CN110257537A - Solution hybridization for syphilis pathogen detection captures library and its construction method - Google Patents
Solution hybridization for syphilis pathogen detection captures library and its construction method Download PDFInfo
- Publication number
- CN110257537A CN110257537A CN201910596979.6A CN201910596979A CN110257537A CN 110257537 A CN110257537 A CN 110257537A CN 201910596979 A CN201910596979 A CN 201910596979A CN 110257537 A CN110257537 A CN 110257537A
- Authority
- CN
- China
- Prior art keywords
- sequence
- syphilis
- library
- solution hybridization
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B40/00—Libraries per se, e.g. arrays, mixtures
- C40B40/04—Libraries containing only organic compounds
- C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The present invention provides a kind of for the solution hybridization capture library of syphilis pathogen detection and its construction method.Solution hybridization capture probe library includes syphilis genome sequence and human genome canonical sequence；The syphilis genome sequence intercepts 50-70bp every 10-20bp, obtains probe sequence；Acquired probe sequence is compared with pathogen database, chooses the probe sequence for wherein specifically comparing the sequence in syphilis as solution hybridization capture library.Rational design of the solution hybridization capture library of syphilis pathogen detection of the invention for target acquistion region, ensure that the homogeneity in each region solution hybridization capture probe library, can greatly improve detection sensitivity and accuracy.
Description
Technical field
The invention belongs to technical field of molecular biology, are related to a kind of solution hybridization capture for syphilis pathogen detection
Library and its construction method.
Background technique
Infectious diseases is one of the main reason for causing human diseases at present.It was predicted that annual about 40,000,000 people in the whole world
Infection, 500,000 is dead.Chinese annual about 15,000,000 infection, 200,000 is dead.Detection for infectious sample, current main inspection
Survey method or immunology/molecular biology and based on being separately cultured.Clinical infection patient's types of presentation is varied, mainly has
Bloodstream infection, nervous system infection, respiratory tract infection and alimentary canal infect syndrome, and the pathogen for causing people to infect is a variety of
Multiplicity, including bacterium, fungi, virus, helminth, mycoplasma, Chlamydia, rickettsia, conveyor screw etc..Many cause of disease body-sensings
Dye can cause different clinical phenotypes, and different pathogenic infections can also cause same clinical manifestation, this is also determined
The diversity and complexity of detection method.Traditional the pathogenic microorganism examination means include the immunological method based on antigen-antibody
It can no longer meet the needs that unknown pathogen body quickly detects with the method based on detection of nucleic acids.Therefore, a kind of general quick
Method is particularly important for acute infection patient.And two generation sequencing technologies are with can be once parallel to hundreds of thousands to millions of
DNA molecular carries out sequencing, and the gene sequence information of institute's test sample sheet is obtained by bioinformatic analysis.Two generation sequencing technologies
The primary confirmation means for having become epidemic situation caused by new hair burst pathogenic microorganism both at home and abroad, such as China tick worm in 2009
Disease, the Influenza A H1N1 started in 2009 and H7N9 influenza in 2013.Worldwide, occur there are also in May, 2011
The super drug resistance Klebsiella Pneumoniae Oxa4 epidemic situation of Holland occurred German Escherichia coli O104:H4 epidemic situation in July, 2011, and
World-shaking West Africa Ebola virus epidemic situation in 2014.In recent years, it with the reduction of two generation sequencing costs, has come into
During routine clinical is examined, U.S. FDA and China CFDA have successively promulgated guideline, solve current Clinical Acute Infections and severe
The difficult problem of infected patient diagnosis.
Wherein syphilis is a kind of typical infectious diseases, and syphilis is systemic disease caused by microspironema pallidum.Generally
Syphilis is divided into three phases: primary syphilis (such as infection site ulcer or chancre), mesosyphilis (including but not limited to fash, skin
Skin non-cancer lesion and lymph node pathological change) and tertiary syphilis (such as heart disease or gumme).The disease incidence of syphilis is in recent years year by year
It increases, is the Category B notifiable disease that attract great attention.
Latent syphilis, also referred to as latent syphilis clinical manifestation be symptom and sign without any syphilis, but its have it is higher
Infection risk.Primary syphilis chancre and mesosyphilis all have self limiting, and generally leave no trace, and such as fail to treat or control
Treat it is unsuccessful, then enter the latent syphilis stage.
And nerve syphilis is one kind of more difficult diagnosis among these, neurolues is that microspironema pallidum invades central nervous system
The caused chronic systemic infection disease of system.The course of disease may alternatively appear in each period (including early syphilis) of syphilis, show as
Function of cranial nerves obstacle, meningitis, cerebral apoplexy, acute lesion, hearing and the visual impairment of neural state etc..
Therefore, in view of syphilis complicated clinical manifestation, misdiagnosis rate is high, and there is an urgent need to one kind can be quick, sensitive, convenient, quasi-
The really method and kit of detection syphilis.
Summary of the invention
In one embodiment, the present invention provides a kind of solution hybridization capture library for syphilis pathogen detection,
Solution hybridization capture probe library includes: syphilis genome sequence and human genome canonical sequence；The syphilis genome
Sequence intercepts 50-70bp every 10-20bp, obtains probe sequence；Acquired probe sequence and pathogen database are compared
It is right, choose the probe sequence for wherein specifically comparing the sequence in syphilis as solution hybridization capture library；The genome reference
Sequence guarantees solution hybridization capture effect as internal reference, is selected from human genome conserved sequence.
In one embodiment, the syphilis genome sequence is No. GenBank: CP003679.1 sequence.
In one embodiment, the syphilis genome sequence intercepts 65bp every 12bp, obtains probe sequence；By institute
It obtains probe sequence to be compared with pathogen database, chooses the sequence wherein specifically compared in syphilis and caught as solution hybridization
Obtain the probe sequence in library.
In one embodiment, the human genome conserved sequence chooses EFTUD2 gene and/or SDHA Gene Partial
Sequence is as human genome canonical sequence；The EFTUD2 gene intercepts 50-70bp every 10-20bp, obtains human genome ginseng
According to sequence；The SDHA gene intercepts 50-70bp every 10-20bp, obtains human genome canonical sequence.
In one embodiment, EFTUD2 gene and/or SDHA Gene Partial sequence are chosen as human genome reference
Sequence, the EFTUD2 gene intercept 65bp every 16bp, obtain human genome canonical sequence；And/or the SDHA gene is every
65bp is intercepted every 16bp, obtains human genome canonical sequence.
In one embodiment, the present invention provides a kind of solution hybridization capture library for syphilis pathogen detection
Construction method, which is characterized in that the described method comprises the following steps: step 1: design syphilis genome sequence and human genome ginseng
According to sequence, the syphilis genome sequence intercepts 50-70bp every 10-20bp, obtains probe sequence；By acquired probe sequence
It is compared with pathogen database, chooses the probe for wherein specifically comparing the sequence in syphilis as solution hybridization capture library
Sequence；The genome canonical sequence guarantees solution hybridization capture effect as internal reference, is selected from human genome conserved sequence；
Step 2: by the design syphilis genome sequence and human genome canonical sequence, downstream is separately added into the synthesis of primer pond on it
Universal primer sequence, so that subsequent PCR amplification is prepared needed for probe；Step 3: being carried out using the upstream and downstream universal sequence primer
The solution hybridization capture probe library with biotin labeling is prepared in PCR amplification.
In one embodiment, the syphilis genome sequence is No. GenBank: CP003679.1 sequence；And/or
The human genome conserved sequence chooses EFTUD2 gene and/or SDHA Gene Partial sequence as human genome canonical sequence；
The EFTUD2 gene intercepts 50-70bp every 10-20bp, obtains human genome canonical sequence；The SDHA gene is every 10-
20bp intercepts 50-70bp, obtains human genome canonical sequence.
In one embodiment, the primer pond synthesis upstream universal primer sequence is SEQ No.1:
TGTAATACGACTCACTATAGGGAGA；It is SEQ No.2 with primer pond synthesis downstream universal primer sequence:
TGTAATACGACTCACTATAGGGAGA；The sequential structure of the primer pond synthesis is: TGTAATACGACTCACTATAGGGA
GANNNNNTGAGACGCGACCACGAA, wherein wherein the NNNNN of overstriking represents a variety of Insert Fragment sequences, i.e. syphilis genome
The probe sequence that sequence and/or human genome canonical sequence intercept.
In one embodiment, the solution hybridization capture probe with biotin labeling is prepared by PCR amplification
In the reaction system of the PCR of library step, when the ratio of dUTP and dTTP are 1:3.
In one embodiment, the solution hybridization capture probe with biotin labeling is prepared by PCR amplification
It recycles to obtain solution hybridization capture probe library by secondary magnetic beads for purifying after PCR amplification in the step of library.
Sequent synthesis technology is high in solution hybridization capture probe library constructed by the present invention, composition sequence accuracy rate compared with
Height, accuracy rate can reach 99.8%, ensure that the accuracy in solution hybridization capture probe library, and then guarantee higher capture effect
Rate performance.Meanwhile the uniform of each region solution hybridization capture probe library ensure that for the rational design in target acquistion region
Property, detection sensitivity and accuracy can be greatly improved.
The present invention provides selective enrichment syphilis pathogen sequence fragments in a kind of plasma DNA sample from people
Method greatly increases syphilis pathogen detection sensitivity and accuracy, to provide a kind of for the inspection of syphilis pathogen
The efficient and inexpensive detection kit surveyed.
In the present invention, the solution hybridization capture probe library of building can hybridize 1-4 sample simultaneously, and sample can pass through
Sample to be captured is first carried out sequencing library building by two generation banking process known to this field respectively, in addition different both-ends
Index label will carry out mixed in equal amounts plus the 1-4 sample of different both-end index, then with solution hybridization capture probe text
Library carries out hybrid capture, and the product of capture is finally carried out high-flux sequence, subsequent point of the target area of the different samples of capture
The index label added when analysis by building library distinguishes.
Specific embodiment
In order to make art technology field personnel more fully understand the technical solution in the application, below in conjunction with embodiment
The invention will be further described, it is clear that and described embodiments are only a part of embodiments of the present application, rather than whole
Embodiment.Based on the embodiment in the application, those of ordinary skill in the art are obtained without making creative work
The all other embodiment obtained, shall fall within the protection scope of the present application.
In each embodiment of the present invention, in order to make the reader understand this application better, many technical details are proposed.
But even if each claimed technical solution of the application also may be implemented without these technical details.Following embodiment
Quantitative experiment in, be setting three repeated experiments, results are averaged.
The syphilis pathogen detection solution hybridization capture probe library construction of the invention of embodiment 1
Specifically, by the present invention according to existing or acquired syphilis pathogen gene group information based on, building
It is directed to syphilis pathogen detection solution hybridization capture probe library.
Probe Library DNA sequence dna for solution hybridization capture wants specificity with higher, not by other homologous nucleic acids
The influence of sequence.The present invention obtains syphilis pathogen detection solution hybridization capture probe library in the following way, specifically describes
It is as follows:
1. probe designs: as described above, syphilis pathogen detection solution hybridization capture probe library includes two parts: 1. plums
Virus gene group sequence；2. human genome canonical sequence.Wherein syphilis genome sequence (No. GenBank: CP003679.1), size
About 1.14Mb intercepts 65bp every 12bp, 94792 probe sequences is obtained according to reference sequences, by obtained sequence and disease
Substance database is compared, have chosen wherein 92703 specifically compare sequences in syphilis as probe sequence.It chooses simultaneously
Human genome conserved sequence guarantees solution hybridization capture effect as internal reference, chooses EFTUD2 gene, SDHA Gene Partial sequence
Column are used as human genome canonical sequence, and EFTUD2 gene (is about 4.4k), intercept 50-70bp (about 4x covering) every 10-20bp,
2762 probe sequences are obtained；SDHA gene intercepts 50-70bp every 10-20bp, takes wherein 535 sequences.
In designed probe fragment, downstream is separately added into primer pond (oligo pool) synthesis universal primer sequence on it
Column, needed for preparing probe so as to subsequent PCR amplification, upstream is general draws for primer pond synthesis described in primer pond synthesis universal primer sequence
Object sequence is SEQ No.1:TGTAATACGACTCACTATAGGGAGA；It is with primer pond synthesis downstream universal primer sequence
SEQ No.2:TGTAATACGACTCACTATAGGGAGA；The sequential structure of the primer pond synthesis is: TGTAATACGACTCA
CTATAGGGAGANNNNNTGAGACGCGACCACGAA, wherein the NNNNN of overstriking represents a variety of Insert Fragment sequences, i.e. syphilis
The probe sequence that genome sequence and/or human genome canonical sequence intercept.
2.PCR prepares liquid phase hybrid capture Probe Library: after above-mentioned primer pond synthesizes successfully, by the primer pond of dry powder
It is dissolved with the DNase/RNase free ddH20 of 50ul cleaning, is centrifuged after fulling shake.Drawn afterwards using upstream and downstream universal sequence
Object carries out PCR amplification and the solution hybridization capture probe library with biotin labeling is prepared.
Specifically, for above-mentioned technical proposal, in preferred situation, the PCR amplification system are as follows:
PCR amplification condition is as follows: 98 DEG C, 30S；98 DEG C, 10s, 60 DEG C, 30s, 72 DEG C, 30s, 14 circulations；72℃,
7min；4℃,∞.
Aforesaid operations are related to passing through optimization in the DNA product of the Biotin-11-dUTP incorporation synthesis of biotin labeling
The reaction system of PCR mainly optimizes the ratio of dUTP and dTTP, and when dUTP:dTTP is 1:3, amplification has Biotin-
The PCR product effect of 11-dUTP is best.
It recycles to obtain solution hybridization capture probe library by 2 × magnetic beads for purifying after PCR amplification.
2 present invention of embodiment constructs the application for the capture of syphilis pathogen detection solution hybridization
Specifically, the present invention constructs the detection kit for the capture of syphilis pathogen detection solution hybridization, reagent
The plasma sample dissociative DNA extracted is carried out sample library construction first by box, is repaired by end, is added " A " and connection procedure
DNA fragmentation is connected into both-end index connector, followed by building solution hybridization capture probe library with contain sample to be captured
The hybridization of this library DNA fragment is sequenced these DNA fragmentations after washing enrichment, by bioinformatic data analysis
Pattern detection result is obtained afterwards.The technical solution includes all experimentss process exported from plasma DNA to sequencing result, main
It to include that sample extraction, library construction, solution hybridization capture, sequencing and data analyze four aspect contents.
The plasma DNA sample of 1 syphilis positive patient is chosen in experiment, carries out sample library construction, experiment to sample
Upper machine is sequenced after group 1 carries out solution hybridization capture using above-mentioned syphilopathy Mycoplasma Detection Reagent box, and experimental group 2 is miscellaneous without liquid phase
Capture direct Sequencing is handed over, sequencing result comparison is obtained.
1. plasma DNA sample extraction and library preparation
The streck pipe of the syphilis positive blood sample separated plasma after 3000g is centrifuged 10min will be collected to manage to EP
In, the plasma sample pipe of separator well is centrifuged after 10min using 14000rpm takes supernatant to carry out dissociative DNA extraction.Dissociative DNA mentions
It takes using Tiangeng dissociative DNA extracts kit TIANamp Micro DNA Kit, DP316.
The dissociative DNA sample extracted carries out the sample library construction of different index respectively, and conditions for building groundwater reservoir is identical:
(1) the higher cfDNA sample of the quality extracted is carried out end reparation using enzyme reaction and A is added (to build library reagent by
Library kit KAPA Hyper Prep Kit Illumina platforms is built from commercialization).
Reaction condition: 20 DEG C of 30min, 65 DEG C of 30min, 4 DEG C of ever.
(2) above-mentioned cfDNA and both-end adaptor connector by end reparation plus A is attached reaction by.
Reaction condition: 20 DEG C of 15min.Product obtains connection product after 0.8 × magnetic beads for purifying after connection.
(3) connection product of previous step is carried out PCR amplification enriched library by
Reaction condition: 98 DEG C of 45s, 98 DEG C of 15s；60℃30s；72 DEG C of 30s, 10-13cycles, 72 DEG C of 1min, 4 DEG C
ever.Product screens to obtain dissociative DNA sample library by 0.5-0.9 × magnetic bead after PCR.
2. the enrichment of syphilis pathogen sequence
Solution hybridization capture is carried out to the dissociative DNA sample of experimental group 1 built, 2 sample library of experimental group, which is not done, to be located
Manage direct Sequencing.
(1) mixing of dissociative DNA sample library, closing and drying: the genome dna library mixed in equal amounts that will be built, always
1 μ g is measured, then mixes COT DNA, genome dna library according to following ratio with closing primer.Wherein COT DNA is as base
Because of the higher a part of DNA fragmentation of repetitive rate in group, hybridization efficiency is helped to improve in hybridization, closing primer is used to close text
Sequence measuring joints in library.The above-mentioned sample mixed is evaporated for 60 DEG C in vacuum concentration instrument, is used for subsequent hybridization.
(2) it re-dissolves and is denaturalized: the hybridization buffer of 10.5 μ L, abundant whirlpool being added into the mixture after above-mentioned drying
In 95 DEG C of denaturation 10min after rotation dissolution.
(3) hybridize: the 10.5uL mixture being denaturalized being added in 4.5 μ L hybrid capture Probe Libraries, vortex 30s fills
It is centrifuged 30s at full speed after dividing dissolution to mix.In 55 DEG C of hybridization 16h.
(4) biological avidin magnetic bead captures target area DNA library segment: after hybridization reaction, 15uL sample being transferred to
It is washed in the 100uL marked by streptavidin magnetic bead being resuspended by biological avidin magnetic bead washing solution in advance, in 55 after mixing
DEG C it is incubated for 45min, is mixed every piping and druming in 15 minutes primary, allows the segment of capture in conjunction with magnetic bead, Specific adsorption target fragment, general
The segment hybridized to crawls out.
(5) nontarget area DNA fragmentation is washed:
1. the washing solution I of 55 DEG C of 100 μ L preheatings is added, magnetic levitation abandons supernatant after mixing, is repeated once.
2. the Stringent washing solution of 55 DEG C of 200 μ L preheatings is added, 55 DEG C of incubation 5min after mixing, magnetic levitation is abandoned
Supernatant, in triplicate, totally four times.
3. 200 μ L washing solution I is added, vortex 2min, magnetic levitation abandons supernatant.
4. 200 μ L washing solution II is added, vortex 1min, magnetic levitation abandons supernatant.
5. 200 μ L washing solution III is added, vortex 30S, magnetic levitation abandons supernatant.
6. 50 μ L PCR rank dd H are added2Magnetic bead is resuspended in O.
(6) capture after be enriched with: after elution magnetic bead with capture target DNA fragments, into sample LM-PCR be enriched with.
LM-PCR reaction system is following (a capture sample does two pipe PCR reaction):
PCR reaction condition are as follows: 98 DEG C of initial denaturation 45s；98 DEG C of denaturation 15s, 60 DEG C of annealing 30s, 72 DEG C of extension 30s, totally 14
A circulation；72 DEG C of extension 1min；4 DEG C of heat preservations.
After reaction, using magnetic beads for purifying pcr amplification product, sample library after being captured, for being sequenced point after quality inspection
Analysis.
3. high-flux sequence and data are analyzed
The present invention carries out high-flux sequence using two generations microarray dataset well known to those skilled in the art, by the sequence of capture
The method being sequenced when Illumina microarray dataset is used in synthesis carries out sequencing, and (sequencing reagent is purchased from Illumina quotient
Industry sequencing kit), to obtained data analyzed known to sequence label thereon, determine that its is corresponding according to sequence label
Sample DNA source.The sequencing of two generations has the characteristics that high throughput, provides convenience rapidly and efficiently for this technical application.
The present invention be sequenced to the sequencing library that above method obtains and has obtained sequencing data using two generations sequencing means, has
It is as follows to close analysis result:
Data analysis result after table 1 is sequenced
As shown in table 1, the syphilis positive sample of selection, experimental group 1 are carried out using above-mentioned syphilopathy Mycoplasma Detection Reagent box
Upper machine sequencing, experimental group 2 capture direct Sequencing without solution hybridization after solution hybridization capture.Test data analysis result is aobvious
Show, has carried out the experimental group 1 of solution hybridization capture experiment compared with 2 result of experimental group for directly building library sequencing, experimental group 1 detects
To 18,720 syphilis reads, mostly 444 times of the quantity (42) that detects compared to experimental group 2.And sequencing data quantum of output is only
The 26% of the latter, therefore plum is greatly improved using syphilis pathogen detection solution hybridization capture probe provided by the invention library
The sensitivity and accuracy of malicious pathogen detection, while testing cost is greatly reduced, there is very well application value.
The different probe length of the invention of embodiment 3 influences syphilis cause of disease testing result
1. probe designs: 1 probe of experimental group designs as described above, syphilis pathogen detection solution hybridization capture probe library
Include two parts: 1. syphilis genome sequences；2. human genome canonical sequence.Wherein syphilis genome sequence (No. GenBank:
CP003679.1), size about 1.14Mb intercepts 65bp every 12bp, 94792 probe sequences is obtained according to reference sequences,
Obtained sequence is compared with pathogen database, has chosen wherein 92703 sequence conducts specifically compared in syphilis
Probe sequence.Human genome conserved sequence is chosen simultaneously as internal reference to guarantee solution hybridization capture effect, chooses EFTUD2 base
As human genome canonical sequence, EFTUD2 gene (is about 4.4k) for cause, SDHA Gene Partial sequence, intercepts 65bp every 16bp
(about 4x covering), is obtained 2762 probe sequences；SDHA gene intercepts 65bp every 16bp, takes wherein 535 sequences.
2 probe design process of experimental group: according to syphilis genome sequence (No. GenBank: CP003679.1), every 15bp
100bp is intercepted, 63183 probe sequences are obtained, 62968 specificity are chosen after comparing and are compared to the sequence in syphilis and are made
For probe sequence；As human genome conservative gene EFTUD2 and the SDHA sequence of internal reference, every intercepting 100bp every 15bp,
2198 sequences are obtained.
In designed probe fragment, downstream is separately added into primer pond synthesis universal primer sequence on it, so as to subsequent
Needed for PCR amplification prepares probe, in designed probe fragment, downstream is separately added into primer pond (oligo pool) conjunction on it
At universal primer sequence, needed for preparing probe so as to subsequent PCR amplification, primer pond synthesizes primer pond described in universal primer sequence and closes
It is SEQ No.1:TGTAATACGACTCACTATAGGGAGA at upstream universal primer sequence；It is logical with primer pond synthesis downstream
It is SEQ No.2:TGTAATACGACTCACTATAGGGAGA with primer sequence；The sequential structure of the primer pond synthesis is: TG
TAATACGACTCACTATAGGGAGANNNNNTGAGACGCGACCACGAA, wherein the NNNNN of overstriking represents a variety of Insert Fragments
The probe sequence that sequence, i.e. syphilis genome sequence and/or human genome canonical sequence intercept.
2.PCR prepares liquid phase hybrid capture Probe Library: after above-mentioned primer pond synthesizes successfully, by the primer pond of dry powder
It is dissolved with the DNase/RNase free ddH20 of 50ul cleaning, is centrifuged after fulling shake.Drawn afterwards using upstream and downstream universal sequence
Object carries out PCR amplification and the solution hybridization capture probe library with biotin labeling is prepared.
Specifically, for above-mentioned technical proposal, in preferred situation, the PCR amplification system are as follows:
PCR amplification condition is as follows: 98 DEG C, 30S；98 DEG C, 10s, 60 DEG C, 30s, 72 DEG C, 30s, 14 circulations；72℃,
7min；4℃,∞.
Aforesaid operations are related to passing through optimization in the DNA product of the Biotin-11-dUTP incorporation synthesis of biotin labeling
The reaction system of PCR mainly optimizes the ratio of dUTP and dTTP, and when dUTP:dTTP is 1:3, amplification has Biotin-
The PCR product effect of 11-dUTP is best.
It recycles to obtain solution hybridization capture probe library by 2 × magnetic beads for purifying after PCR amplification.
3. the plasma DNA pattern detection of syphilis positive patient: the plasma sample dissociative DNA extracted is carried out sample
Library construction is repaired by end, adds " A " and connection procedure that DNA fragmentation is connected both-end index connector, followed by building
Solution hybridization capture probe library hybridize with containing sample library DNA fragment to be captured, to these after washing is enriched with
DNA fragmentation is sequenced, and pattern detection result is obtained after bioinformatic data analysis.
(1) plasma DNA sample extraction and library preparation
The streck pipe of the syphilis positive blood sample separated plasma after 3000g is centrifuged 10min will be collected to manage to EP
In, the plasma sample pipe of separator well is centrifuged after 10min using 14000rpm takes supernatant to carry out dissociative DNA extraction.Dissociative DNA mentions
It takes using Tiangeng dissociative DNA extracts kit TIANamp Micro DNA Kit, DP316.
The dissociative DNA sample extracted carries out the sample library construction of different index respectively, and conditions for building groundwater reservoir is identical:
1. the higher cfDNA sample of the quality extracted is subjected to end reparation using enzyme reaction and add A (build library reagent come
Library kit KAPA Hyper Prep Kit Illumina platforms is built from commercialization).
Reaction condition: 20 DEG C of 30min, 65 DEG C of 30min, 4 DEG C of ever.
2. above-mentioned cfDNA and both-end adaptor connector by end reparation plus A is attached reaction.
Reaction condition: 20 DEG C of 15min.Product obtains connection product after 0.8 × magnetic beads for purifying after connection.
3. the connection product of previous step is carried out PCR amplification enriched library.
Reaction condition: 98 DEG C of 45s, 98 DEG C of 15s；60℃30s；72 DEG C of 30s, 10-13cycles, 72 DEG C of 1min, 4 DEG C
ever.Product screens to obtain dissociative DNA sample library by 0.5-0.9 × magnetic bead after PCR.
(2) enrichment of syphilis pathogen sequence
The Probe Library that the dissociative DNA sample built is prepared with experimental group 1 and experimental group 2 respectively carries out liquid phase
Hybrid capture.
1. the mixing of dissociative DNA sample library, closing and drying: the genome dna library mixed in equal amounts that will be built, total amount
1 μ g then mixes COT DNA, genome dna library with closing primer according to following ratio.Wherein COT DNA is as gene
The higher a part of DNA fragmentation of repetitive rate in group, hybridization efficiency is helped to improve in hybridization, and closing primer is used to close library
In sequence measuring joints.The above-mentioned sample mixed is evaporated for 60 DEG C in vacuum concentration instrument, is used for subsequent hybridization.
2. re-dissolving and being denaturalized: the hybridization buffer of 10.5 μ L, abundant whirlpool being added into the mixture after above-mentioned drying
In 95 DEG C of denaturation 10min after rotation dissolution.
3. hybridization: the 10.5uL mixture being denaturalized being added in 4.5 μ L hybrid capture Probe Libraries, vortex 30s fills
It is centrifuged 30s at full speed after dividing dissolution to mix.In 55 DEG C of hybridization 16h.
4. biological avidin magnetic bead captures target area DNA library segment: after hybridization reaction, 15uL sample being transferred to thing
It first passes through in the 100uL marked by streptavidin magnetic bead that biological avidin magnetic bead washing solution washing is resuspended, in 55 DEG C after mixing
It is incubated for 45min, is mixed once every piping and druming in 15 minutes, allows the segment of capture in conjunction with magnetic bead, Specific adsorption target fragment will be miscellaneous
The segment being sent to crawls out.
5. washing nontarget area DNA fragmentation:
The washing solution I of 55 DEG C of 100 μ L preheatings is added in I, and magnetic levitation abandons supernatant after mixing, is repeated once.
The Stringent that 55 DEG C of 200 μ L preheatings are added in II washs solution, 55 DEG C of incubation 5min, magnetic levitation after mixing
Abandon supernatant, in triplicate, totally four times.
III is added 200 μ L and washs solution I, vortex 2min, and magnetic levitation abandons supernatant.
IV is added 200 μ L and washs solution II, vortex 1min, and magnetic levitation abandons supernatant.
V is added 200 μ L and washs solution III, vortex 30S, and magnetic levitation abandons supernatant.
50 μ L PCR rank dd H are added in VI2Magnetic bead is resuspended in O.
6. capture after be enriched with: after elution magnetic bead with capture target DNA fragments, into sample LM-PCR be enriched with.LM-
PCR reaction system is following (a capture sample does two pipe PCR reaction):
PCR reaction condition are as follows: 98 DEG C of initial denaturation 45s；98 DEG C of denaturation 15s, 60 DEG C of annealing 30s, 72 DEG C of extension 30s, totally 14
A circulation；72 DEG C of extension 1min；4 DEG C of heat preservations.
After reaction, using magnetic beads for purifying pcr amplification product, sample library after being captured, for being sequenced point after quality inspection
Analysis.
(3) high-flux sequence and data are analyzed
The present invention carries out high-flux sequence using two generations microarray dataset well known to those skilled in the art, by the sequence of capture
The method being sequenced when Illumina microarray dataset is used in synthesis carries out sequencing, and (sequencing reagent is purchased from Illumina quotient
Industry sequencing kit), to obtained data analyzed known to sequence label thereon, determine that its is corresponding according to sequence label
Sample DNA source.The sequencing of two generations has the characteristics that high throughput, provides convenience rapidly and efficiently for this technical application.
The present invention be sequenced to the sequencing library that above method obtains and has obtained sequencing data using two generations sequencing means, has
It is as follows to close analysis result:
Data analysis result after table 2 is sequenced
As shown in table 2, it compared the shadow that different probe design scheme tests syphilis pathogen solution hybridization Acquisition Detection
It rings, detection data shows, 1 probe liquid phase hybrid capture of experimental group detects 18,720 syphilis reads as the result is shown, and
In the case where roughly the same data output, 2 probe liquid phase hybrid capture testing result of experimental group detects 81 syphilis reads,
It is 230 times more that experimental group 1 compares the syphilis reads that experimental group 2 detects.By result it is not difficult to find out that the probe of experimental group 1 designs
Scheme is substantially better than experimental group 2 in capture rate, substantially increases syphilis pathogen detection sensitivity, therefore the present invention provides
Solution hybridization capture probe library be greatly improved the sensitivity and accuracy of syphilis pathogen detection, greatly reduce simultaneously
Testing cost has preferably application value.
It should be understood that the present invention disclosed is not limited only to specific method, scheme and the substance of description, because these
It is alterable.It will also be understood that purpose of the terminology used here just for the sake of the specific embodiment scheme of description, rather than
It is intended to limit the scope of the invention, the scope of the present invention is limited solely by the attached claims.
Those skilled in the art, which will also be appreciated that or be able to confirm that, uses no more than routine experiment, institute herein
The many equivalents for the specific embodiment of the invention stated.These equivalents are also contained in the attached claims.
Sequence table
<110>system in Beijing Jing Norma spy Science and Technology Ltd.
<120>for the solution hybridization capture library of syphilis pathogen detection and its construction method
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
tgtaatacga ctcactatag ggaga 25
<210> 2
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
tgtaatacga ctcactatag ggaga 25
Claims (10)
1. a kind of solution hybridization for syphilis pathogen detection captures library, which is characterized in that the solution hybridization capture is visited
Needle library includes: syphilis genome sequence and human genome canonical sequence；The syphilis genome sequence is intercepted every 10-20bp
50-70bp obtains probe sequence；Acquired probe sequence is compared with pathogen database, selection is wherein specifically compared
Probe sequence of the sequence as solution hybridization capture library in syphilis；The genome canonical sequence is as internal reference to guarantee liquid
Phase hybrid capture effect is selected from human genome conserved sequence.
2. solution hybridization according to claim 1 captures library, which is characterized in that the syphilis genome sequence is
No. GenBank: CP003679.1 sequence.
3. solution hybridization according to claim 1 captures library, which is characterized in that the syphilis genome sequence every
12bp intercepts 65bp, obtains probe sequence；Acquired probe sequence is compared with pathogen database, is chosen wherein special
Than the probe sequence to the sequence in syphilis as solution hybridization capture library.
4. solution hybridization according to claim 1 captures library, which is characterized in that the human genome conserved sequence is chosen
EFTUD2 gene and/or SDHA Gene Partial sequence are as human genome canonical sequence；The EFTUD2 gene is every 10-20bp
50-70bp is intercepted, human genome canonical sequence is obtained；The SDHA gene intercepts 50-70bp every 10-20bp, obtains people's base
Because of a group canonical sequence.
5. solution hybridization according to claim 4 captures library, which is characterized in that choose EFTUD2 gene and/or SDHA
Gene Partial sequence intercepts 65bp every 16bp, obtains human genome as human genome canonical sequence, the EFTUD2 gene
Canonical sequence；And/or the SDHA gene intercepts 65bp every 16bp, obtains human genome canonical sequence.
6. the building side in -5 any solution hybridization capture libraries for syphilis pathogen detection according to claim 1
Method, which is characterized in that the described method comprises the following steps:
Step 1: design syphilis genome sequence and human genome canonical sequence, the syphilis genome sequence is every 10-20bp
50-70bp is intercepted, probe sequence is obtained；Acquired probe sequence is compared with pathogen database, is chosen wherein special
Than the probe sequence to the sequence in syphilis as solution hybridization capture library；The genome canonical sequence is as internal reference to protect
Solution hybridization capture effect is demonstrate,proved, human genome conserved sequence is selected from；
Step 2: by the design syphilis genome sequence and human genome canonical sequence, downstream is separately added into primer pond on it
Universal primer sequence is synthesized, so that subsequent PCR amplification is prepared needed for probe；
Step 3: it is miscellaneous that the liquid phase with biotin labeling is prepared using upstream and downstream universal sequence primer progress PCR amplification
Hand over capture probe library.
7. construction method according to claim 6, which is characterized in that the syphilis genome sequence is No. GenBank:
The sequence of CP003679.1；And/or the human genome conserved sequence chooses EFTUD2 gene and/or SDHA Gene Partial sequence
As human genome canonical sequence；The EFTUD2 gene intercepts 50-70bp every 10-20bp, obtains human genome referring to sequence
Column；The SDHA gene intercepts 50-70bp every 10-20bp, obtains human genome canonical sequence.
8. construction method according to claim 6, which is characterized in that the primer pond synthesizes upstream universal primer sequence and is
SEQ No.1:TGTAATACGACTCACTATAGGGAGA；It is SEQ with primer pond synthesis downstream universal primer sequence
No.2:TGTAATACGACTCACTATAGGGAGA；The sequential structure of the primer pond synthesis is: TGTAATACGACTCACTAT
AGGGAGANNNNNTGAGACGCGACCACGAA, wherein wherein the NNNNN of overstriking represents a variety of Insert Fragment sequences, i.e. syphilis
The probe sequence that genome sequence and/or human genome canonical sequence intercept.
9. construction method according to claim 6, which is characterized in that be prepared by PCR amplification with biotin mark
In the reaction system of the PCR of the solution hybridization capture probe library step of note, when the ratio of dUTP and dTTP are 1:3.
10. construction method according to claim 6, which is characterized in that be prepared by PCR amplification with biotin mark
It recycles to obtain solution hybridization capture spy by secondary magnetic beads for purifying after PCR amplification in the solution hybridization capture probe library step of note
Needle library.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910596979.6A CN110257537B (en) | 2019-07-04 | 2019-07-04 | Liquid phase hybridization capture library for syphilis pathogen detection and construction method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910596979.6A CN110257537B (en) | 2019-07-04 | 2019-07-04 | Liquid phase hybridization capture library for syphilis pathogen detection and construction method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110257537A true CN110257537A (en) | 2019-09-20 |
| CN110257537B CN110257537B (en) | 2023-03-24 |
Family
ID=67924352
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910596979.6A Active CN110257537B (en) | 2019-07-04 | 2019-07-04 | Liquid phase hybridization capture library for syphilis pathogen detection and construction method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110257537B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113755555A (en) * | 2021-09-03 | 2021-12-07 | 浙江工商大学 | Capture probe set for detecting food allergen, preparation method and application thereof |
| CN115011594A (en) * | 2022-05-16 | 2022-09-06 | 纳昂达(南京)生物科技有限公司 | Liquid phase hybridization capture probe for detecting HPV, application and kit thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090318305A1 (en) * | 2008-06-18 | 2009-12-24 | Xi Erick Lin | Methods for selectively capturing and amplifying exons or targeted genomic regions from biological samples |
| US20150203907A1 (en) * | 2014-01-17 | 2015-07-23 | Florida State University Research Foundation | Genome capture and sequencing to determine genome-wide copy number variation |
| CN107475375A (en) * | 2017-08-01 | 2017-12-15 | 南京世和基因生物技术有限公司 | A kind of DNA probe storehouse, detection method and kit hybridized for microsatellite locus related to microsatellite instability |
| US20190093172A1 (en) * | 2016-04-15 | 2019-03-28 | Exosome Diagnostics, Inc. | Plasma-based detection of anaplastic lymphoma kinase (alk) nucleic acids and alk fusion transcripts and uses thereof in diagnosis and treatment of cancer |
-
2019
- 2019-07-04 CN CN201910596979.6A patent/CN110257537B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090318305A1 (en) * | 2008-06-18 | 2009-12-24 | Xi Erick Lin | Methods for selectively capturing and amplifying exons or targeted genomic regions from biological samples |
| US20150203907A1 (en) * | 2014-01-17 | 2015-07-23 | Florida State University Research Foundation | Genome capture and sequencing to determine genome-wide copy number variation |
| US20190093172A1 (en) * | 2016-04-15 | 2019-03-28 | Exosome Diagnostics, Inc. | Plasma-based detection of anaplastic lymphoma kinase (alk) nucleic acids and alk fusion transcripts and uses thereof in diagnosis and treatment of cancer |
| CN107475375A (en) * | 2017-08-01 | 2017-12-15 | 南京世和基因生物技术有限公司 | A kind of DNA probe storehouse, detection method and kit hybridized for microsatellite locus related to microsatellite instability |
Non-Patent Citations (2)
| Title |
|---|
| ARORA N等: "Origin of modern syphilis and emergence of a pandemic Treponema pallidum cluster", 《NAT MICROBIOL》 * |
| 杨琼: "血液病原联合检测基因芯片技术的研究", 《中国优秀硕士学位论文全文数据库》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113755555A (en) * | 2021-09-03 | 2021-12-07 | 浙江工商大学 | Capture probe set for detecting food allergen, preparation method and application thereof |
| CN115011594A (en) * | 2022-05-16 | 2022-09-06 | 纳昂达(南京)生物科技有限公司 | Liquid phase hybridization capture probe for detecting HPV, application and kit thereof |
| CN115011594B (en) * | 2022-05-16 | 2023-10-20 | 纳昂达(南京)生物科技有限公司 | Liquid phase hybridization capture probe for detecting HPV, application and kit thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110257537B (en) | 2023-03-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111304368A (en) | Method, oligonucleotide and kit for detecting novel coronavirus | |
| CN111235316A (en) | Primer probe for identifying novel coronavirus and application of primer probe in triple fluorescence RPA | |
| JPH11500305A (en) | Nucleic acid probes for detection and identification of fungi | |
| CN104846097B (en) | Helicobacter pylori parting and drug resistant mutant genes detection kit | |
| CN108384899B (en) | Fluorescent quantitative PCR kit for detecting novel goose astrovirus and application thereof | |
| CN113005226A (en) | Oligonucleotide and kit for detecting SARS-CoV-2 | |
| CN110257537A (en) | Solution hybridization for syphilis pathogen detection captures library and its construction method | |
| CN110669870A (en) | Real-time fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection primer, probe and detection kit for serotype of Palima serogroup virus | |
| CN104988141B (en) | G.32912799T ＞ C mutation and its application in Computer-aided Diagnosis of Breast Cancer of BRCA2 genes | |
| CN109797203A (en) | Helicobacter pylori detection architecture and detection kit and application | |
| CN107653333A (en) | A kind of ox Babesia nest-type PRC specific primer and detection kit and nested PCR detection method | |
| CN106555013A (en) | The detection method of HBV viruses, test kit and its application | |
| CN111621580A (en) | RAA primer, probe and detection method for detecting pasteurellosis multocida | |
| CN109337956A (en) | Design method, capture probe, capture probe group and the kit of capture probe | |
| CN113025696A (en) | High-sensitivity detection method for hydatid cyst based on high-throughput sequencing and application | |
| CN110438220A (en) | The motionless syndrome gene panel kit of cilium and its application | |
| CN105256068A (en) | Novel high-sensitivity respiratory virus nucleic acid NASBA (nucleic acid sequence based amplification) primers and detection method | |
| CN108411014A (en) | Differentiate the primer and probe and detection method of A types and the dual real-time fluorescence quantitative PCR of Type B ox pasteurella multocida | |
| CN102108420B (en) | Fluorescence quantitative polymerase chain reaction (PCR) kit for detecting dengue virus type 1 | |
| CN110643740A (en) | Real-time fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection primer, probe and detection kit for Palimam serogroup virus | |
| CN112501280B (en) | High-sensitivity detection method for hydatid cyst based on high-throughput sequencing | |
| CN113265488B (en) | RPA-LFD primer, probe and kit for jointly detecting epidemic hemorrhagic disease virus and palieimia serogroup virus | |
| CN109536625A (en) | A kind of the iiPCR detection method and detection kit of Mycoplasma bovis | |
| CN111500768B (en) | Primer probe for identifying novel coronavirus and application of primer probe in dual-digital PCR | |
| CN107583052A (en) | Applications of the 5p of miR 6734 in Luminal type breast cancer diagnosis instruments are prepared |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20210524 Address after: 116600 no.9-2 Jinqi Road, Dalian Economic and Technological Development Zone, Liaoning Province Applicant after: Dalian Jingtai medical laboratory Co.,Ltd. Address before: 101318 Room 301, 3 / F, building 2, 28 Yuhua Road, airport economic core area, Shunyi District, Beijing (Airport Area B) Applicant before: BEIJING JINGNUO MATE TECHNOLOGY Co.,Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |