CN110272900B

CN110272900B - sgRNA for preparing skeletal dysplasia pig model and application thereof

Info

Publication number: CN110272900B
Application number: CN201910317344.8A
Authority: CN
Inventors: 王勇; 谢飞; 谢杨丽; 周晓杨; 王露露; 魏泓; 陈林; 郭科男
Original assignee: Third Military Medical University TMMU
Current assignee: Third Military Medical University TMMU
Priority date: 2019-04-19
Filing date: 2019-04-19
Publication date: 2024-03-26
Anticipated expiration: 2039-04-19
Also published as: CN110272900A

Abstract

The invention belongs to the technical field of animal genome editing, and particularly relates to sgRNA for preparing a bone dysplasia pig model and application thereof. The invention aims to solve the technical problem that the existing animal model for the skeletal development abnormality of the mice and the human have great difference in skeletal structure and function. The technical means of the invention is to provide the sgRNA for preparing the bone dysplasia pig model. The sgRNA recognizes a target site with a nucleotide sequence 5'-GAAAGCCCAGCCCGTAGCTGAGG-3' on the porcine fibroblast growth factor receptor 3 editing gene. On the basis of obtaining the sgRNA, matched donor DNA is designed, a Fgfr3c.1132G > A accurate mutant pig model can be efficiently prepared, a FGFR3p.G378R mutant pig line with abnormal cartilage development is cultivated, and a large animal model which is closer to a human body is provided for bone development research and clinical treatment of bone diseases.

Description

sgRNA for preparing skeletal dysplasia pig model and application thereof

Technical Field

The invention belongs to the technical field of animal genome editing, and particularly relates to sgRNA for preparing a bone dysplasia pig model and application thereof.

Background

Bone is one of the most diverse organs for developmental deformity and genetic diseases, and more than 400 single-gene skeletal genetic diseases are recorded in the online human Mendelian genetic disease database (OMIM). Common skeletal development deformities include dwarfism, spinal dysplasia, osteogenesis imperfecta, craniofacial deformity, hereditary bone metabolic diseases (bone sclerosis, rickets) and the like. At present, the most common animal model for the research of skeletal developmental diseases is a genetically engineered mouse, which is used as a model animal to carry out a lot of research around skeletal development and metabolic diseases. However, mice are rodents, which have great differences in bone structure and function from humans, such as the mouse bone has no haves system, the spine has no bony endplates, and the early pattern development and morphogenesis of the bone are different, the growth plate does not close for life, etc. In addition, repeated sampling (blood and urine) for metabolic related index detection, mechanical property measurement and operation (such as orthopedic surgery, branch office and tissue engineering material implantation, etc.) are difficult to realize due to the small size.

Pigs, especially small pigs, are basically consistent with human beings in terms of body weight, anatomy of bones, tissue structures (bone trabecula thickness, collagen arrangement, mineralization deposition rate, joint size and weight mechanics, articular cartilage thickness, intervertebral disc structure and composition, lumbar rotation angle and the like), development process and the like. At present, pigs are mainly used for evaluating biological materials, stem cell treatment, surgical instruments, surgical mode curative effects and the like in the process of repairing the injury of a bone joint and other movement systems, and research on bones by utilizing genetically modified pigs is lacking.

Fgfr3 (fibroblast growth factor receptor 3) is a key molecule for skeletal development regulation, and mutation of this molecule can lead to skeletal dysplasia. Among them, the point mutation Fgfr3c.1132G > A which can cause the 378 th glycine of FGFR3 protein to be mutated into arginine is the most common cartilage development disorder mutation in human clinic, but no genetic bone development abnormal pig and other large animal models are reported at present.

Disclosure of Invention

The invention aims to solve the technical problem that the existing animal model of the skeletal development abnormality of the mice and the human have great differences in skeletal structure and function.

The technical means for solving the technical problems is to provide the sgRNA for preparing the skeletal dysplasia pig model. The sgRNA recognizes a target site with a nucleotide sequence 5'-GAAAGCCCAGCCCGTAGCTGAGG-3' (SEQ ID NO. l) on the gene encoding the porcine fibroblast growth factor receptor 3.

Further, the guide sequence for identifying the target site in the sgRNA is as follows:

5’-GAAAGCCCAGCCCGTAGCTG-3’(SEQ ID NO.2)。

further, the nucleotide sequence of the sgRNA is:

5’-GAAAGCCCAGCCCGTAGCTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3’(SEQ ID NO.3)。

the invention also uses a donor DNA for being matched with the sgRNA for preparing the skeletal dysplasia pig model, wherein the codon encoding the 378 th glycine on the encoding gene of the fibroblast growth factor receptor 3 of pigs is mutated into arginine codon. Furthermore, the mutation of the codon encoding the 378 th glycine on the encoding gene of the fibroblast growth factor receptor 3 of the pig into the arginine codon refers to the mutation of Fgfr3c.1132G > A of the pig.

Wherein the donor DNA is double-stranded donor DNA or single-stranded donor DNA.

Preferably, the donor DNA comprises the following core sequence 5'-TTATA-3' (SEQ ID NO. 4), or the complement thereof.

Wherein, the two sides of the core sequence in the donor DNA contain homologous sequences of 50-70 bases.

Preferably, the nucleotide sequence of the donor DNA is:

5'-CCGAGGAGGAGCTGGTGGAGGCTGGTGAGGCTGGCAGTGTGTACGCGGGGGTCCTCAGTTATAGGCTGGGCTTTCTCCTCTTCATCCTGGTGGTGGCCACCGTGACACTCTGCCGCCTGCGCAGCCCCCC-3' (SEQ ID NO. 5) or a complement thereof.

On the basis, the invention also provides a kit for preparing the bone dysplasia pig model, which comprises the following components: the sgrnas described above and/or the donor DNAs described above. Further, the kit may further comprise mRNA encoding spCas9 protein and/or spCas9 recombinant protein. Further, each main component in the kit is independently packaged.

The invention also provides a method for preparing the bone dysplasia pig model. The method comprises the following steps:

a. after thoroughly mixing the above-mentioned sgrnas with mRNA encoding spCas9 and/or spCas9 purified recombinant protein, introducing the mixture into the cytoplasm of early embryo of pig by microinjection;

b. b, transplanting the early embryo of the pig treated in the step a into the oviduct of a recipient sow to enable the recipient sow to conception;

c. the pregnant recipient sow is born with piglets after gestation period, and a skeletal dysplasia pig model is obtained.

Wherein the proportion of the sgRNA, the donor DNA and the mRNA encoding spCas9 and/or the spCas9 purified recombinant protein in the method is 10-15 ng/uL of the sgRNA, 20-25 ng/uL of the spCas9 mRNA and/or the spCas9 purified recombinant protein and 5-10 ng/uL of the donor DNA according to the final concentration in the mixture.

Further, the porcine early embryo described in the above method is a 4-cell stage and prior embryo.

Further, the step c of the method further includes a detection and verification step: the piglet genomic DNA samples were amplified using the pFgfr3-E9-F1/R1 (Table 1) primers and sequenced based on the amplification results to determine if the expected genotype was present for gene editing (pFgfr 3c.1132G > A), indicating successful modeling if it was present.

The invention has the beneficial effects that: aiming at the most common mutation site Fgfr3c.1132G of human cartilage development disorder, the invention firstly finds the corresponding site of the pig Fgfr3 gene, designs a high-efficiency sgRNA site nearby, constructs a donor DNA which aims at the site and can effectively realize Fgfr3c.1132G > A mutation site-directed knock-in through a DNA (high-efficiency) homology-directed repair) mechanism, and can efficiently prepare the Fgfr3c.1132G > A accurate mutation pig model. Experiments show that the mutation efficiency of the first-built pig can reach up to 100%, and the precise mutation rate of FGFR3p.G378R realized by an HDR mechanism can reach up to 80%. The FGFR3p.G378R mutant pig line with abnormal development of the cultivated cartilage can be effectively cultivated through the cross-bred of the first-built pig; meanwhile, the sgRNA locus adopted by the invention can effectively induce the Fgfr3 gene of the pig to generate frame shift mutation, and the mutant pig with the Fgfr3 gene completely knocked out can be cultivated through the transverse cross-breeding of the first-built pig, and can be used as a large animal model with overgrowth of bones and lateral bending of the spinal column. The invention can provide a large animal model which is more similar to human for bone development research and clinical treatment of bone diseases with high efficiency, and has good application value.

Drawings

Fig. 1 experimental design scheme. A, human, mouse and pig FGFR3 coded protein amino acid sequence comparison results, and black boxes are human FGFR3 p.G380R mutant homologous amino acid sites. B, pig FGFR3 gene composition, homologous site is located in exon 9, thick arrow below is sgRNA, gray horizontal line is ssODN template, thick arrow on left side indicates transcription direction of gene. C, FGFR3-G378R-ssODN structure diagram. The A base marked is the target mutation base pFgfr 3c.1132G > A; the two grey T bases are two synonymous mutant bases (pFgfr 3 c.1131C > T and pFgfr3 c.1128C > T); the black letters and black lines on both sides of the mutant base are homologous sequences on both sides of the mutant base. D, working schematic of the sgRNA of the present invention (herein designated Fgfr 3-G378-sgRNA) and-donor DNA (herein designated Fgfr 3-G378R-ssODN) mediating the desired gene mutation. The arrow below the sequence shows the sgRNA recognition region, and the position shown by the scissor symbol is the spCas9 protein cleavage site; 3 bases AGG at the 3' -end of the recognition sequence is of a PAM structure; the underlined GGG base in the target gene recognition site is a codon for the 378 th glycine, wherein the gray marked G base is a pseudo-mutation target; the base A streaked in the donor DNA and the edited gene sequence is a target mutant base, and two gray T bases are synonymous mutant bases.

FIG. 2 shows the results of the genetic analysis of the first-established pigs. A, the PCR products of the No.9 exon gel electrophoresis result (Marker 100 bp) of pF1-1 to pF1-5 (left to right) ear tissue genome amplified pFgfr 3. B, sequence sequencing analysis results near the editing site of the genes numbered pF1-1 to pF1-5, in brackets: the number is the clone number containing the corresponding genotype/total effective sequencing clone number; KI: the expected gene knock-in genotype pFgfr 3c.1132g > a; other types of gene mutations are indicated by international naming rules; "PCR product" means that the genotype is the result of direct sequencing of the PCR product. C, sequencing peak diagram of each genotype of the individual, wherein the base in the black box is an expected mutation site based on homologous recombination of donor DNA, 2T bases are synonymous mutation bases, and A base is a target mutation base (Fgfr 3c.1132G > A); the black arrow indicates the base deletion mutation position (pFgfr 3 c.1124_1130 delCAGCT); the bases indicated by the circular boxes are insertion mutated bases.

FIG. 3 in vivo phenotypes of Fgfr3 frameshift mutant pigs and Fgfr3c.1132G > A heterozygous mutant pigs. A, photographs of 5 first-born piglets (wherein white arrows show pF1-3 individuals with frame shift mutations) and scoliosis phenotypes of pF1-3 individuals; photographs of B, fgfr3c.1132g > a heterozygous mutant pigs and wild-type pigs.

Fig. 4 shows the relative length of long bones of mutant pigs (< 0.05). Femur, femur; tibia, tibia; humerus, humerus; WT: wild type pigs; MT: mutant pigs.

FIG. 5 Wild Type (WT) and mutant pig (MT) X-ray examination (left: right upper limb: lower limb).

Fig. 6X photo shows the results of observation of the morphology of the pig head. MT: mutant pigs; WT: wild type pigs.

Fig. 7 Wild Type (WT) and mutant pig (MT) femur X-ray dual-energy bone density assays (×p <0.05;×p < 0.01). Relative BMD, relative bone density; total Femur, total Femur; midshaft, mid femur; distal: a femoral end; WT: wild type pigs; MT: mutant pigs.

Fig. 8 is a histological section of a metaphyseal porcine end. WT: wild type pigs; MT: mutant pigs.

FIG. 9 is a histological section of a pig growth plate. WT: wild type pigs; MT: mutant pigs.

Detailed Description

The invention is further described by the following description of specific embodiments.

The invention searches the homologous locus of the corresponding pig Fgfr3 gene through researching the sequence of the common cartilage development disorder mutation locus (the first base G of the 380 th glycine encoding FGFR3 protein) in human clinic. Through further research, a highly efficient sgRNA targeting site (named as pFgfr 3-G378-sgRNA) was selected on the antisense strand near the homologous site, see FIG. 1,

the guide sequence for identifying the target site is as follows: 5-GAAAGCCCAGCCCGTAGCTG-3；

The target site sequence of the recognition on the pig fibroblast growth factor receptor 3 gene is as follows:

wherein the black bolded 3 bases are PAM structures, and the underlined part is the complementary base of the codon GGG encoding glycine 378.

The invention also designs a preferred sgRNA, the nucleotide sequence of which is:

5’-GAAAGCCCAGCCCGTAGCTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3’。

aiming at the recognition site of the sgRNA, the homologous mutation Fgfr3c.1132G which can efficiently realize the most common cartilage development disorder in human clinic in the porcine Fgfr3 gene is designed>A DNA homologous recombination template (donor DNA). The donor DNA needs to contain the following core sequences: 5' -TTATA-3'; wherein the scored base is a mutant base, wherein 2 scored T bases are synonymous mutant bases, and the scored A base is the target mutant base. Generally, in practical use, the donor DNA needs to have a homologous sequence of 50 to 70 bases on both sides of the aforementioned core sequence.

Furthermore, it is also preferable that a donor DNA (designated as Fgfr 3-G378R-ssODN) is obtained according to the present invention, which has the nucleotide sequence:

wherein the black thickened base sequence is a core sequence, 2 marked T bases are synonymous mutant bases, and marked A bases are target mutant bases; the bases indicated in italics are homology arm sequences. The donor DNA comprises Fgfr3c.1132G > A mutation which can lead the 378 th glycine of the pig FGFR3 protein to mutate into arginine, 2 synonymous base mutations, fgfr3 c.1131C > T and Fgfr3 c.1128C > T are respectively introduced into codons (TAC and AGC) which code for the 377 th tyrosine and 376 th serine of the pig FGFR3 protein, so as to inhibit the pgfr 3-G378-sgRNA/spCas9 protein complex from re-cutting mutation sites after homologous recombination; the two sides of the mutant base respectively contain homologous sequences of 50-70 bases so as to realize homologous recombination and knocking-in of mutant sites.

In one example of the present invention, based on the pFgfr3-G378-sgRNA site and donor DNA designed by the present invention, the skilled artisan can introduce the above sgrnas, donor DNA, and mRNA encoding spCas9 and/or spCas9 purified recombinant protein into the cytoplasm of porcine early embryo by microinjection after thoroughly mixing the above sgrnas, donor DNA with the genome editing system of CRISPR/Cas9 and microinjection technique; then the treated early embryo of the pig is transplanted into the oviduct of the recipient sow, so that the recipient sow is pregnant; the pregnant recipient sow is born with piglets after gestation period, and a skeletal dysplasia pig model is obtained.

Wherein, the proportion of the sgRNA, the donor DNA and the mRNA encoding the spCas9 and/or the spCas9 purified recombinant protein is 10-15 ng/uL, 20-25 ng/uL and 5-10 ng/uL of the donor DNA according to the final concentration of the sgRNA, the spCas9 mRNA and/or the spCas9 purified recombinant protein in the mixture.

Further, the porcine early embryo described in the above method is a 4-cell stage and prior embryo. In order to detect whether the modeling is successful or not by the method, a piglet genome DNA sample can be amplified by using a primer, and whether the piglet genome DNA sample contains an expected gene editing genotype (pFgfr 3c.1132G > A) or not is determined by sequencing according to the amplification result, and if the piglet genome DNA sample contains the expected gene editing genotype, the modeling is successful. The present invention also provides an effective primer for detection pFgfr3-E9-F1/R1 (see Table 2).

In one example of the invention, by utilizing the pFgfr3-G378-sgRNA locus and the Fgfr3-G378R-ssODN template designed by the invention, the corresponding in vitro transcribed sgRNA and the artificially synthesized single-stranded DNA template as well as the spCas9 mRNA are simultaneously introduced into fertilized eggs in the 1-2 cell stage of pigs through microinjection, and the injected fertilized eggs are transplanted into the oviduct of adult sow in oestrus, the mutated pig (FGFR 3p.G378R mutated pig) with the glycine at the 378 th position of FGFR3 protein mutated into arginine is efficiently obtained, the mutation efficiency of the first-established pig can reach 100%, and the precise mutation rate of the FGFR3p.G378R realized through an HDR mechanism can reach 80%. The FGFR3p.G378R mutant pigs with abnormal development of the cultured cartilage are effectively cultivated by cross-breeding of the first-established pigs. The sgRNA locus adopted by the invention can effectively induce the pig Fgfr3 gene to generate frame shift mutation, and the transverse cross-bred breed of the first-built pig can be used for cultivating a mutant pig with the Fgfr3 gene completely knocked out, and the mutant pig can be used as a large animal model with excessive bone growth and lateral bending of the spinal column.

The present invention will be described in more detail with reference to examples.

EXAMPLE FGFR3p.G378R mutant pig production

1. Experimental protocol:

1. preparation of homologous recombination templates

Artificially synthesizing single-stranded oligonucleotides (ssODN, < 150 bp) according to the designed sequence of the homologous recombination template (Shanghai process); the synthesized freeze-dried powder of ssODN was dissolved in RNase-free ultra-pure water at a concentration of 500ng/uL and sub-packaged and stored at-80 c for use.

2. Preparation of sgRNA

1) Two complementary single strands DNA (oligo DNA) of oligonucleotides containing the sgRNA recognition sequence, the sense strand (SEQ ID No. 6) were synthesized: 5-TAGGAAGCCCAGCCCGTAGCTG-3; antisense strand (SEQ ID No. 7): 5-AAACCAGCTACGGGCTGGGCTT-3. After the two complementary single-stranded DNA are renatured into double chains, the tail ends of the two complementary single-stranded DNA are complementary with the subcloning sites of the sgRNA in-vitro transcription plasmid after enzyme digestion; the sgRNA in vitro transcription plasmid used in this example was pUC57kan-T7-gRNA-U6V2 (Addgene #115520, y, bsaI for subcloning);

2) 1OD of each synthesized single-stranded oligo DNA is taken, dissolved in deionized water at the concentration of 0.2ug/uL, and split-packed at 20 uL/tube for standby;

3) Taking 1 tube of complementary single-stranded oligo DNA solution, mixing the solution in equal volume, fully mixing the solution, and then incubating the solution in a water bath kettle containing 1L of tap water at 95 ℃ for 10min so as to fully denature two complementary single-stranded oligo DNAs into a single-stranded state;

4) Turning off the power supply of the water bath kettle, naturally cooling the water bath kettle, and enabling the complementary single-strand oligo DNA to be renatured into a double-strand state;

5) The BsaI is used for fully digesting the sgRNA in vitro transcription vector plasmid pUC57Kan-T7-gRNA-U6V2, and a linear plasmid fragment is recovered;

6) Ligating the double-stranded DNA obtained in step 4) with the linear plasmid fragment obtained in step 5) by using T4 DNA ligase to obtain a recombinant plasmid;

7) The connection product of the step 6) converts competent bacteria, picks kanamycin-resistant colonies, and carries out amplification culture to obtain resistant bacteria liquid;

8) Extracting recombinant plasmid by using a resistant bacterial liquid, and sequencing and verifying;

9) The plasmid obtained in the step 8) is completely digested and sequenced by using endonuclease DraI to verify correctness, so that complete and complete linearization of the recombinant plasmid is realized;

10 Purifying the linear plasmid DNA and removing rnase contamination;

11 Fully washing the DNA precipitate with 70% ethanol without RNase, and then dissolving the DNA precipitate with deionized water without RNase;

12 1ug of the purified linear plasmid obtained in step 11) was used as a template, and in vitro transcription was performed using an in vitro transcription Kit MEGAshortscriptTM T7 transcription Kit (invitrogen, U.S. catalog number AM 1354) to obtain sgrnas (see the Kit description for details of the procedure);

13 The in vitro transcription product obtained in step 12) was purified using a MEGAClear Transcription Clean-Up Kit (Invitrogen, U.S. catalog number AM 1908) and kept in 5-10 uL/tube for further use depending on the concentration (see Kit instructions for the procedure).

3. Preparation of Cas9 mRNA

1) Preparation of transcription templates:

plasmid pST1374-N-NLS-flag-linker-Cas9 (Addgene, USA, catalog # 44758) was digested with AgeI endonuclease well (overnight), and the remaining steps were followed in preparation of an sgRNA in vitro transcription template.

2) In vitro transcription:

cas9 mRNA was transcribed using mMESSAGE mMACHINE T Ultra kit (invitrogen, usa, cat. No. AM 1345), and the experimental procedures are detailed in the kit instructions. After transcription was completed, 1ul Turbo DNase,37 ℃was added to the system and incubated for 15min to remove the residual template DNA.

3) Tail adding:

(1) The following reagents were added sequentially to the T7 Ultra Reaction system:

TABLE 1 reagent system

(2) After mixing, 2.5ul mix was aspirated as a control; 4ul of E-PAP enzyme was added and incubated at 37℃for 45min after mixing.

4) And (3) mRNA purification and recovery:

mRNA was purified and recovered using RNAeasy kit from Qiagen:

(1) Adjusting the template to 100ul with NFW water;

(2) Adding 350ul of RLT Buffer, and fully and uniformly mixing;

(3) Adding 250ul of absolute ethyl alcohol, and uniformly mixing;

(4) Transferring into a column with the kit, and centrifuging for 15s, wherein the weight of the column is more than or equal to 8000 g;

(5) Discarding the waste liquid in the collecting pipe, adding 500ul Buffer RPE (reactive power of the waste liquid) to be more than or equal to 8000g, and centrifuging for 15s;

(6) Repeating the steps;

(7) Transferring the column into a new 2ml collecting pipe, and idling for 1min;

(8) The column was placed in a 1.5ml centrifuge tube, 40ul of RFW, at > 8000g,1min was added;

(9) Taking 2uL of measured concentration, subpackaging the mRNA solution into an EP tube without RNase according to the volume of 1-5 uL/tube according to the concentration, and placing the subpackaged mRNA solution into a refrigerator at-80 ℃ for freezing.

(10) Taking 1 tube of mRNA for electrophoresis, and taking mRNA before tailing as a control, and detecting the quality and tailing effect of the mRNA (the band position of the mRNA after tailing is slightly delayed from that of the mRNA before tailing). Cas9 mRNA was diluted to 20ng/ul prior to use.

4. Acquisition of early embryo of pig, microinjection and transplantation of CRISPR reagent:

1) Acquisition of early embryo of pig

(1) Selecting 3-5 healthy mature sows in estrus, and using the healthy mature sows as embryo donor sows after mating with healthy mature boars, and preparing another healthy mature sow in estrus as acceptor sows;

(2) After 24-36h of hybridization of the donor sow, 10-15mL of pentobarbital sodium solution with the mass fraction of 3% is injected through the ear margin vein, or the general anesthesia of the donor sow is realized through a respirator by using isoflurane, and the sow is bound on a V-shaped operating table;

(3) After the abdomen of the sow is cleaned and disinfected conventionally, the skin, fascia, muscle and peritoneum of the abdomen are cut along the normal midline of the abdomen between the first nipple and the third nipple of the sow, and the incision size is 5 cm to 8cm;

(4) Taking out the ovary, oviduct and partial uterus of the sow, wherein an ovulation bleeding point on the surface of the sow ovary is visible at the time, so that the sow is indicated to be ovulated;

(5) The glass catheter with the inner diameter of 4-6mm and the passivated two ends is inserted into the oviduct through the oviduct umbrella part;

(6) Drawing about 20mL of embryo flushing liquid (PBS+1% fetal calf serum) fully incubated in a water bath at 38 ℃ by using a syringe, connecting the syringe containing the embryo flushing liquid with a fallopian tube cavity by using an intravenous infusion needle (one end containing a needle is inserted into the fallopian tube cavity through a joint of the fallopian tube and uterus, and the other end is connected with the syringe);

(7) Injecting the embryo flushing liquid into the oviduct through a syringe, and collecting the embryo flushing liquid flowing through the oviduct and flowing out of a glass catheter inserted into an umbrella part of the oviduct by using a sterilized 50mL centrifuge tube;

(8) Transferring the collected embryo flushing liquid into a sterile culture dish with the diameter of 9cm, and picking up embryos under a stereoscopic microscope, wherein the embryos picked up at the moment are generally in the 1-cell or 2-cell stage, as shown in fig. 7;

(9) Placing the picked pig embryo into culture solution drops which are covered with paraffin oil and are fully incubated and balanced in an incubator for culturing for standby (the pig embryo culture solution used in the present case is PZM-3, and the formula is shown in the document Biology of Reproduction,2002, 66:112);

2) Microinjection of porcine early embryo:

the sgrnas, spCas9 mRNA and homologous recombination template DNA (donor DNA) prepared in the steps above were thoroughly mixed at final concentrations of sgRNA10 ng/uL, spCas9 mRNA 20ng/uL and donor DNA 10ng/uL, respectively, and the mixed solution was injected into the cytoplasm of the early embryo of swine by microinjection. For details, see Hogan et al, managing Mouse Embryo Manipulation Manual, cold Spring Harbor Laboratory Press,1994,Second Edition.

3) Pig embryo transfer

(1) Anesthetizing and stabilizing the recipient sow, cutting the abdominal cavity, taking out the ovary, oviduct and part of uterus in the same way as embryo acquisition;

(2) Connect a embryo picking pipette (Agtech, USA) with a 1mL syringe and pre-draw a length of air into the embryo picking pipette;

(3) Sucking 20-30 injected embryos in the culture solution into an embryo picking straw through a connected injector under a stereoscopic microscope (note that a section of air is sucked before the liquid section of the embryos is positioned, and a section of liquid is sucked before the air so as to prevent pollution);

(4) Inserting an embryo picking straw filled with embryos into a oviduct of a receptor pig through an umbrella part, pushing a syringe to guide the embryos into the oviduct;

(5) Placing uterus, oviduct and ovary of a receptor pig back into the abdomen, sequentially suturing the peritoneum, muscle, fascia and skin, and performing conventional disinfection treatment on the wound; the pregnant recipient sow can produce piglets after gestation is over.

5. Genetic analysis of genetically mutated pigs

1) Cutting ear tissues of the mutant pigs and extracting genome DNA;

2) Primers are selected at the upstream and downstream of the exon where the mutation target site is located, and amplified products near the target site are obtained through PCR amplification;

3) Directly sending the PCR product to sample for sequencing, and if the sequencing result is a single sequencing peak, indicating that the mutant individual is homozygote; if the sequencing result contains a set peak, the mutant individual is indicated to be heterozygote;

4) And (3) performing TA cloning on PCR amplification products of heterozygote individuals, transforming competent bacteria to obtain resistant transformed colonies, randomly picking about 20 transformed colonies for each individual, carrying out sample feeding and sequencing, and determining genotypes of mutant individuals.

2. Experimental results

1. Results of sequence analysis and design

By comparing the amino acid sequences of the proteins encoded by the human, pig and mouse Fgfr3 genes on NCBI (FIG. 3-1A), the 380 rd glycine of the site of the human achondroplasia mutation was found to be the 378 th glycine at the corresponding site of the pig. The reference gene sequence of porcine Fgfr3 at NCBI was aligned and this site was determined to be located at exon 9 of porcine Fgfr3 (pFgfr 3) (FIG. 1B). Designing primer according to the reference gene sequence to amplify the No.9 exon for sequencing to obtain the accurate base sequence of the miniature Bama pig, and finding that the homologous mutation site of the miniature Bama pig pFr 3 gene is c.1132G>A, resulting in mutation of the coding amino acid codon GGG to AGG, thereby causing mutation of glycine to arginine. A high efficiency sgRNA site (named pFgfr 3-G378-sgRNA) was selected and its sequence was:wherein the thickened and marked AGG base has a PAM structure, and the streaked portion is a complementary base of the GGG codon encoding glycine 378.

The sgRNA locus is designed and screened to obtain a DNA homologous recombination template (donor DNA, named as pFgfr 3-G378R-ssODN) capable of efficiently realizing the homologous mutation pFgfr 3c.1132G > A of the most common cartilage dysplasia in human clinic in the pFgfr3 gene (fig. 3-1C): the template comprises a pFgfr 3c.1132G > A mutation which can lead the 378 th glycine of the pig FGFR3 protein to be mutated into arginine, and simultaneously 2 synonymous base mutations, namely pFgfr3 c.1131C > T and pFgfr3 c.1128C > T, are respectively introduced into codons (TAC and AGC) which code for the 377 th tyrosine and 376 th serine of the pig FGFR3 protein, so as to inhibit the pFgfr3-G378-sgRNA/Cas9 protein complex from re-cleavage of mutation sites after homologous recombination. To achieve homologous recombination and knock-in of the mutation site, 65 base homologous sequences were added on both sides of the above mutation base, respectively. The results of the sequence analysis and experimental design of this example are shown in FIG. 1.

2. Preparation and genetic analysis of genetically mutated first-established pigs

5 head of the first pig with gene editing is obtained through embryo transplantation. Genomic DNA was extracted from ear tissues by cutting, and the target fragment was amplified with pFgfr3-E9-F1/R1 (Table 2) primers to obtain PCR products (FIG. 2, A). Directly sending the PCR product to the PCR product for sequencing, and if the PCR product is a single sequencing peak, determining that the mutant individual is homozygote, and directly determining the genotype of the mutant individual; if the PCR product is a sequencing sleeve peak, TA cloning is carried out on the PCR product, after transformation of competent bacteria to obtain transformation-resistant colonies, 20 colony samples are randomly selected from each individual to carry out Sanger sequencing. Analysis finds that: among 5 (numbered pF1-1 to pF 1-5) pigs, the sequencing result of PCR products of the gene editing sites of 4 individuals (numbered pF1-1, pF1-2, pF1-4 and pF 1-5) was single-peaked, and the analysis and comparison revealed that the 4 individuals were homozygotes of the expected gene editing genotype (pFgfr 3c.1132G > A) by analyzing the genotype; the PCR products numbered pF1-3 were sequenced as a set of peaks, sequenced by TA cloning and out of 12 valid sequencing clones: the 1 pFgfr 3c.1132G > A mutant genotype, the 6 pFgfr3 c.1127_1128 insTA genotype, the 4 pFgfr3 c.1127_1128 insG genotype, and the 1 pFgfr3 c.1124_1130delCAGCT genotype indicated that the individuals were genetically highly chimeric individuals (FIGS. 2B, C). Genotype statistics for 5 first-established pig individuals are shown in Table 3.

Table 2 genetic analysis of amplification primers.

TABLE 3 first-established pig genotype statistics

From the above data, it can be seen that: using the selected sgRNA sites and designed donor DNA of the present invention, 80% of individuals in the first pig were homozygous mutant individuals with the expected knock-in genotype (pFgfr 3c.1132G > A), indicating that the sgRNA sites (pFgfr 3-G378-sgRNA) and donor DNA (pFgfr 3-G378-ssODN) used in the present invention had extremely strong gene editing activity; the FGFR3p.G378R homozygous or heterozygous mutant pig with abnormal cartilage development, namely the miniature Bama pig Achondroplasia (ACH) model, can be cultivated by cross-breeding the first pig with the gene mutation. Meanwhile, the gene editing reagent selected and designed by the invention can also be used for obtaining the genotype of the Fgfr3 gene with frame shift mutation, and the mutant pig with the Fgfr3 gene completely knocked out can be cultivated through the transverse cross breeding of the first-built pig, and can be used as an animal model with overgrowth of bones and lateral bending of the spinal column.

3. Phenotypic analysis of genetically mutated pigs

Among the 5 head pigs obtained, individuals pF1-3, mainly with frameshift mutation, present a phenotype of significant limb lengthening (fig. 3A); necropsy findings were performed on pF1-3 individuals: the spine exhibited a pronounced lateral curvature phenotype (fig. 3A), which was consistent with the phenotype of clinical and animal models (mice) of the fcfr 3 gene knock-out mutation. The sgRNA of the invention can be used for preparing a pFgfr 3c.1132G > A point mutation model and also can be used for efficiently preparing a scoliosis animal model knocked out by pFgfr 3.

To exclude the possible genetic chimeric effect of the first-established animal, male first-established pigs pF1-5 with ear tissues homozygous for the expected gene knock-in mutation (pFgfr 3c.1132G > A) are selected for breeding with wild sows to obtain F1 generation pFgfr 3c.1132G > A heterozygous mutant individuals and wild individuals with littermates. The discovery is as follows: compared with normal individuals of littermates, individuals with heterozygous mutations of F1 generation pFgfr 3c.1132G > A exhibited obvious symptoms of shortness of limbs (FIG. 3B), which is consistent with previous studies in human clinical and mouse models.

Further analysis of the skeletal development phenotype of the mutant pigs revealed that the lengths of the long bones such as tibia, femur and humerus were significantly shortened compared to the wild ones, respectively 84.4%, 84.5% and 90.8% of the control (see fig. 4). Further, by observation through an X-ray film, the transmittance of the long epiphyseal part of the ACH pig is obviously reduced compared with that of a wild pig under the same projection condition (figure 5); the cranium is bluntery than the wild pig, the projected area of the cranial cavity is obviously reduced, the length is easy to be shortened, and the width is obviously narrowed (figure 6).

Because the radiograph cannot quantify bone mass, and the femur is subjected to X-ray dual-energy bone density measurement, the result shows that the total femur, the middle femur bone density and the terminal metaphyseal bone density of the mutant pig are respectively reduced by 7.2%, 8.4% and 9.8% compared with the wild pig (figure 7). The above results indicate that the function enhancing mutation of FGFR3 after mutation can lead to reduced bone mass in the mutated pigs.

FGFR3 expression primarily affects the endochondral osteogenesis process. The growth plate is the motive force for the growth of long bones. Preliminary observations by pig metaphyseal histological sections revealed that mutant pig matrix deeply stained hypertrophic chondrocytes decreased (fig. 8); further analysis of growth plate phenotype revealed that growth plates of wild pigs were orderly divided into resting zone, proliferation zone and hypertrophic zone, while growth plate columnar structure of mutant pigs was arranged in disorder, small scattered small and round resting chondrocytes were seen in each zone, suggesting that growth plate development process was significantly affected (fig. 9).

Sequence listing

<110> Chinese people's university of Legend army medical university

<120> sgRNA for preparing porcine model of skeletal dysplasia and use thereof

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

gaaagcccag cccgtagctg agg 23

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

gaaagcccag cccgtagctg 20

<210> 3

<211> 96

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

gaaagcccag cccgtagctg gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgc 96

<210> 4

<211> 5

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

ttata 5

<210> 5

<211> 130

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

ccgaggagga gctggtggag gctggtgagg ctggcagtgt gtacgcgggg gtcctcagtt 60

ataggctggg ctttctcctc ttcatcctgg tggtggccac cgtgacactc tgccgcctgc 120

gcagcccccc 130

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

taggaagccc agcccgtagc tg 22

<210> 7

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

aaaccagcta cgggctgggc tt 22

<210> 8

<211> 26

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

ccgaggagga gctggtggag gctggt 26

<210> 9

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

ctgtcgcttg agcgggaagc ggga 24

Claims

1. A kit for preparing a porcine model of skeletal dysplasia comprising the following components: preparing sgrnas of a skeletal dysplasia pig model, donor DNA used in conjunction with the sgrnas, mRNA encoding spCas9 protein, and/or spCas9 recombinant protein;

wherein the nucleotide sequence of the sgRNA is shown as SEQ ID NO. 3;

the nucleotide sequence of the donor DNA is shown as SEQ ID NO.5 or the complementary sequence of the SEQ ID NO. 5.

2. The kit for preparing a porcine model of skeletal dysplasia according to claim 1, wherein: the donor DNA is as follows: double-stranded donor DNA or single-stranded donor DNA.

3. A method of preparing a porcine model of skeletal dysplasia comprising the steps of:

a. after thoroughly mixing sgrnas from which a porcine model of skeletal dysplasia was prepared, donor DNA for use in combination with sgrnas from which a porcine model of skeletal dysplasia was prepared to mutate the codon encoding glycine 378 to an arginine codon on the porcine fibroblast growth factor receptor 3 encoding gene, mRNA encoding spCas9, and/or spCas9 purified recombinant protein, the mixture was introduced into the cytoplasm of the porcine early embryo by microinjection;

c. the pregnant recipient sow gives off piglets after gestation period, and a skeletal dysplasia pig model is obtained;

the nucleotide sequence of the sgRNA for preparing the skeletal dysplasia pig model is as follows: SEQ ID NO. 3;

4. A method according to claim 3, characterized in that: the proportion of the sgRNA, the donor DNA and the mRNA encoding the spCas9 and/or the spCas9 purified recombinant protein is 10-15 ng/uL, 20-25 ng/uL and 5-10 ng/uL of the donor DNA according to the final concentration of the sgRNA, the spCas9 mRNA and/or the spCas9 purified recombinant protein in the mixture.

5. A method according to claim 3, characterized in that: the early embryo of the pig is an embryo in 4 cell phases and before.

6. The method according to any one of claims 3 to 5, wherein said step c further comprises a detection verification step of: the piglet genome DNA sample is amplified by using the primer pair pFgfr3-E9-F1/R1 shown in SEQ ID NO.8 and SEQ ID NO.9, and whether the piglet genome DNA sample contains a desired gene editing genotype pFgfr 3c.1132G > A or not is determined by sequencing according to the amplification result, and if the piglet genome DNA sample contains the genotype, the modeling is successful.