so that the release of placenta-specific exosomes into the maternal circulation is increased along with the activity of placenta maturation and maternal-fetal exchange.

Total exosome isolation method: SBI company is based on the principle of sedimentation and centrifugation, and Thermo Fisher company is based on immunomagnetic bead separation; the invention combines the two, obtains a large amount of exosome by using SBI company reagent, and solves the problem of low purity of the exosome by an immunomagnetic bead method.

Other methods with higher exosome separation purity, such as ultracentrifugation and density gradient centrifugation, can also achieve the effect of pathogenic microorganism enrichment similar to immunomagnetic beads.

In another preferred embodiment, enrichment of total plasma vesicles, i.e. microvesicles (or other not well defined classes of extracellular vesicles, such as additionally platelet nucleic acids) and exosomes, may also achieve a pathogenic microorganism enrichment effect similar to exosomes.

In another preferred embodiment, detection of plasma exosome pathogenic microorganisms may be helpful in assessing tumor immunotherapy efficacy.

In another preferred example, plasma exosome pathogenic microorganism detection can be used for post-transplant pathogen monitoring.

As the exosome is an intercellular communication mode, the detection of pathogenic microorganisms in DNA content reflects the infection condition of pathogenic microorganisms in a human body, and the information can be used for the detection of unknown pathogenic microorganisms of clinical patients (such as fever people) and the screening and risk prediction of common diseases of pregnancy people.

Capture or sorting agents

As used herein, the terms "capture agent", "sorting agent" and "reagents" are used interchangeably and refer to an agent that captures or enriches or sorts exosomes from a blood or body fluid sample.

A typical capture agent includes (a) a specific antibody to at least one of the following antigens: PLAP, CD9, CD63, or CD 81; or (b) magnetic beads coupled with the antibody. For example, an Exoquick reagent and/or an immunomagnetic bead that specifically recognizes CD63 and/or PLAP (placental alkaline phosphatase) may be used.

Immunomagnetic beads are spherical magnetic particles with monoclonal antibodies coupled to the surface of the beads (e.g., coupled via the streptomycin-avidin system), which specifically capture total plasma exosomes via antibody interaction with exosome surface antigens (e.g., CD9, CD63, CD 81); the exosome with tissue and organ specificity can also be separated through an antigen (such as PLAP) specifically expressed by a certain tissue and organ, and the sensitivity and specificity of disease detection are improved by detecting the inclusion of the exosome.

It is noted that the term "exosome nucleic acid" as used herein refers to the nucleic acid component of an exosome. Similarly, "exosome DNA" refers to the DNA component in exosomes and "exosome RNA" refers to the RNA component in exosomes. The inventor of the present invention has found that total exosome DNA extracted from peripheral blood of a pregnant woman contains DNA of both maternal origin (maternal origin) and fetal origin (fetal origin), and the fetal origin DNA exists in the form of free DNA fragments. Similarly, the placenta and exosomes derived from the tissues of pregnancy (e.g., exosomes isolated using PLAP magnetic beads) extracted from the peripheral blood of a pregnant woman contain both maternal (maternal) and fetal (fetal) DNA.

Mechanism of

For ease of understanding the present invention, the following inventive mechanisms are provided by reference. It is to be understood that the scope of the present invention is not limited by the above-described inventive mechanism.

The inventor proposes the following scientific mechanism and explanation: during pregnancy there are exosomes released from placental trophoblast cells in the maternal blood, which contains free DNA fragments of fetal origin; the detection is carried out by a high-throughput sequencing method and is used for screening pregnancy diseases and predicting risks.

Specifically, maternal and fetal exosomes are present in maternal blood during pregnancy: exosomes derived from lymphocytes can be extracted from peripheral blood of a non-pregnant woman by a chromatographic analysis method and an immunoadsorption method, and fetal-origin exosomes can be detected in the peripheral blood of the pregnant woman in pregnancy through quantification of a placenta-specific antibody PLAP, so that the exosomes in the maternal blood in pregnancy are proved to be mixed with fetal sources.

The inventor proves that the fetal-origin exosome in the maternal blood is mainly synthesized and released into the maternal blood by the placental trophoblast cells through in vitro and in vivo experiments. In placental trophoblast cells, primary endosomes develop into mature endosomes through membrane invagination, then one part enters lysosomes, and the other part carries a large number of signal molecules (DNA, mRNA, miRNA, proteins and the like) through encapsulation to form exosomes, and the exosomes are released to extracellular matrix to enter maternal blood through membrane fusion.

Although the biosynthesis, transport, inclusion encapsulation, and action of exosomes are not fully understood, the present studies suggest that fetal-derived exosomes may be involved in the regulation of important processes during pregnancy, such as immune tolerance, maternal-fetal interface remodeling, inflammatory responses, and the like, by actively encapsulating tissue-specific inclusions and releasing them into the maternal circulation. Furthermore, it seems to be more helpful to keep fetal DNA stable, since exosomes have a stable bilayer lipid membrane.

Method for detecting microorganisms based on exosomes in peripheral blood of pregnant woman

The invention provides a method for detecting microorganisms based on exosomes and exosomes in a pregnant woman. According to a particular embodiment of the invention, the method comprises the following steps: (a) isolating exosome nucleic acids from the pregnant woman; (b) sequencing the exosome nucleic acid to obtain a sequencing result consisting of nucleic acid data; (c) removing nucleic acid sequences from the pregnant woman and the fetus from the sequencing results, thereby obtaining removal-processed sequence data; (d) and comparing the sequence data subjected to the removal processing with the nucleic acid sequence of a microorganism database, thereby obtaining a microorganism detection result.

It should be noted that the method of the present invention can be used to determine not only the types and proportions of pathogenic microorganisms in the pregnant woman, but also the types of beneficial microorganisms in the pregnant woman, thereby indicating the physical condition of the pregnant woman. Therefore, the compound can be used for instructing clinical medication or diagnosis of clinical diseases, and can also be used for nutrition and health care, or enhancing the disease resistance of the organism or improving the physique. The microorganism in the pregnant woman determined by the method can be used for assisting clinical diagnosis, providing reference for doctors or dieticians and the like, and can also be used for other non-diagnosis purposes. For example, the method for rapidly and painlessly determining the microbes in the pregnant women is used for monitoring the physique and the state of the pregnant mother during pregnancy, or the method can be used for scientific research or other purposes, such as rapidly determining the microbes in the pregnant women, collecting samples, analyzing the dominant microbe species in the pregnant women, tracking the change condition of the microbe species in the placenta and the pregnant tissues during the whole pregnancy, and the like. Furthermore, even if the method determines that the microorganism is present in the body of the pregnant woman, it can be used for clinical diagnosis assistance, and the disease state of the pregnant woman can be directly diagnosed without using the information on the microorganism.

According to a specific embodiment of the invention, the invention provides a method for detecting pathogenic microorganisms based on exosomes in the peripheral blood of a pregnant woman.

Typically, the method of the invention comprises the steps of:

(a) providing a blood sample, which is blood, plasma, serum, or a combination thereof from the peripheral blood of a pregnant woman;

(b) isolating exosomes from the blood sample;

(c) extracting DNA (including fetal-derived DNA) from the isolated exosomes;

(d) detecting (e.g., PCR amplifying or sequencing) the DNA obtained in (c) so as to obtain a corresponding analysis result or detection result; and

(e) and (4) analyzing information to obtain the types and the proportions of pathogenic microorganisms in the exosomes of the detection sample and the comparison relation with corresponding blood plasma.

In the method of the present invention, the peripheral blood of the pregnant woman may be collected by a conventional method, and then plasma or serum is separated. Peripheral blood (e.g., about 2-20ml, preferably 3-10ml) is collected, for example, using commercially available streck tubes. Plasma or serum separation may be performed by a two-step centrifugation process.

For the separated plasma or serum, an isolate containing total exosomes can be obtained by using centrifugation or the like. Preferably, the total exosomes obtained may be purified, for example, by magnetic bead separation using immunomagnetic beads loaded with CD63 antibody. Exosomes from specific tissue sources may also be enriched, for example, by capturing/enriching placenta and gestational tissue-derived exosomes via immunomagnetic beads loaded with PLAP antibodies, in order to obtain exosomes rich in fetal-derived DNA.

For the isolated total exosomes or exosomes derived from placenta and gestational tissues, the DNA can be extracted and then detected. For example, a high throughput sequencing library can be constructed, then sequenced and analyzed to detect the type of pathogenic microorganism, and the like.

In another preferred embodiment, a typical inventive method comprises the steps of:

the first step is as follows: total plasma exosomes were isolated from blood samples. Wherein total plasma exosomes can be isolated using known methods or reagents, e.g., SBI quick reagent commercially available from SBI corporation;

the second step is that: purifying the total plasma exosomes. For example, the exosome pellet generated in the first step is dissolved in PBS buffer, and then purified using anti-CD 63 immunomagnetic beads, for example, by incubation at a temperature (e.g., 4-8 degrees) for a period of time (e.g., 2-24 hours, or overnight incubation), thereby forming a "magnetic bead-exosome binary complex". anti-CD 63 immunomagnetic beads can be prepared by conventional methods or commercially available, for example, Thermo Fisher CD63 immunomagnetic beads;

the third step: performing exosome DNA extraction on the magnetic bead-exosome binary complex formed in the second step, and then performing library building (increasing PCR cycle number) and/or sequencing to obtain sequencing data consisting of nucleic acid sequence information;

the fourth step: and (3) carrying out information analysis on the sequencing data so as to obtain a corresponding analysis result, for example, carrying out quality control on the sequencing result, removing a human sequence, and then carrying out species classification on the basis of the existing microbial database. Species classification can be achieved by, for example, the Kraken method. The sequence data can be classified and calculated quickly based on a specific k-mer database, the classification result based on Kraken can be used for sorting and counting the microbial species level, the result of Kraken can be processed by Krona, and a more detailed result display is obtained, and the specific analysis flow is shown in figure 1.

In another preferred embodiment, a typical inventive method comprises the steps of:

the first step is as follows: total plasma exosomes were isolated from blood samples. Wherein total plasma exosomes can be isolated using known methods or reagents, e.g., SBI quick reagent commercially available from SBI corporation;

the second step is that: enriching or capturing placenta and pregnancy tissue-derived plasma exosomes from the total plasma exosomes. For example, after the total exosome pellet generated in the first step is solubilized in PBS buffer, capture or enrichment is performed with anti-PLAP immunomagnetic beads, e.g., incubation for a period of time (e.g., 2-24 hours, or overnight incubation) at a temperature (e.g., 4-8 degrees), thereby forming a "bead-exosome binary complex". anti-PLAP immunomagnetic beads can be prepared by conventional methods or commercially available, for example, PLAP immunomagnetic beads from Thermo Fisher company;

the third step: performing exosome DNA extraction on the magnetic bead-exosome binary complex formed in the second step, and then performing library building (increasing PCR cycle number) and/or sequencing to obtain sequencing data consisting of nucleic acid sequence information;

the fourth step: and (3) carrying out information analysis on the sequencing data so as to obtain a corresponding analysis result, for example, carrying out quality control on the sequencing result, removing a human sequence, and then carrying out species classification on the basis of the existing microbial database. Species classification can be achieved by, for example, Kraken software. The sequence data can be rapidly classified and calculated based on a specific k-mer database, the classification result based on Kraken can be used for sorting and counting the microbial species level, and the result of Kraken can be processed by Krona to obtain more detailed result display.

A typical Kraken process comprises the steps of:

(1) firstly, a K-mer database required by Kraken classification needs to be constructed according to genome data, wherein the genome data comprises: human genome (GRCh38), bacterial/archaea, viruses, fungi, protozoa, plasmids, the rest of the data except human are from the Refseq database at NCBI;

(2) when the classification is carried out, each read sequence is required to be broken into fragments of K-mers with specific lengths, then all the K-mers of the read sequence are compared back to a K-mer database, and the read sequence is subjected to species classification according to the principle of a nearest common ancestor (LCA); and

(3) the classification of the microorganisms is statistically sorted based on the classification result of the Kraken species, and the classification result can also be visualized by using a Krona (KronaTools-2.5) tool to obtain a more detailed display result.

It is noted that the term "read sequences", also referred to as "reads", refers to the nucleic acid sequences generated at the end of each sequencing run. The original sequencing data obtained after high-throughput sequencing is the original read sequence, and those skilled in the art can perform filtering processing on the original read sequence as required, such as removing low-quality value read sequences, removing linker sequences, and the like. It is understood that for a sequencing library, numerous read sequences are generated after sequencing, and one skilled in the art can assemble a genome based on the overlapping relationship between the read sequences.

"Kraken", as described herein, is a microbial metagenomic data analysis software that can achieve high sensitivity and high speed short DNA sequence classification by using precise alignment of k-mers and a new classification algorithm. More on Kraken, see http:// ccb. jhu. edu/software/Kraken/.

As used herein, "K-mer" refers to a division of reads into strings of K bases, a read of length m can be divided into (m-K +1) K-mers, m and K are positive integers greater than 1, and m is related to the sequencing platform and sequencing strategy, e.g., SE90 sequencing using a BGISEQ500 sequencer, m is 90. For another example, a reads sequence is: ATCGTTGCTTAATGACGTCAGTCGAATGCGATGACGTGACTGACTG, which need to be segmented into strings of 13 bases, i.e., 13-mers, can be cleaved into the following fragment forms:

ATCGTTGCTTAAT；

TCGTTGCTTAATG；

CGTTGCTTAATGA；

GTTGCTTAATGAC, respectively; and so on.

As used herein, a "K-mer database" refers to a database comprised of K-mer data. The K-mer data may be from any open source database, such as the Refseq database of NCBI, which includes bacterial/archaeal data, viral data, fungal data, protozoal data, and the like.

System for determining microorganisms in a sample to be tested

According to another aspect of the present invention, there is provided a system for determining a microorganism in a sample to be tested, as shown in FIG. 3. The system comprises: the kit comprises a nucleic acid separation device, a sequencing device, a data screening device and a data analysis device, wherein the nucleic acid separation device is used for separating a sample to be detected to obtain exosome nucleic acid, wherein the sample to be detected is from a first species; the sequencing device is connected with the exosome nucleic acid separation device and is used for sequencing the exosome nucleic acid to obtain a sequencing result consisting of nucleic acid sequence data; the data screening device is connected with the sequencing device, and the data screening device excludes a nucleic acid sequence corresponding to the first species from the sequencing result based on the nucleic acid sequence information of the first species, so as to obtain the sequence data subjected to removal processing; and the data analysis device is connected with the data screening device, compares the sequence data subjected to removal processing with the nucleic acid sequence of a microorganism database, and classifies microorganism species so as to obtain a microorganism detection result in the sample. The system provided by the invention can realize rapid and efficient detection of microorganisms on individuals, and has higher sensitivity and a wider detection range.

According to an embodiment of the present invention, the data screening apparatus further includes: the species data removing unit is used for comparing the sequencing result with the nucleic acid sequence information of the first species according to a preset comparison parameter, removing a sequence on comparison, obtaining a sequence which is not compared, and further obtaining first preprocessing sequence data; the joint data removing unit is connected with the species data removing unit and compares the first preprocessing sequence data with a sequencing joint sequence according to a preset fault tolerance rate, so that a joint sequence in the sequence is cut from the first preprocessing sequence data, and further second preprocessing sequence data is obtained; the short sequence removal unit removes sequences with a length less than L from the second preprocessed sequence data according to the length L as a standard, so as to obtain the removed processed sequence data, wherein L is a positive integer of 18-25.

According to an embodiment of the present invention, in the data analysis apparatus, the species classification of the microorganism is performed by using a kraken method, and in the case of performing the species classification of the microorganism by using the kraken method, the data analysis apparatus may further include: the device comprises a database construction unit, a fragment generation unit and a fragment comparison unit, wherein the database construction unit constructs a K-mer database according to known genome data; the fragment generation unit is connected with the K-mer database construction unit and is used for breaking each sequence into fragments of a K-mer with a preset length based on the sequence data subjected to removal processing and obtained by the data screening unit; the fragment comparison unit is connected with the fragment generation unit and compares the fragments of the K-mer with the preset length with a K-mer database, and then the sequences are subjected to species classification according to the principle of the nearest common ancestor.

The main advantages of the invention are:

(1) the method does not need microbial culture and can detect unknown pathogens;

(2) compared with the conventional plasma cfDNA method, the method for detecting pathogenic microorganisms based on exosome DNA has higher sensitivity and wider detection range;

(3) according to the invention, pathogenic microorganisms are enriched based on the DNA of exosome during pregnancy, so that the sensitivity and detection range of detecting the pathogenic microorganisms based on plasma metagenome are greatly improved;

(4) the invention can detect intrauterine infection by separating placenta and pregnancies tissue source exosome, is a non-invasive detection means compared with the traditional amniotic fluid puncture detection, and is simple and easy to implement without abortion risk.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, molecular cloning is generally performed according to conventional conditions such as Sambrook et al: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are by weight.

The experimental materials referred to in the present invention are commercially available without specific reference.

Example 1 detection of pathogenic microorganisms based on Total exosomes in maternal plasma (SBI exosomes)

Two-step method for plasma separation

1. Streck Cell-Free DNA BCT blood sampling

According to the standard collection operation of peripheral blood, 10 cases of pregnant woman peripheral blood are collected, 10mL of blood is collected in each 1 case, after the blood is collected, the blood is required to be slowly inverted 10 times to be uniformly mixed with the components in the tube (as shown in figure 2), and detection failure can be caused by delaying the inversion of the mixing time. After mixing, please place the blood collection tube upright on the test tube rack (6-35 ℃).

2. Plasma separation for pregnant women

2.1 centrifuging at 1600g for 10 min at 4 deg.C, and subpackaging the supernatant in multiple 2.0mL centrifuge tubes on an ice box;

2.2 centrifugation at 16000g for 10 min at 4 ℃ and transfer the resulting supernatant to a new numbered 2.0mL centrifuge tube on an ice box, each centrifuge tube transferring 600 μ L plasma;

2.3 plasma sample preservation: plasma was immediately cryopreserved after separation and stored temporarily at-20 ℃ within one week: long-term storage in refrigerator at-80 deg.C.

3. Total exosome isolation: separation of Total plasma exosomes Using the reagent of the SBI System Biosciences ExoQuick Exosome Precipitation Solution

3.1 adding an Exoquick reagent (adding the Exoquick reagent into 250 mu L of plasma) into the separated plasma, fully sucking, stirring uniformly, and placing in an ice bath for 30 min;

3.21500 g, centrifuging for 30min, and sucking the supernatant;

3.3 centrifuging 1500g of the precipitate produced in step 3.2 for 5min, carefully blotting off traces of the supernatant;

3.4 the precipitate produced in step 3.3 was thawed in 100. mu.L of PBS buffer at 37 ℃ and the resulting solution was labeled "SBI exosomes" (note: the SBI exosomes obtained here were total exosomes obtained using the SBI corporation exosome preparation kit, and they were labeled as SBI exosomes by the inventors for the purpose of distinguishing them from the exosomes obtained in the subsequent examples 2, 3 and comparative example).

4. Total exosome DNA extraction

The SBI exosome solution obtained in step 3.4 was subjected to total exosome DNA extraction using a Meiji bio corporation Kit (magenta Magpure Circulating DNA Mini KF Kit), and the operations were performed completely according to the Kit instructions. The DNA obtained was labeled "SBI exosome DNA".

5. High throughput library building sequencing

The SBI exosome DNA obtained in step 4 was subjected to library construction and high-throughput sequencing (wherein the number of PCR cycles for library construction was 19, and other steps and parameters were identical to those disclosed in the above-mentioned patent application) according to the method disclosed in the patent application "method for constructing a sequencing library based on a blood sample and use thereof in determining fetal genetic abnormality" (application publication No. CN105400864A), to obtain sequencing data.

6. Sequencing data analysis

6.1 comparing the high-throughput sequencing data with a human genome reference sequence hg19 and 3 maximum fault-tolerant base groups or 3 indels through bwa, and filtering out the unaligned sequence according to the comparison result; then, using software 'cutadapt' to compare with a sequencing joint at a fault tolerance rate of 20%, cutting off a joint sequence in the remaining sequence, and filtering out a sequence with the remaining sequence less than 20bp to finally obtain a non-human sequence to be analyzed;

6.2 microbial species Classification Using Kraken (Kraken-0.10.5-beta), first a K-mer database required for Kraken classification was constructed from genomic data including: human genome (GRCh38), bacterial/archaea, viruses, fungi, protozoa, plasmids, and the rest of the data, except for human data, are from the Refseq database at NCBI. When the classification is carried out, each read is broken into a fragment of a K-mer with a specific length, all the K-mers of the read are compared back to a K-mer database, and the read is subjected to species classification according to the principle of a nearest common ancestor (LCA). The classification of the microorganisms is statistically sorted based on the classification result of the Kraken species, and the classification result can also be visualized by using a Krona (KronaTools-2.5) tool to obtain a more detailed display result. Counting the number of the reads detected by various types of microorganisms and the number of the reads detected by the microorganisms in each sample (the number of the reads detected by the microorganisms is the sum of the numbers of the reads detected by bacteria, viruses, archaea and fungi), and calculating a microorganism coefficient, wherein the microorganism coefficient is the number of the reads detected by the microorganisms/the total number of the reads sequenced (M).

As a result: the results of detection of microorganisms based on the SBI exosome DNA method are shown in Table 1. As can be seen from Table 1, the detected microbial coefficient based on the SBI exosome DNA method was 148.50 after being corrected by sequencing data.

Example 2 detection of pathogenic microorganisms based on Total exosomes in maternal plasma (CD63 exosomes)

First, 10 pregnant woman peripheral blood samples were collected (same samples as in example 1), plasma was separated by a two-step method, and total plasma exosomes were separated using an exotic Exosome Precipitation Solution reagent from SBI System Biosciences, in the same manner as in example 1.

The "SBI exosomes" obtained in step 3.4 were isolated and purified using Thermo Fisher Exosom-Human CD63 magnetic beads. The method comprises the following specific steps:

3.5 shaking the CD63 magnetic beads for 30s to mix well;

3.6 taking out 40 μ L of magnetic beads, adding 500 μ L of separation buffer solution (PBS + 0.1% BSA), sucking, uniformly mixing, centrifuging 3000g for 5s for a short time, placing on a magnetic frame, placing for 2min, and sucking the supernatant;

3.7 adding 100. mu.L of the SBI exosomes generated in the step 3.4 into the magnetic beads prepared in the step 3.6, sucking, uniformly mixing, and incubating overnight (18-22h) at 4 ℃ on a rotary shaking table;

3.8 centrifuging 3000g of the mixture of the magnetic beads and the SBI exosomes obtained in the step 3.7 for 5s for a short time, adding 500 mu L of separation buffer solution, placing the mixture on a magnetic frame for 2min, and sucking the supernatant;

3.9 adding 500. mu.L of separation buffer, placing in a magnetic frame for 2min, aspirating the supernatant to obtain magnetic beads carrying exosomes, labeled "CD 63 exosomes" (note: the CD63 exosomes obtained here are total exosomes obtained by first obtaining total exosomes using an exosome preparation kit from SBI company, and then purifying the total exosomes using CD63 magnetic beads, and the inventors labeled them as CD63 exosomes in order to distinguish them from the exosomes obtained in examples 1, 3 and comparative example).

Then, the "CD 63 exosome" obtained in step 3.9 was subjected to total exosome DNA extraction using a Meiji Bio Inc Kit (magenta MagPure Circulating DNA Mini KF Kit), and the procedure was performed exactly as the Kit instructions. The obtained DNA was labeled as "CD 63 exosome DNA".

Finally, the obtained "CD 63 exosome DNA" is subjected to library construction, high-throughput sequencing and sequencing data analysis, and the specific steps are the same as those in example 1.

As a result: the results of microbial detection based on the CD63 exosome DNA method are shown in table 1. As can be seen from table 1, the detected microbial coefficient based on the CD63 exosome DNA method was 6586.87 after being corrected by sequencing data. Compared with a plasma free nucleic acid method and an SBI exosome method, the CD63 exosome DNA-based method can greatly enrich microorganisms and has an extremely obvious enrichment effect.

Comparative example pathogenic microorganism detection based on conventional plasma free nucleic acids

First, 10 pregnant woman peripheral blood samples were collected (samples were obtained as in example 1), and plasma free nucleic acid library construction and high-throughput sequencing were carried out according to the method disclosed in the patent application "method for constructing sequencing library based on blood sample and use thereof in determining fetal genetic abnormality" (application publication No. CN 105400864A). Finally, the obtained sequencing data were analyzed in the same manner as in example 1.

Results and analysis: the results of the microorganism detection based on the plasma free nucleic acid method are shown in Table 1 (the samples in Table 1 are annotated as "sample 1 plasma-sample 10 plasma" and represent the results of the microorganism detection using the method of the present comparative example). As can be seen from Table 1, the detected microbial biomass was 68.10 based on the plasma-free nucleic acid method, after correction of the sequencing data.

TABLE 1 comparison of microbial detection results based on the CD63 exosome, plasma free nucleic acid and SBI exosome methods

Example 3 detection of pathogenic microorganisms based on exosomes derived from placenta and gestational tissue in maternal plasma

Firstly, collecting 1 sample of peripheral blood and amniotic fluid of pregnant women diagnosed with hepatitis B virus infection (diagnosed by the existing hepatitis B antigen immunological detection method), and marking the sample as a sample 1; 3 samples of peripheral blood and amniotic fluid of pregnant women who have been diagnosed with hepatitis B virus infection (which have been diagnosed by the existing immunological detection method for hepatitis B antigen) are collected as negative controls and labeled as samples 2-4.

And simultaneously carrying out detection on pathogenic microorganisms by an SBI exosome-based method, a PLAP exosome-based method, a conventional plasma free nucleic acid-based method and a conventional amniotic fluid cell-based method on each sample.

The specific steps of detecting pathogenic microorganisms based on the SBI exosome method are the same as in example 1.

The specific steps for detecting pathogenic microorganisms based on the conventional plasma free nucleic acid method are the same as the comparative example, and each sample is subjected to two parallel tests.

The method is characterized in that pathogenic microorganisms are detected based on a conventional amniotic fluid cell method, according to the conventional operation method, firstly, amniotic fluid cells are centrifuged, then, DNA of the amniotic fluid cells is extracted, finally, DNA library construction and high-throughput sequencing are carried out, and the analysis method of obtained sequencing data is the same as that of example 1.

The specific steps of pathogenic microorganism detection based on the PLAP exosome method are as follows:

plasma was separated using a two-step process, and total plasma exosomes were separated using the reagent of the SBI System Biosciences ExoQuick Exosome Precipitation Solution, the procedure of which was the same as in example 1.

The "SBI exosomes" obtained in step 3.4 were isolated and purified using Thermo Fisher Exosom-Human PLAP magnetic beads. The method comprises the following specific steps:

3.5 oscillating the PLAP magnetic beads for 30s to fully mix;

3.6 taking out 40 μ L of magnetic beads, adding 500 μ L of separation buffer solution (PBS + 0.1% BSA), sucking, uniformly mixing, centrifuging 3000g for 5s for a short time, placing on a magnetic frame, placing for 2min, and sucking the supernatant;

3.7 adding 100. mu.L of the SBI exosomes generated in the step 3.4 into the magnetic beads prepared in the step 3.6, sucking, uniformly mixing, and incubating overnight (18-22h) at 4 ℃ on a rotary shaking table;

3.8 centrifuging 3000g of the mixture of the magnetic beads and the SBI exosomes obtained in the step 3.7 for 5s for a short time, adding 500 mu L of separation buffer solution, placing the mixture on a magnetic frame for 2min, and sucking the supernatant;

3.9 adding 500. mu.L of separation buffer, placing in a magnetic frame for 2min, aspirating the supernatant to obtain magnetic beads carrying exosomes, labeled "PLAP exosomes" (it is indicated that the PLAP exosomes obtained here are obtained by first obtaining total exosomes using an SBI corporation exosome preparation kit, then capturing the exosomes from placenta and gestational tissues using PLAP magnetic beads, and the inventors labeled them as PLAP exosomes in order to distinguish them from the exosomes obtained in examples 1, 2 and comparative examples).

Then, the "PLAP exosome" obtained in step 3.9 was subjected to placenta and gestational tissue-derived exosome DNA extraction using a Meiji Bio Inc Kit (magenta Magpure Circulating DNA Mini KF Kit), and the procedure was completely performed according to the Kit instructions. The DNA obtained was labeled "PLAP exosome DNA".

Finally, library construction, high-throughput sequencing and sequencing data analysis are carried out on the obtained PLAP exosome DNA, and the specific steps are the same as those in example 1.

Results and analysis: the results of the microbial detection of each sample are shown in Table 2. As can be seen from Table 2, hepatitis B virus could be detected in both plasma and amniotic fluid of sample 1, indicating that both pregnant women and their uterus are infected with hepatitis B virus; in sample 1 based on the PLAP exosome method, a large amount of hepatitis B viruses can be detected, which indicates that intrauterine infection can be indirectly reflected by detecting microorganisms of exosomes derived from placenta and gestational tissues. And 2-3 of negative control samples, hepatitis B virus is not detected in plasma and amniotic fluid, and is not detected in the method based on the PLAP exosome, which indicates that no detection false positive exists. In the negative control sample 4, a small amount of hepatitis B virus was detected in both plasma-based and SBI exosome-based methods, but hepatitis B virus infection was not detected in amniotic fluid samples, nor was hepatitis B virus infection detected in the PLAP exosome-based methods. This demonstrates that PLAP exosomes are more specific for detecting intrauterine infection than plasma-based and SBI exosome-based methods. The results in table 2 demonstrate that the detection of pathogenic microorganisms based on PLAP exosomes can be used to diagnose intrauterine infections.

TABLE 2 detection of intrauterine infection based on PLAP exosomes

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

Claims (46)

1. A method for detecting a microorganism in a sample to be tested, comprising the steps of:

   (a) separating the sample to be detected to obtain exosome nucleic acid, wherein the sample to be detected is from a first species;

   (b) sequencing the exosome nucleic acid to obtain a sequencing result consisting of nucleic acid sequence data;

   (c) excluding from the sequencing results a nucleic acid sequence corresponding to the first species based on the nucleic acid sequence information of the first species, thereby obtaining de-processed sequence data; and

   (d) and comparing the sequence data subjected to the removal processing with the nucleic acid sequence of a microorganism database, and carrying out microorganism species classification, thereby obtaining a microorganism detection result in the sample.
2. The method of claim 1, wherein the exosome nucleic acid is selected from the group consisting of: exosome DNA, exosome RNA, or a combination thereof.
3. The method of claim 1, wherein the first species is selected from the group consisting of: mammals, birds, or reptiles.
4. The method of claim 1, wherein the test sample is a sample from a normal subject, a sample from a febrile subject, or a sample from a pregnant subject.
5. The method of claim 2 or 4, wherein the exosome nucleic acids comprise maternal-derived exosome nucleic acids, or a combination thereof; preferably, the exosome nucleic acid comprises fetal-derived exosome DNA.
6. The method of claim 1, wherein the microorganism is selected from the group consisting of: a virus, a bacterium, a fungus, a parasite, a chlamydia, a mycoplasma, or a combination thereof.
7. The method of claim 1, wherein the microorganism detection result comprises a species of microorganism and a number or abundance of the microorganism.
8. The method of claim 1, wherein the sample to be tested is selected from the group consisting of: a blood sample, or a body fluid sample.
9. The method of claim 8, wherein the blood sample is selected from the group consisting of: plasma, serum, or a combination thereof.
10. The method of claim 8, wherein the bodily fluid sample is selected from the group consisting of: urine, saliva, pleural effusion, cerebrospinal fluid, sweat, amniotic fluid, cell culture fluid, or a combination thereof.
11. The method of claim 8, wherein the blood sample is a supernatant collected after centrifugation of the blood sample.
12. The method of claim 11, wherein the supernatant is prepared by a two-step process comprising:

    (1) collecting a blood sample using a collection device, wherein the collection device comprises an anticoagulant, an

    (2) Subjecting the sample to high speed centrifugation, thereby obtaining the supernatant.
13. The method of claim 1, 2 or 5, wherein in step (a), the separating comprises the steps of:

    (a1) separating exosomes from the sample to be tested; and

    (a2) extracting nucleic acids from the isolated exosomes.
14. The method of claim 1, wherein the separation is performed by magnetic bead separation, affinity separation, or a combination thereof.
15. The method of claim 14, wherein the magnetic bead separation method comprises separating the antibody using a magnetic bead labeled with a CD63 antibody or a PLAP antibody on the surface thereof.
16. The method of claim 1, wherein the isolating comprises sorting or capturing using specific antibodies to at least one of the following antigens: PLAP, CD9, CD63, or CD 81.
17. The method of claim 1, wherein said sequencing comprises high throughput sequencing.
18. The method according to any one of claims 1, 2 or 5, wherein in step (c), the following sub-steps are included:

    (c1) comparing the sequencing result with the nucleic acid sequence information of the first species according to a preset comparison parameter, and removing the compared sequence, thereby obtaining the non-compared sequence and further obtaining first pretreatment sequence data;

    (c2) according to a preset fault tolerance rate, the first preprocessing sequence data is compared with a sequencing joint sequence, so that a joint sequence in the sequence is cut from the first preprocessing sequence data, and further second preprocessing sequence data is obtained; and

    (c3) removing sequences with length less than L from the second pre-processed sequence data according to length L as a standard, thereby obtaining the removed processed sequence data, wherein L is a positive integer from 18 to 25.
19. The method of claim 18, wherein the predetermined alignment parameter in step (c1) is a maximum tolerance of 3 bases, or a maximum allowable insertion or deletion of 3 bases.
20. The method of claim 18, wherein said predetermined fault tolerance in step (c2) is 15% -25%.
21. The method of claim 18, wherein the nucleic acid sequence information of the first species is Hg19 genome sequence when the first species is human.
22. The method of any one of claims 1, 2, 5 or 18, wherein in step (d), the microorganism species classification is performed using the Kraken method.
23. The method as claimed in claim 22, wherein the classification of the microbial species by the Kraken method comprises the following sub-steps:

    (d1) constructing a K-mer database according to the known genome data;

    (d2) based on the de-processed sequence data obtained in step (c), breaking each of the sequences into segments of predetermined length K-mers;

    (d3) and comparing the fragments of the predetermined length K-mers with a K-mer database, and further performing species classification on the sequences according to the principle of the nearest common ancestor.
24. The method of claim 1, further comprising: for step (c), further performing genetic testing analysis on said excluded nucleic acid sequences corresponding to said first species, thereby obtaining a genetic test result corresponding to the first species.
25. The method of claim 24, wherein the gene test results corresponding to the first species comprise: non-invasive prenatal gene detection results.
26. A system for determining a microorganism in a sample to be tested, the system comprising:

    a nucleic acid separation device for separating the sample to be tested to obtain exosome nucleic acid, wherein the sample to be tested is from a first species;

    the sequencing device is connected with the exosome nucleic acid separation device and is used for sequencing the exosome nucleic acid to obtain a sequencing result consisting of nucleic acid sequence data;

    a data screening device coupled to the sequencing device, the data screening device excluding a nucleic acid sequence corresponding to the first species from the sequencing results based on nucleic acid sequence information of the first species, thereby obtaining de-processed sequence data; and

    and the data analysis device is connected with the data screening device, compares the sequence data subjected to the removal processing with the nucleic acid sequence of the microorganism database, and classifies microorganism species so as to obtain a microorganism detection result in the sample.
27. The system of claim 26, wherein the exosome nucleic acid is selected from the group consisting of: exosome DNA, exosome RNA, or a combination thereof; preferably exosome DNA.
28. The system of claim 26, wherein the first species is selected from the group consisting of: mammals, birds or reptiles.
29. The system of claim 26, wherein the test sample is a sample from a normal individual, a sample from a febrile individual, or a sample from a pregnant individual.
30. The system of claim 27, or 28, wherein the exosome nucleic acids comprise maternal-derived exosome nucleic acids, or a combination thereof; preferably, the exosome nucleic acid comprises fetal-derived exosome DNA.
31. The system of claim 26, wherein the microorganism is selected from the group consisting of: a virus, a bacterium, a fungus, a parasite, a chlamydia, a mycoplasma, or a combination thereof.
32. The system of claim 26, wherein the sample to be tested is selected from the group consisting of: a blood sample, or a body fluid sample.
33. The system of claim 32, wherein the blood sample is selected from the group consisting of: plasma, serum, or a combination thereof.
34. The method of claim 32, wherein the bodily fluid sample is selected from the group consisting of: urine, saliva, pleural effusion, cerebrospinal fluid, sweat, amniotic fluid, cell culture fluid, or a combination thereof.
35. The method of any one of claims 26, 27 or 30, wherein the nucleic acid isolation apparatus comprises:

    the exosome separation unit is used for separating exosomes from the sample to be detected; and

    a nucleic acid extraction unit connected to the exosome separation unit, the nucleic acid extraction unit extracting nucleic acids from the separated exosomes.
36. The method according to claim 35, wherein the exosome-separating unit separates exosomes from the sample to be tested using the following group of methods: magnetic bead separation, affinity separation, or a combination thereof.
37. The method of claim 36, wherein the magnetic bead separation method comprises separating using magnetic beads labeled with CD63 antibody or PLAP antibody on their surface.
38. The method of claim 35, wherein the separating comprises sorting or capturing using specific antibodies to at least one of the following antigens: PLAP, CD9, CD63, or CD 81.
39. The method of claim 35, wherein the sequencing device comprises a high throughput sequencing device, preferably wherein the sequencing device comprises a BGISEQ series or a MGISEQ series sequencing device.
40. The system of any one of claims 26, 27 or 30, wherein the data screening means comprises:

    a species data removing unit, which compares the sequencing result with the nucleic acid sequence information of the first species according to a preset comparison parameter, removes the sequence on the comparison, thereby obtaining the sequence not on the comparison, and further obtains a first preprocessing sequence data;

    the joint data removing unit is connected with the species data removing unit and compares the first preprocessing sequence data with a sequencing joint sequence according to a preset fault tolerance rate, so that the joint sequence in the sequence is cut from the first preprocessing sequence data, and further second preprocessing sequence data is obtained; and

    a short sequence removal unit that removes sequences having a length smaller than L from the second preprocessed sequence data based on the length L as a criterion, thereby obtaining the removal-processed sequence data, wherein L is a positive integer from 18 to 25.
41. The system of claim 40, wherein the predetermined alignment parameter in the species data removal unit is a maximum tolerance of 3 bases, or a maximum allowable insertion or deletion of 3 bases.
42. The system according to claim 40, wherein said predetermined fault tolerance in said splice data removal unit is between 15% and 25%.
43. The system of claim 40, wherein the nucleic acid sequence information of the first species is Hg19 genome sequence when the first species is a human.
44. The system of any one of claims 26, 27, 30 or 40, wherein in the data analysis device, the Kraken method is used for classification of microbial species.
45. The system of claim 44, wherein the microorganism species classification using the Kraken method comprises the following units:

    the database construction unit is used for constructing a K-mer database according to the known genome data;

    the fragment generating unit is connected with the K-mer database constructing unit and is used for breaking each sequence into fragments of K-mers with preset lengths based on the sequence data subjected to the removal processing and obtained by the data screening unit;

    and the fragment comparison unit is connected with the fragment generation unit and compares the fragments of the preset length K-mer with a K-mer database, and further performs species classification on the sequence according to the principle of the nearest common ancestor.
46. The system of claim 45, wherein the K-mer database comprises sequence data from the following species: human genome, bacteria/archaea, viruses, fungi, protozoa, plasmids.

Images