CN110106183B - Herbicide-resistant gene and application thereof - Google Patents

Abstract

The invention discloses a herbicide-resistant gene and application thereof, wherein the nucleotide sequence of the herbicide-resistant gene is shown in SEQ ID No.15, the invention provides a novel herbicide-resistant gene derived from sugarcane, and the gene can degrade at least one ALS inhibitor herbicide and one HPPD inhibitor herbicide. The introduction of the herbicide-resistant gene into plants sensitive to the herbicides can remarkably increase the tolerance of the sensitive plants to the herbicides, so that the herbicide which cannot be used for controlling weeds on the plants originally can be used for the plants introduced with the herbicide-resistant gene, and more choices are provided for weed control. In addition, the gene of the invention can be used as a screening marker gene in the field of plant tissue culture.

Description

Herbicide-resistant gene and application thereof

(I) technical field

The invention relates to the field of plant genetic engineering, in particular to a gene for resisting various herbicides such as flazasulfuron, mesotrione and the like and a protein coded by the gene. This gene can be used to express in plants to increase the resistance of the plants to herbicides. The invention can be applied to the fields of crop breeding, plant cell culture screening and the like.

(II) background of the invention

Weed control is required during crop planting. If a crop plant obtains resistance to a broad-spectrum herbicide, the weeds of the crop plant can be controlled by spraying the broad-spectrum herbicide after emergence of the seedlings. The weed control method is simple, efficient, low in cost and safe for crops.

Crops can be improved by genetic engineering to obtain herbicide resistance. For example, a crop plant can be rendered glyphosate resistant by transgenic expression of a resistant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) of Agrobacterium tumefaciens (Agrobacterium tumefaciens sp CP 4). Transgenic glyphosate resistant plants expressing this enzyme have been used in production (us patents 453590, 4769061, 5094945). In order to control the occurrence of herbicide resistance of weeds, improve the resistance level of transgenic crops and increase the diversity of resistance genes, the development of resistant transgenic crops resistant to herbicides other than glyphosate is very useful in production.

Cytochrome P450 is a large family of genes. In general, more than 200P 450 genes can be found in a single plant. Previous studies found that a part of the protein encoded by the P450 gene was able to degrade herbicides. For example, it can be obtained by fusing rat CYP1A1 with the yeast P450 reductase gene and introducing the fused gene into tobacco. And other cytochrome P450 genes (e.g., Didierjean, L.et al. (2002) Plant Physiol.130: 179-189; Morant, M.S.et al. (2003) Opinion in Biotechnology 14:151-162) have herbicide resistance and are used to obtain herbicide resistant transgenic plants. A cytochrome P450 gene in corn is found to have the capability of resisting herbicides such as nicosulfuron (Chinese patent, application No. 200610155661; U.S. Pat. No.3, 20080052798A1), and a cytochrome P450 gene in rice has the capability of resisting bentazon and sulforon herbicides (Pan et al, Plant Molecular Biology,2006, 61: 933-.

Sugarcane (Sacchrum officinarum x S. spontanium) can resist herbicides such as flazasulfuron, nicosulfuron, mesotrione and the like, so that a herbicide-resistant gene is hopefully cloned from sugarcane and applied to cultivation of herbicide-resistant transgenic crops. The invention clones a herbicide-resistant gene which can obviously resist at least one herbicide in the following herbicides from sugarcane: acetolactate synthase (ALS) inhibitor herbicides including, but not limited to, sulfonylureas, imidazolinones, triazolopyrimidine sulfonamides, and pyrimidinylsalicylates; p-hydroxyphenylpyruvate dioxygenase (HPPD) inhibitor herbicides, including but not limited to mesotrione, isoxazolone, and the like. The invention provides a method for obtaining transgenic herbicide-resistant crops by using the gene.

Disclosure of the invention

The invention aims to provide a herbicide-resistant gene and application thereof, wherein the herbicide-resistant gene can degrade at least one ALS inhibitor herbicide and at least one HPPD inhibitor herbicide simultaneously. Introduction of the herbicide-resistant gene into plants sensitive to these herbicides can significantly increase the tolerance of these sensitive plants to these herbicides, and thus herbicides that would otherwise not be used on these plants to control weeds can be used for plants into which the herbicide-resistant gene has been introduced. In addition, the herbicide-resistant gene can also be used in the field of plant tissue culture as a screening marker gene.

The technical scheme adopted by the invention is as follows:

the invention provides a herbicide-resistant gene, wherein the nucleotide sequence of the herbicide-resistant gene is shown in SEQ ID No.15, and the amino acid sequence of the herbicide-resistant gene coding protein is shown in SEQ ID No. 19.

The invention also provides an application of the herbicide-resistant gene in preparation of herbicide-resistant plant cells, wherein the application is to introduce the herbicide-resistant gene into plant cell genomes to obtain the herbicide-resistant plant cells.

Further, it is preferable that the herbicide-resistant gene encoding protein for use in preparing the herbicide-resistant plant cell is an amino acid fragment from position 104 to 170 in the amino acid sequence shown in SEQ ID NO.19 (SEQ ID NO. 20).

Furthermore, the application is obtained by constructing a T-DNA expression frame containing herbicide-resistant genes and then transforming plant genes into the T-DNA expression frame, wherein the construction method of the T-DNA expression frame comprises the following steps: the promoter is functionally connected with the herbicide-resistant gene cds shown in SEQ ID NO.15 at the 5 'position, and the terminator is functionally connected with the herbicide-resistant gene cds at the 3' position.

The expression of the protein polypeptide encoded by the herbicide-resistant gene in a plant, or having at least 83%, 85%, 90% or 95% of the amino acid sequence compared thereto, of the present invention results in a transgenic plant having improved herbicide resistance. Amino acid identity can be obtained by existing methods (Karlin and Altschul 1990). And a plant having introduced therein the gene at least exhibits increased resistance to one or more of the following herbicides: 1) acetolactate synthase (ALS) inhibitor herbicides including, but not limited to, sulfonylurea, imidazolinone, triazolopyrimidine sulfonamide, and pyrimidinylsalicylate herbicides; 2) herbicides of the hydroxyphenylpyruvate dioxygenase (HPPD) inhibitor class include, but are not limited to, mesotrione, isoxazolone and the like.

The method of the present invention for producing herbicide-resistant transgenic plant cells is accomplished by expressing in a plant a protein polypeptide encoded by a polynucleotide sequence provided by the present invention. Expression of the polynucleotide-encoded polypeptide can be achieved by constructing a gene expression cassette obtained by functionally linking one or more expression-controlling polynucleotide sequences and herbicide-resistant polynucleotide sequences, and further transferring the expression cassette into the genome of the plant. One of ordinary skill in the art would be able to construct herbicide-resistant gene expression cassettes based on known knowledge using the polynucleotide sequences provided by the present invention, and transform plants to obtain transgenic plants that are herbicide-resistant. The herbicide tolerant transgenic plant can provide a convenient and economical method for controlling weeds.

The polynucleotide provided by the invention and the protein variant coded by the polynucleotide are also part of the protection content of the invention. A variant refers to a polynucleotide or protein with a highly similar sequence. Variants of a polynucleotide sequence include variations in deletion, insertion or substitution of one or more polynucleotides at one or more positions, which still do not alter the open reading frame. The source of a variant of a polynucleotide sequence can be of various aspects. One is the difference in codons encoding the same amino acid, since polynucleotide sequences encoding the same amino acid sequence may be different; another situation is the natural diversity that is widely present in different individuals or closely related species of organisms; also, mutation is introduced by human. Many methods for artificially introducing mutations are available, and those skilled in the art can introduce mutations by conventional techniques, for example, by PCR.

Protein polypeptide variants include variant proteins in which one or more amino acids are deleted, inserted, or substituted at one or more positions. The variants protected by the present invention are proteins that still retain the biological activity of their native genes, i.e. are capable of causing herbicide resistance in transgenic plants. Such variants may be derived from biological genetic polymorphisms (genetic polymorphisms) or artificial genetic manipulation changes. These genetic manipulations can effect amino acid substitutions, deletions or insertions into the protein. Methods for such genetic manipulation are known. Deletions, substitutions or insertional variations of a protein sequence do not in many cases alter the biological activity characteristics of the protein very significantly. However, even if one cannot predict the effect of these variations on protein activity, one of ordinary skill in the art would be able to express the proteins encoded by these particular variants in plants and evaluate their herbicide resistance.

The present invention provides herbicide-resistant proteins and also includes variants obtained by the protein domain replacement method. The present inventors have found that a fragment of SEQ ID No.19 plays a key role in its herbicide resistance. The herbicide resistance was obtained by substituting the amino acid sequence of SEQ ID NO:20 (corresponding to 67 amino acids from 104 to 170 of SEQ ID NO: 19) for the fragment corresponding to the cytochrome P450 homologous gene Zm-513 (nucleotide sequence SEQ ID NO:21, amino acid sequence SEQ ID NO:22, U.S. Pat. No.5,9657307) which had NO herbicide resistance (67 amino acids from 107 th to 173 of SEQ ID NO: 22). It is expected that artificial variants of proteins that are herbicide resistant may also be obtained by replacing corresponding fragments or corresponding amino acid positions of other cytochrome P450 homologous proteins with SEQ ID NO:20 or fragments or amino acid positions contained therein.

The polynucleotide provided by the invention and the protein coded by the polynucleotide also comprise variants obtained by artificial mutation or recombination method. Such methods of mutagenesis or recombination include, but are not limited to, recombinant integration of DNA (DNA shuffling), such as US 2002/0058249; stemmer (1994) proc.natl.Acad.Sci.USA 91: 10747-10751; stemmer (1994) Nature 370: 389-391; crameri et al (1997) Nature Biotech.15: 436-438; moore et al (1997) J.mol.biol.272: 336-347; zhang et al (1997) Proc.Natl.Acad.Sci.USA 94: 4504-; crameri et al (1998) Nature 391: 288-; and U.S. Pat. No.5, 605,793and 5,837, 458. One of ordinary skill in the art will recognize that variants can be obtained by these methods that still have the same herbicide resistance activity or have altered herbicide resistance.

The polynucleotides provided by the invention can also be used to clone corresponding genes from other plants. According to the polynucleotide sequences provided by the present invention, those skilled in the art can generally clone corresponding homologous genes from a plant by using PCR method and DNA hybridization method. The PCR method can be based on the polynucleotide sequence design primer, through the PCR method to obtain part or all homologous gene sequence. DNA hybridization methods homologous genes can be obtained by hybridizing DNA libraries using the polynucleotides provided by the present invention to prepare probes. Furthermore, those skilled in the art can also find out genes with high homology from genome libraries by using the nucleic acid sequences and protein sequences provided by the present invention through a molecular informatics method. Based on the polynucleotide sequences and the amino acid sequences of the protein polypeptides provided by the present invention, genes having higher homology to the genes provided by the present invention were found, for example, by using the BLAST (www.ncbi.nih.gov) method.

The polynucleotides provided by the invention can be cloned into plasmid vectors to obtain large-scale replication in cells. By using such a DNA recombination technique, the polynucleotide obtained in the present invention can be functionally linked to a promoter and a terminator which control gene expression to construct an expression cassette. By functionally linked is meant that the promoter and terminator are capable of acting to initiate and control expression of the polynucleotide to which they are linked. Typically, the promoter is linked at the 5 'end and the terminator is linked at the 3' end.

Promoters for controlling gene expression are well known to those skilled in the art. A review by Potenza et al details and summarizes the studies on the promoters (Potenza et al (2004) In Vitro Cell Dev Biol-Plant 40: 1-22). The promoter includes a promoter for constitutive expression, a tissue-specific expression promoter, a promoter capable of inducing expression, and the like. And constitutive expression promoters are widely used for herbicide-resistant gene control. For example, the CaMV35S promoter (Odell et al (1985) Nature 313: 810-812); the rice actin promoter (McElroy et al (1990) Plant Cell 2: 163-171); the maize ubiquitin promoter (Christensen et al (1989) Plant mol. biol.12:619-632and Christensen et al (1992) Plant mol. biol.18: 675-689). These promoters may be used to control the expression of the genes provided by the present invention in plants, thereby obtaining transgenic herbicide resistant plants.

The terminator which controls the expression of the gene may be the natural terminator which provides the gene, or may be a terminator of another gene derived from a plant or another plant gene. Commonly used terminators include Octopine synthase terminator and nopaline synthase terminator derived from Agrobacterium, such as CaMV35S terminator. References include: guerineau et al (1991) mol.Gen.Genet.262: 141-144; propufoot (1991) Cell 64: 671-674; sanfacon et al (1991) Genes Dev.5: 141-149; mogen et al (1990) Plant Cell 2: 1261-; munroe et al (1990) Gene 91: 151-158; ballas et al (1989) Nucleic Acids Res.17: 7891-7903; and Joshi et al (1987) Nucleic Acids Res.15:9627-9639.

The polynucleotide sequence of the gene may be further modified or altered in order to provide for the level of expression of the gene in the target plant. These changes include deletion of introns, removal of sequences that may affect normal expression, such as the immature PolyA signal sequence, etc. Depending on the codon usage of the target plant, the polynucleotide sequences encoding the same protein polypeptides may be optimized for increased expression in the target plant.

The vector comprising the expression cassette of the gene provided by the present invention may also comprise a selection marker gene expression cassette. This selectable marker gene can be used to select for transformed cells. Commonly used selectable marker genes include antibiotic resistance genes such as neomycin phosphotransferase II (NEO) and Hygromycin Phosphotransferase (HPT), herbicide resistance genes such as glyphosate resistance gene EPSPS gene, glufosinate resistance Bar gene, and the like. Other selectable marker genes may also be used as selectable genes for transformation in accordance with the present invention.

The herbicide-resistant gene provided by the invention can be introduced into plants to obtain transgenic herbicide-resistant plants, wherein the plants include but are not limited to corn, wheat, barley, sorghum, rice, soybean, carrot, potato, cotton, sunflower, rape, oak, turfgrass and pasture.

The polynucleotide provided by the present invention can be expressed by introducing it into a plant by a person of ordinary skill in the art using known techniques. The methods which are more commonly used are the gene gun method (Klein et al,1987, Nature (London)327: 70-73; U.S. Pat. No.4,945,050) or the Agrobacterium mediated method (De Blaere et al,1987, meth.enzymol.143: 277). The present invention is not limited to this method.

The methods and procedures for transformation vary from plant to plant. However, it is generally introduced into immature embryos, mature embryos, undifferentiated callus or protoplasts of plants by Agrobacterium or biolistics. The cultures were then screened using the corresponding screening medium. Then differentiation is carried out to obtain transformed buds, and the transgenic seedlings which can be planted can be obtained through the culture of a rooting culture medium. Further, herbicide-resistant transgenic plants can be screened by herbicide application, for example, flazasulfuron spray can kill non-transgenic rice.

Compared with the prior art, the invention has the following beneficial effects: the invention provides a novel herbicide-resistant gene derived from sugarcane, which can degrade at least one ALS inhibitor herbicide and one HPPD inhibitor herbicide. The introduction of the herbicide-resistant gene into plants sensitive to the herbicides can remarkably increase the tolerance of the sensitive plants to the herbicides, so that the herbicide which cannot be used for controlling weeds on the plants originally can be used for the plants introduced with the herbicide-resistant gene, and more choices are provided for weed control. In addition, the gene of the invention can be used as a screening marker gene in the field of plant tissue culture.

(IV) description of the drawings

FIG. 1 is a T-DNA vector map of the expressed gene 3.

FIG. 2 is a map of gene 48 plant expression vectors;

FIG. 3 is a map of a plant expression vector for the gene CF 48;

FIG. 4 is a plant expression vector map of gene 49.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

the molecular biological and biochemical methods used in the following examples of the invention are all known techniques. The details are described in the documents A Laboratory Manual,3rd ED., and others, published by John Wiley and Sons company, Current Protocols in Molecular Biology, Ausubel, and Cold Spring Harbor Laboratory Press, J.Sambrook et al, Molecular Cloning, A Laboratory Manual,3rd ED..

Example 1 cloning of resistance candidate P450 Gene

1.1 amplification of conserved regions of candidate P450 genes

Plants typically have a relatively large P450 gene family, for example, in Arabidopsis thaliana genomes, over 300 cytochrome P450 genes are found (Werck-Reichhart et al (2000) Trends in Plant Science 5(3): 116-. DNA alignment analysis of three known gramineous plant P450 gene cDNA sequences (gene bank access: KT184658.1, EU955667.1, AK066760.1, respectively) with herbicide-resistant activity shows that the sequences of some regions are conserved. Based on the nucleotide sequences of these conserved regions of cytochrome P450 genes, PCR primers shown in Table 1 below were designed.

TABLE 1 amplification of P450 conserved region primers

Primer name	Sequence 5'to 3'
		SP450F1	CGCSARGGAGTGCTTCACSGASCACGACGTG
SP450F2	AGCTACGGSSCGYACTGGCGCRACCTSCGCCG
		SP450F3	CCGTSCASCTSCTSTCCGCGCACCGCGTC
SP450F4	GAGSTCTCSCTCAGCGTGCTBATGGAGACCATCGC
		SP450R1	GCGATGGTCTCCATVAGCACGCTGAGSGAGASCTC
SP450R2	GATCTTSYTCCTSACGCCGAAMACGTCGAACCA
		SP450R3	GGCTCDGWCTTCTGCARAGTGAGCAGCA
SP450R4	TCYGGCTCDGWCTTCTGCARAGTGAGCAGCA

Genomic DNA was extracted from sugarcane leaves, and PCR was performed using PRIMESTAR HS DNA polymerase of Takara, using sugarcane genomic DNA as a template, and four forward primers and four reverse primers in Table 1 in combination.

The reaction system is as follows:

the reaction procedure was as follows:

94℃，5min；(98℃10s，56℃10s，72℃1min)，32cycles；72℃，5min。

PCR products obtained by amplification of a primer combination (SP450F1, SP450R4) are selected, gel recovered and cloned into pMD19-T, and 18 clones are selected for sequencing. At least 4 fragments with different sequences were found in the PCR products, 3c (SEQ ID NO.1), 48c (SEQ ID NO.2), CF48c (SEQ ID NO.3), 49c (SEQ ID NO.4), respectively.

1.2 obtaining of nucleic acid sequence encoding end P450N

The alignment also shows that the first 5 amino acids at the N end of the P450 with the capability of degrading the herbicide are relatively conserved, and 15 nucleotides from the beginning of the initial code have relatively high conservation, so that the following 3N-end specific primers are designed for amplifying the nucleic acid sequence coding the four P450N ends.

P450-5-F15：5’-ATGGATAAGGCCTAC-3’

P450-5-F17：5’-ATGGATAAGGCCTACGT-3’

P450-5-F30：5’-CGAATTCACTAGTGATTATGGATAAGGCCT-3’

Further, based on the obtained sequences of 3c, 48c, CF48c, 49c, gene-specific primers of Table 2 were designed for amplification of the 5' portions of these four genes by nested PCR.

TABLE 2 specific primer sequences for amplification of 5' of sugarcane P450 candidate genes

The first round of nested PCR was performed using sugarcane genomic DNA as a template, a mixture of three P450-5-F15, P450-5-F17 and P450-5-F30 as a forward primer, and SR3 as a reverse primer for each of the four genes. The first round of reaction system is as follows:

the first round of PCR reaction procedure was as follows:

94℃，5min；(98℃10s，56℃10s，72℃1min)，32cycles；72℃，5min。

the second PCR reaction was performed using the first product diluted 200 times as a template, P450-5-F30 as a forward primer, and SR2 as a reverse primer for each of the four genes. The second round of reaction system is as follows:

the second round of PCR reaction procedure was as follows:

94℃，5min；(98℃10s，56℃10s，72℃1min)，32cycles；72℃，5min。

the sequences encoding 5' of the four P450 genes, 3-5 ' (SEQ ID NO.5), 48-5 ' (SEQ ID NO.6), CF48-5 ' (SEQ ID NO.7), 49-5 ' (SEQ ID NO.8), were obtained by two rounds of PCR.

1.3 obtaining of nucleic acid sequence encoding C-terminus of P450 Gene

The nucleic acid sequence of the C end of the coding P450 gene is obtained by nested PCR by taking sugarcane bud cDNA as a template. The nested PCR adopts a single-side nested design, two positive nested primers are designed in a gene conservation region, and a fixed reverse primer is designed at the 3' end of a gene.

TABLE 3 Gene-specific forward nested primers for amplification of the 3' sequence of the sugarcane P450 Gene

Primer name	Sequence 5'to 3'
		3SF1	ACCTCCTGTCCGCTCACCGTGTGAGGT
3SF2	CCCTTATGGAAACCATCGCGCAAAC
		48SF1	CATGGAGACCATCGCGCAGACCAAGA
48SF2	TGTTGCGGTGGTTCTACGTGTACGGC
		CF48SF1	CATGGAGACAATCGCGCAGACCAAGA
CF48SF2	TGTTGCGGTGGTTCGACGTGTACGGC
		49SF1	GTCGCCTGCATGTCCTCCGTTATCTC
49SF2	TGCTCATGGAGACCATCGCGCAGAC

Reverse primer:

ANCHOR：5’-GACCACGCGTATCGATGT-3’

P450-3-R：5’-TCAGAGCTYCTSCAAAACCTCACGCAT-3’

extracting sugarcane bud total RNA as a template, and using the following primers:

DTANCHOR:5’-GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTV-3’

cDNA was synthesized using the Primescript RT reagent kit from TAKARA. The reaction system is as follows:

the first round of PCR was performed using cDNA as a template, and the second round of PCR was performed using the first round of PCR product diluted 200 times as a template. The 3' portion of the candidate P450 gene was obtained by amplification using the primer combinations of Table 4.

TABLE 4 primer combinations for amplifying the 3' end portion nucleic acid sequences of candidate sugarcane P450 s

The obtained PCR product sequences were 3-3 '(SEQ ID NO.9), 48-3' (SEQ ID NO.10), CF48-3 '(SEQ ID NO.11), and 49-3' (SEQ ID NO.12), respectively.

1.4 determination of candidate P450 Gene cds

The sequences 3(SEQ ID NO.13), 48(SEQ ID NO.14), CF48(SEQ ID NO.15), 49(SEQ ID NO.16) were obtained by splicing nucleic acid sequences encoding the N-terminal and C-terminal of each candidate gene and cutting the cds portion. Designing a table primer according to the spliced sequence, taking sugarcane bud cDNA as a template, and amplifying the full length of four candidate genes cds by using the primer in the table 5, wherein the reaction system is as follows:

the reaction procedure was as follows:

94℃，3min；(98℃10s，56℃10s，72℃1min 45s)，32cycles；72℃，5min。

obtaining gene 3, gene 48, gene CF48 and gene 49; the sequencing result confirms that the spliced sequence is error-free and exists really instead of being generated by artificial splicing.

TABLE 5 primers for amplification of full length candidate sugarcane P450cds

Primer name	Sequence 5'to 3'
		3-F	ATGGATAAGGCCTACGTTGTCGTCCTCTCG
3-R	TCACAACTTCTGAAGGACATCAAGCATGACTT
		48-F	ATGGATAAGGCCTATATCGCCGTCCTCTCC
48-R	TCAGAGCTCCTGAAGAACATCACGCATAGCTG
		CF48-F	ATGGATAAGGCCTATATCGCCGTCCTCT
CF48-R	TCAGAGCTCCTGAAGAACATCACGCATAGCT
		49-F	ATGGATAAGGCCTACGTGGCCGTGCTCTCC
49-R	TCAGAGCTCCAGAAGAACATCGCGCATAGCTG

Example 2 construction of expression vectors for expressing 3, 48, CF48, 49 in Rice

The primers in Table 6 were synthesized for the construction of plant expression vectors.

The fragment p35S-TEV-r was obtained by amplifying the artificially synthesized p35S-TEV 5' UTR (SEQ ID NO: 17) as a template with primers (35S-r-FP, TEV-r-RP).

3(SEQ ID NO.13) was used as a template, and a fragment 3-r was obtained by amplification using a primer (3-r-FP, 3-r-RP).

A fragment 48-r was obtained by amplification using a primer (48-r-FP,48-r-RP) using 48(SEQ ID NO.14) as a template.

Using CF48(SEQ ID NO.15) as a template and primers (CF48-r-FP, CF48-r-RP), fragment CF48-r was amplified.

A fragment 49-r was amplified using 49(SEQ ID NO.16) as a template and primers (49-r-FP, 49-r-RP).

pCAMBIA1300(gene bank access: AF234296.1) was digested simultaneously with KpnI and XhoI to recover the vector FV.

FV, 35S-TEV-r, 3-r were spliced using a seamless cloning approach such that 3 was functionally linked to the 35S promoter and TEV 5' UTR at 5' and CaMV35S terminator at 3', and the resulting vector was named 1300-3.

FV, 35S-TEV-r, 48-r were spliced using a seamless cloning approach such that 48 was functionally linked to the 35S promoter and TEV 5' UTR at 5' and CaMV35S terminator at 3', and the resulting vector was named 1300-48.

FV, 35S-TEV-r, CF48-r were spliced using a seamless cloning approach such that CF48 was functionally linked 5' to the 35S promoter and TEV 5' UTR, and 3' to the CaMV35S terminator, and the resulting vector was named 1300-CF 48.

FV, 35S-TEV-r, 49-r were spliced using a seamless cloning approach such that 49 was functionally linked to the 35S promoter and TEV 5' UTR at 5' and CaMV35S terminator at 3', and the resulting vector was named 1300-49.

The artificially synthesized fragment pH4A748-H3.3intron-CP4-H4A748terminator (SEQ ID NO.18) was inserted between the (HindIII, KpnI) multiple cloning sites of 1300-3, 1300-48, 1300-CF48, 1300-49, respectively, by means of (HindIII, KpnI) digestion. The final plant transformation vectors 1300-CP4-3, 1300-CP4-48, 1300-CP4-CF48, 1300-CP4-49 were obtained. The resulting final support structure is shown in fig. 1 to 4. The plant transformation vector was transformed to agrobacterium strain LBA4404 by electric shock.

TABLE 6 primer sequences used in the construction of sugarcane P450 plant expression vectors

Primer name	Sequence 5'to 3'
		35S-r-FP	AGAAAAGGATCCCCGGGTACCGTAATCATGGTCATAGCTGTTTCCTGTG
TEV-r-RP	GGCTATCGTTCGTAAATGGTGAAAATTTT
		3-r-FP	TTACGAACGATAGCCAGATCTATGGATAAGGCCTACGTTGTCGTCCTCT
3-r-RP	ATTATTATGGAGAAACTCGAAGAATTCTCACAACTTCTGAAGGACATCAAGCATG
		48-r-FP	TTACGAACGATAGCCAGATCTATGGATAAGGCCTATATCGCCGTCCTCT
48-r-RP	ATTATTATGGAGAAACTCGAAGAATTCTCAGAGCTCCTGAAGAACATCACGCATA
		CF48-r-FP	TTACGAACGATAGCCAGATCTATGGATAAGGCCTATATCGCCGTCCTCT
CF48-r-RP	ATTATTATGGAGAAACTCGAAGAATTCTCAGAGCTCCTGAAGAACATCACGCATA
		49-r-FP	TTACGAACGATAGCCAGATCTATGGATAAGGCCTACGTGGCCGTGCTCT
49-r-RP	ATTATTATGGAGAAACTCGAAGAATTCTCAGAGCTCCAGAAGAACATCGCGCATA

Example 3 transformation of Rice

The transgenic rice is obtained by adopting the prior art (Luandroster Gong Xun 1998 life science 10: 125-. Mature and full 'Xishui 134' seeds are selected to be hulled, and callus is generated by induction and is used as a transformation material. Respectively taking agrobacterium slide plates containing target gene vectors 1300-CP4-3, 1300-CP4-48, 1300-CP4-CF48 and 1300-CP4-49, and selecting a single colony to inoculate agrobacterium for transformation. Putting the callus to be transformed into an agrobacterium liquid (containing acetosyringone) with a proper concentration, allowing agrobacterium to be combined to the surface of the callus, transferring the callus into a co-culture medium, and culturing for 2-3 days. The transformed calli were rinsed with sterile water, transferred to selection medium containing appropriate glyphosate, and selected for two months (one intermediate subculture). Transferring the selected callus with good growth activity to a pre-differentiation culture medium for about 20 days, transferring the pre-differentiated callus to the differentiation culture medium, and irradiating for 14 hours to differentiate and germinate. After 2-3 weeks, the resistant regenerated plants are transferred to a rooting culture medium containing glyphosate (0.1mg/L) for strong seedling and rooting, and finally the regenerated plants are washed off and agar is transplanted to a greenhouse to be used as an identification material.

Example 4 herbicide resistance assay of transgenic Rice

10 transformants obtained by transformation with the vectors 1300-CP4-3, 1300-CP4-48, 1300-CP4-CF48 and 1300-CP4-49, respectively, and a non-transgenic strain of the same variety "Xiuishui 134" were planted in a greenhouse (temperature 15-25 ℃), and the flazasulfuron-methyl (Xibaigong, Nippon stone Seiko Co., Ltd.) was sprayed at a dose of 5.6 mg/m at a seedling height of about 10 cm. The results of the examination after 10 days are shown in Table 7. It can be seen that most of the 4 genes transformed with CF48 gene showed good resistance to flazasulfuron, while the other three genes 3, 48, 49 showed no difference in flazasulfuron resistance from the control.

TABLE 7 resistance of rice transgenic for different sugarcane P450 genes to flazasulfuron

Transformation vector	No chemical injury	Slight damage	Severe damage	Death was caused by death
					1300-CP4-3	0	0	0	10
1300-CP4-48	0	0	0	10
					1300-CP4-CF48	3	5	1	1
1300-CP4-49	0	0	0	10
					CK	0	0	0	10

Example 6: determination of resistance of rice transformant with transferred CF48 gene to HPPD inhibitor herbicides:

10 different transgenic rice plants transformed with 1300-CP4-CF48 vector and non-transgenic rice plants of the same variety "Xiushui 134" were selected and planted in the greenhouse (temperature 15-25 deg.C), and sprayed with mesotrione at a concentration of 15 mg/m at a seedling height of about 10 cm. After 10 days of examination, all non-transgenic plants were found dead, whereas the mortality rate for transgenic rice plants was 0%, of which 3 transgenic lines did not have any visible growth inhibition and 5 lines grew slowly.

Example 7: gene with herbicide resistance function obtained by replacing protein structural domain

The amino acid sequence of CF48(SEQ ID NO.19) and the amino acid sequence of cytochrome P450 gene Zm-513 (the nucleotide sequence is SEQ ID NO.21, the amino acid sequence is SEQ ID NO.22) of a corn species have 81 percent of identity. However, the resistance of rice expressing Zm-513 to herbicides such as nicosulfuron, mesotrione, etc. was not improved (U.S. Pat. No.5,965,7307). In order to determine the region of CF48 protein sequence which determines the function of herbicide resistance, 67 amino acids (amino acid sequence SEQ ID NO.20) from 104 to 170 of its sequence were used to replace the corresponding polypeptide fragment (67 amino acids from 107 to 173 of Zm-513) in Zm-513 to obtain 513-CF48SW (SEQ ID NO.23), and the gene SEQ ID NO.24 encoding 513-CF48SW protein was artificially synthesized. This synthetic gene was mutated in only 14 of 73 amino acids from 107 to 173, as compared with Zm-513.

The T-DNA vector 1300-513-CF48SW was obtained by functionally linking the DNA fragment encoding 513-CF48SW at the 5 'end with the 35S promoter and at the 3' end with the 35S terminator in the same manner as in example 2. This vector was used to transform rice to obtain transgenic rice (the same method as in example 3). As a control, Zm-513(SEQ ID NO.21) was cloned under the control of the same promoter and terminator into the same transformation vector to obtain the T-DNA vector 1300-513, which was used to transform rice to obtain transgenic rice (same method as in example 3).

Example 8: determination of resistance of P450 transgenic rice by protein structure replacement:

10 different transgenic rice strains obtained by transforming 1300-513-CF48SW vectors and non-transgenic strains of the same variety 'Xiushui 134' are selected to be planted in a greenhouse (temperature is 15-25 ℃), and when the height of a seedling is about 10cm, flazasulfuron with the concentration of 6 mg/square meter is sprayed. After 10 days of examination, all non-transgenic plants were found dead, whereas the mortality rate for transgenic rice plants was 0%, with 6 transgenic lines without any visible growth inhibition and 4 lines with reduced growth.

10 different transgenic rice plants transformed with 1300-513-CF48SW vector and a non-transgenic plant of the same variety "Xiushui 134" were selected and planted in the greenhouse (temperature 15-25 ℃) and sprayed with mesotrione at a concentration of 6 mg/m at a seedling height of about 10 cm. After 10 days of examination, all non-transgenic plants were found dead, whereas the mortality rate for transgenic rice plants was 0%, with 5 transgenic lines without any visible growth inhibition and 5 lines with slow growth.

10 different transgenic rice strains obtained by transforming 1300-513 vector and non-transgenic strains of the same variety 'Xiushui 134' are selected to be planted in a greenhouse (the temperature is 15-25 ℃), and when the height of a seedling is about 10cm, the flazasulfuron with the concentration of 6 mg/square meter is sprayed. After 10 days of examination, all the non-transgenic strains and the transgenic strains are dead, which indicates that Zm-513 has no nicosulfuron resistance.

10 different transgenic rice plants obtained by transforming 1300-513 vector and non-transgenic plants of the same variety 'Xiushui 134' are selected and planted in a greenhouse (temperature is 15-25 ℃), and when the height of a seedling is about 10cm, mesotrione with the concentration of 15 mg/square meter is sprayed. Examination after 10 days revealed that all of the non-transgenic and transgenic lines died, indicating that Zm-513 did not have mesotrione resistance.

Sequence listing

<110> Hangzhou Ruifeng Biotechnology Ltd

<120> herbicide-resistant gene and application thereof

<160> 24

<170> SIPOSequenceListing 1.0

<210> 1

<211> 642

<212> DNA

<213> Unknown (Unknown)

<400> 1

cgccagggag tgcctcacag agcacgacgt gaccttcgcg aaccgcccga ccttccccac 60

gttgcatctc atgacctatg ggagcaccac ggtcggcacc tgcgcctacg ggccgtactg 120

gcgccacatg cgccgcgtca tcacggtgca cctcctgtcc gctcaccgtg tgaggtccat 180

gctccccgcc atcgaagcac aggtgcgcgc catggcgcgg agtatgtacc gtgctgccgc 240

ggccgctccc ggcggcaccg gcggcgccgc gagggtggaa cagaggggga ggctgttcga 300

gctcgccatc agcgccctta tggaaaccat cgcgcaaacc aagacatccc gtgccgtgga 360

tgacgcggac acgggcatgt caccggaggc gcaggagttc aaggagtcga tggatgttat 420

ggttccgctt ctcggcacgg ccaatatgtg ggatttcctg cccatcctac agaggttcga 480

cgtgtccggc gtgaagaaca agatcgcggc ctctgtaaac agcagggacg cgttctttcg 540

gcggctgatt gacgcggagc ggcggaggct ggacgacggc gttaagagcg agaacaaaag 600

catgatggcc gtgctgctca ctttgcagaa gtcagagccg ga 642

<210> 2

<211> 633

<212> DNA

<213> Unknown (Unknown)

<400> 2

cgccaagggg tgcttcacgg agcacgacgt gaacttcgcc aaccgcccga tgttcccgtc 60

gatgcggctc gtgtccttcg acggcgcctt gctctccgtg tccagctacg gcccgtactg 120

gcgcaacctc cgccgcgtcg ccaccgtcca gctgctctcc gcgcaccgcg tcgcgtgcat 180

gacccccgtc atcgccgcgg aggtgcgcgc catggtgcgg aggatggacc acgccgccgc 240

ggccgtccca ggcggcgccg cgcgcatcca gctgaagcgg aggctgttcg agctctccct 300

cagcgtcctc atggagacca tcgcgcagac caagacgtcc cgcaccgagg ccaacgccga 360

cacggacatg tcgcccgagg cgcacgagtt caagcagatc atcgacgagc tcgtgccgta 420

cctcggcacg gccaaccggt gggattacct gccggtgttg cggtggttct acgtgtacgg 480

cgtgaggaac aggatcctcg atgctgtgag cagaagagac gcgttcttga agcgactcat 540

cgacggggag cggcggaggc tcgacgatgg caaggagagc gaaaataaga gcatgattgc 600

ggtgctgctc actttgcaga agtctgagcc aga 633

<210> 3

<211> 633

<212> DNA

<213> Unknown (Unknown)

<400> 3

cgccaaggag tgcttcacgg agcacgacgt gaacttcgcc aaccgcccga tgttcccgtc 60

gatgcggctc gtgtccttcg acggcgcctt gctctccatg tccagctacg gcccgtactg 120

gcgcaacctc cgccgcgtcg ccaccgtcca gctgctctcc gcgcaccgcg tcgcgtgcat 180

gacccccgtc atcgccgcgg aggtgcgcgc catggtgcgg aggatggacc acgccgccgc 240

ggccgcccca ggcggcgccg cgcgcatcca gatgaagcgg aggctgttcg agctctccct 300

cagcgtcctc atggagacaa tcgcgcagac caagacgtcc cgcaccgagg ccaacgccga 360

cacggacatg tcgcccgagg cgcacgagtt caagcagatc atcgacgagc tcgtgccata 420

cctcggcacg gccaaccggt gggattacct gccggtgttg cggtggttcg acgtgtacgg 480

cgtgaggaac aggatcctcg atgctgtgag cagaagagac gcgttcttga agcgactcat 540

cgacggggag cggcggaggc tccacgatgg caaggagagc gaaaataaga gcatgatcgc 600

ggtgctgctc actttgcaga agtctgagcc aga 633

<210> 4

<211> 633

<212> DNA

<213> Unknown (Unknown)

<400> 4

cgccaaggag tgcttcacgg agcacgacgt ggccttcgcc aaccgcccca ggttcgccac 60

gcaggagctc gtgtccttcg gcggcgccgc gctcgccacg gccagctacg ggccctactg 120

gcgcaacctc cgccgcgtcg ccgccgtgca gctcctctcc gcgcaccgcg tcgcctgcat 180

gtcctccgtt atctccgccg aggtgcgcgc catggtgcgc cggatgagcc acgcggccgc 240

ggcggcgccc gacggcgccg cgcgcatcca gctcaagcgg aggctgttcg aggtctccct 300

cagcgtgctc atggagacca tcgcgcagac caagacctcc cgcaccgagg ccaacgccga 360

cacggacatg tcgcccgagg cgcacgagtt caagcagatc gtcgacgaga tcgtgccgca 420

cctcggcacg gccaacctgt gggactacct gcccgtgctg cagtggttcg acgtgttcgg 480

cgtgaggaac aagatcatgg ccgctgtgag caggagggac gcgttcctac ggaggctcat 540

cgacgccgag cggcagagga tggacgacgg cggcgacagc gataagaaga gcatgatcgc 600

cgtgctgctc tcgttgcaga agtcagagcc gga 633

<210> 5

<211> 596

<212> DNA

<213> Unknown (Unknown)

<400> 5

atggataagg cctacgttgt cgtcctctcg ttcttcttca tctttgcaat ccaccgcctc 60

ctcaaccgcg gtcatagcaa aaatacgagc atgcagcagc tgccaccggg gcctctcgcc 120

gtcccggtcc tcggccactt acacctcctc gagaagccgt tccaccacgc gtttatgcgc 180

ctcgccgcgt gctacgggcc tgtggtctcc ctccggctcg gctcgcgcga cgctgtggtc 240

gtgtcctccg cggactgcgc cagggagtgc ctcacagagc acgacgtgac cttcgcgaac 300

cgcccgacct tccccacgtt gcatctcatg acctatggga gcaccacggt cggcacctgc 360

gcctacgggc cgtactggcg ccacatgcgc cgcgtcatca cggtgcacct cctgtccgct 420

caccgtgtga ggtccatgct ccccgccatc gaagcacagg tgcgcgccat ggcgcggagt 480

atgtaccgtg ctgccgcggc cgctcccggc ggcaccggcg gcgccgcgag ggtggaacag 540

agggggaggc tgttcgagct cgccatcagc gcccttatgg aaaccatcgc gcaaac 596

<210> 6

<211> 741

<212> DNA

<213> Unknown (Unknown)

<400> 6

atggataagg cctatatcgc cgtcctctcc ggcgccttcc tattcttgct ccactacctc 60

gtgggccgtg ccagcggcgg cggcaagggc aagggccaac agcttccgcc gagccctccg 120

gccatcccgt tcctcggcca cctccatctt atcaagactc cgttccacgc ggcgctgacc 180

cggctcgcgg cgcgccatgg cccggtgttc tccatgcgca tggggtcccg ccgcgccgtg 240

gtcgtgtcct cgccggagtg cgccaagggg tgcttcacgg agcacgacgt gaacttcgcc 300

aaccgcccga tgttcccgtc gatgcggctc gtgtccttcg acggcgcctt gctctccgtg 360

tccagctacg gcccgtactg gcgcaacctc cgccgcgtcg ccaccgtcca gctgctctcc 420

gcgcaccgcg tcgcgtgcat gacccccgtc atcgccgcgg aggtgcgcgc catggtgcgg 480

aggatggacc acgccgccgc ggccgtccca ggcggcgccg cgcgcatcca gctgaagcgg 540

aggctgttcg agctctccct cagcgtcctc atggagacca tcgcgcagac caagacgtcc 600

cgcaccgagg ccaacgccga cacggacatg tcgcccgagg cgcacgagtt caagcagatc 660

atcgacgagc tcgtgccgta cctcggcacg gccaaccggt gggattacct gccggtgttg 720

cggtggttct acgtgtacgg c 741

<210> 7

<211> 741

<212> DNA

<213> Unknown (Unknown)

<400> 7

atggataagg cctatatcgc cgtcctctcc ggcgccttcc tattcttgct ccactacctc 60

gtgggccgtg ccagcggcgg cggcaagggc aagggccaac agcttccgcc gagccctccg 120

gccatcccgt tcctcggcca cctccatctt gtcaagactc cgttccacgc ggcgctgacc 180

cggctggcgg cgcgccatgg cccggtgttc tccatgcgca tggggtcccg ccgcgccgtg 240

gtcgtgtcct cgccggagtg cgccaaggag tgcttcacgg agcacgacgt gaacttcgcc 300

aaccgcccga tgttcccgtc gatgcggctc gtgtccttcg acggcgcctt gctctccatg 360

tccagctacg gcccgtactg gcgcaacctc cgccgcgtcg ccaccgtcca gctgctctcc 420

gcgcaccgcg tcgcgtgcat gacccccgtc atcgccgcgg aggtgcgcgc catggtgcgg 480

aggatggacc acgccgccgc ggccgcccca ggcggcgccg cgcgcatcca gatgaagcgg 540

aggctgttcg agctctccct cagcgtcctc atggagacaa tcgcgcagac caagacgtcc 600

cgcaccgagg ccaacgccga cacggacatg tcgcccgagg cgcacgagtt caagcagatc 660

atcgacgagc tcgtgccata cctcggcacg gccaaccggt gggattacct gccggtgttg 720

cggtggttcg acgtgtacgg c 741

<210> 8

<211> 611

<212> DNA

<213> Unknown (Unknown)

<400> 8

atggataagg cctacgtggc cgtgctctcc ttcgccttcc tcttcgtgct ccactacctc 60

gtcggccgtg ctggcggcaa cggccgcaag ggagataatg gcaaggggaa ggcagcgcag 120

cggctgcctc ccagccctcc cgccgtcccg ttcctcggcc acctccacct cgtcaagacg 180

ccattccacg aggcgctggc cggcctcgcc gcgcgccacg gcccggtgtt ctccatgcgc 240

atgggctccc gcggcgcggt ggtcgtgtcc tcgcccgagt gcgccaagga gtgcttcacg 300

gagcacgacg tggccttcgc caaccgcccc aggttcgcca cgcaggagct cgtgtccttc 360

ggcggcgccg cgctcgccac ggccagctac gggccctact ggcgcaacct ccgccgcgtc 420

gccgccgtgc agctcctctc cgcgcaccgc gtcgcctgca tgtcctccgt tatctccgcc 480

gaggtgcgcg ccatggtgcg ccggatgagc cacgcggccg cggcggcgcc cgacggcgcc 540

gcgcgcatcc agctcaagcg gaggctgttc gaggtctccc tcagcgtgct catggagacc 600

atcgcgcaga c 611

<210> 9

<211> 1251

<212> DNA

<213> Unknown (Unknown)

<400> 9

cccttatgga aaccatcgcg caaaccaaga catcccgtgc cgtggatgac gcggacacgg 60

gcatgtcacc ggaggcgcag gagttcaagg agtcgatgga tgttatggtt ccgcttctcg 120

gcacggccaa tatgtgggat ttcctgccca tcctacagag gttcgacgtg tccggcgtga 180

agaacaagat cgcggcctct gtaaacagca gggacgcgtt ctttcggcgg ctgattgacg 240

cggagcggcg gaggctggac gacggcgtta agagcgagaa caaaagcatg atggccgtgc 300

tgctcacttt gcagaagtca gagccggaga attacaatga tgacatgatc atgtctttat 360

gcttctccat gttctctgcg ggaacggaaa cctcggcgac cacggcggaa tgggcgatgt 420

cgctgctcct gaaccacccc gaggccctga agaaagcaca gggggaaatt gacgcgtacg 480

tggggaattc ccgcctgcta ggcgccgacg acatgccggg cctcagctac ctccagtgca 540

tcctcaccga gacgctccgg ctgtacccgg tcgtgccgac gctgatcccg cacgagtcca 600

ccgcagactc cacggtcggc ggccaccacg tgccaagcgg cacgatgctg ttcgtcaacg 660

tgtacgccat ccacagggat cccgcggcgt ggacggaccc ggccgtcttc aggcctgagc 720

gattcgagga cggcagcgcc gaagggaggc tcctgatgcc gttcgggatg gagcgtcgca 780

agtgtcccgg ggagaccatg gcgctgcgaa ccctggggct ggtcctgggg acgttgatcc 840

agtgcttcga ctgggacact gtcggcggcg tccccaaagt tgacatggcc gaaggggctg 900

gactcaccct cccgaaggct gtttctcttg acgccatgtg caaaccgcgc caagtcatgc 960

ttgatgtcct tcagaagttg tgagcgcctt taataatcta ctctgcgcac agaagaagtt 1020

gagcatcatc acaaaatctc tgtggggcta tgtttatccc acttttaata acagaagatt 1080

taactatcta tatctactcg caaacatgtc cgtacgttgc aacaacgtat ggcttgtatt 1140

ttctgttgta ataagcttta gagtataaaa ctctatcacc ctgttcgttt aagctattca 1200

gcgaaatcag caatcaaaaa aaaaaaaaag tcgacatcga tacgcgtggt c 1251

<210> 10

<211> 833

<212> DNA

<213> Unknown (Unknown)

<400> 10

tgttgcggtg gttctacgtg tacggcgtga ggaacaggat cctcgatgct gtgagcagaa 60

gagacgcgtt cttgaagcga ctcatcgacg gggagcggcg gaggctcgac gatggcaagg 120

agagcgaaaa taagagcatg attgcggtgc tgctcacttt gcagaagtct gagccagagg 180

tctacactga cactatgatc atagctctgt gcgcgaactt atttggcgcc ggaacggaga 240

ccacgtccac cacgacggaa tgggccatgt cgctcctgct gaaccacccg gaggccctca 300

agaaggcgca ggccgagatc gacgccgccg tgggaacctc ccgcctggtg accgcggacg 360

acgtgtctca cctcgcctac ctgcagtgca tcatgaacga gacgctgcgc ctgtaccctg 420

ccgcgccgct gctgctgccg cacgagtcct ccgcagattg caaggtcggc ggctacgacg 480

tgccccgcgg cacgatgctg ctggtgaacg cgtacgccat ccacagggac ccggcggtgt 540

gggaggaccc ggccgagttc aggccggagc ggttcgagga cgacggaaag gccgaggggc 600

ggctgctgat gccgttcggg atggggcggc gcaagtgccc cggggaggcg ctcgcgctgc 660

ggaccattgg gctggtgctc ggaacgctga tccagtgttt cgactgggac agggttgatg 720

gagttgaggt cgacatggcc gagagcggcg ggctgaccat atccagggcc gtcccgttgg 780

aggccatgtg caagccgcgt gcagctatgc gtgatgttct tcaggagctc tga 833

<210> 11

<211> 989

<212> DNA

<213> Unknown (Unknown)

<400> 11

tgttgcggtg gttcgacgtg tacggcgtga ggaacaggat cctcgatgct gtgagcagaa 60

gagacgcgtt cttgaagcga ctcatcgacg gggagcggcg gaggctccac gatggcaagg 120

agagcgaaaa taagagcatg atcgcggtgc tgctcacttt gcagaagtct gagccagagg 180

tctacactga cactatgatc atagctctgt gcgcgaactt atttggcgcc ggaacggaga 240

ccacgtccac cacgacggaa tgggccatgt cgctcctgct gaaccacccg gaggccctca 300

agaaggcgca ggccgagatc gacgccgccg tgggaacctc ccgcctggtg accgcggacg 360

acgtgtctca cctcgcctac ctgcagtgca tcatgaacga gacgctgcgc ctgtaccctg 420

ccgcgccgct gctgctgccg cacgagtcct ccgcagattg caaggtcggc ggctacgacg 480

tgccccgcgg cacgatgctg ctggtgaacg cgtacgccat ccacagggac ccggcggtgt 540

gggaggaccc ggccgagttc aggccggagc ggttcgagga cgacggaaag gccgaggggc 600

ggctgctgat gccgttcggg atggggcggc gcaagtgccc cggggaggcg ctcgcgctgc 660

ggaccattgg gatggtgctc ggaacgctga tccagtgttt cgactgggac agggttgatg 720

gagttgaggt cgacatggcc gagagcggcg ggctgaccat atccagggcc gtcccgttgg 780

aggccatgtg caagccgcgt gcagctatgc gtgatgttct tcaggagctc tgaccatctc 840

atggagcgac ttgttggcat cgtctagtcg agtctgatag tgtgtgacgt agctacatgg 900

gttgtacatg gaacatgggt ttatataagt tcgagtacaa gatgccctat gaacaaaaaa 960

aaaaaaagtc gacatcgata cgcgtggtc 989

<210> 12

<211> 1313

<212> DNA

<213> Unknown (Unknown)

<400> 12

tgctcatgga gaccatcgcg cagaccaaga cctcccgcac cgaggccaac gccgacacgg 60

acatgtcgcc cgaggcgcac gagttcaagc agatcgtcga cgagatcgtg ccgcacctcg 120

gcacggccaa cctgtgggac tacctgcccg tgctgcagtg gttcgacgtg ttcggcgtga 180

ggaacaagat catggccgct gtgagcagga gggacgcgtt cctacggagg ctcatcgacg 240

ccgagcggca gaggatggac gacggcggcg acagcgataa gaagagcatg atcgccgtgc 300

tgctctcgtt gcagaagtca gagccggagg tgtacacgga taccatgatc atggcacttt 360

gcgggaactt atttggcgcg ggaacggaga ccacatcgtc cacgacagaa tgggccatgt 420

cgcttcttct gaaccacccg gaggcgctca agaaggcaca ggcagagatc gacggcgtcg 480

tgggcaactc ccgcctgatc actgcagaag acgtgccccg cctcggctac ctgcactgca 540

tcatcaacga gaccgtgcgc atgtacccgg ccgctccgct gctcctgccg cacgagtcgt 600

ccgcggactg caaggtcggc ggctacgacg tgccccgcgg cacgctgctg atcgtgaacg 660

cgtacgccat ccacagggac ccggctgtgt gggaggaccc tgccgagttc aggccggagc 720

ggttcgagga cgggaaggcc gaggggcggc tcctgatgcc gttcgggatg gggcggcgca 780

agtgccccgg ggagacgctc gcgctgcgga ccatcggcct ggtgctcggc acgctgatcc 840

agtgcttcga ctgggaccga gtcgatggcc tcgagattga catgaccgcg ggtggcgggc 900

tgaccatgcc cagggccgtc ccgttggagg ccacgtgcaa gcctcgtgca gctatgcgcg 960

atgttcttct ggagctctga tggagtaaca tcttggcata tgatccctag ttctcactcc 1020

gcggtaaaag gttcaaccag tactagtgtg taggtgtgta gcagtatgct ttggcttatg 1080

gtgtgtgctg aactaaataa gcttgggtgc gtaataccct cgtacgtttt atctcttcgg 1140

taaaatgtat gtacagtcgt ttgtatgagc aattagaagt tgtttcacaa ttcacagtat 1200

ggtttagcaa attgtaatct tctgcaggtt atcttgtata gtattcagga tataaaatgc 1260

acggtgtttt tgctcaaaaa aaaaaaaaaa agtcgacatc gatacgcgtg gtc 1313

<210> 13

<211> 1554

<212> DNA

<213> Unknown (Unknown)

<400> 13

atggataagg cctacgttgt cgtcctctcg ttcttcttca tctttgcaat ccaccgcctc 60

ctcaaccgcg gtcatagcaa aaatacgagc atgcagcagc tgccaccggg gcctctcgcc 120

gtcccggtcc tcggccactt acacctcctc gagaagccgt tccaccacgc gtttatgcgc 180

ctcgccgcgt gctacgggcc tgtggtctcc ctccggctcg gctcgcgcga cgctgtggtc 240

gtgtcctccg cggactgcgc cagggagtgc ctcacagagc acgacgtgac cttcgcgaac 300

cgcccgacct tccccacgtt gcatctcatg acctatggga gcaccacggt cggcacctgc 360

gcctacgggc cgtactggcg ccacatgcgc cgcgtcatca cggtgcacct cctgtccgct 420

caccgtgtga ggtccatgct ccccgccatc gaagcacagg tgcgcgccat ggcgcggagt 480

atgtaccgtg ctgccgcggc cgctcccggc ggcaccggcg gcgccgcgag ggtggaacag 540

agggggaggc tgttcgagct cgccatcagc gcccttatgg aaaccatcgc gcaaaccaag 600

acatcccgtg ccgtggatga cgcggacacg ggcatgtcac cggaggcgca ggagttcaag 660

gagtcgatgg atgttatggt tccgcttctc ggcacggcca atatgtggga tttcctgccc 720

atcctacaga ggttcgacgt gtccggcgtg aagaacaaga tcgcggcctc tgtaaacagc 780

agggacgcgt tctttcggcg gctgattgac gcggagcggc ggaggctgga cgacggcgtt 840

aagagcgaga acaaaagcat gatggccgtg ctgctcactt tgcagaagtc agagccggag 900

aattacaatg atgacatgat catgtcttta tgcttctcca tgttctctgc gggaacggaa 960

acctcggcga ccacggcgga atgggcgatg tcgctgctcc tgaaccaccc cgaggccctg 1020

aagaaagcac agggggaaat tgacgcgtac gtggggaatt cccgcctgct aggcgccgac 1080

gacatgccgg gcctcagcta cctccagtgc atcctcaccg agacgctccg gctgtacccg 1140

gtcgtgccga cgctgatccc gcacgagtcc accgcagact ccacggtcgg cggccaccac 1200

gtgccaagcg gcacgatgct gttcgtcaac gtgtacgcca tccacaggga tcccgcggcg 1260

tggacggacc cggccgtctt caggcctgag cgattcgagg acggcagcgc cgaagggagg 1320

ctcctgatgc cgttcgggat ggagcgtcgc aagtgtcccg gggagaccat ggcgctgcga 1380

accctggggc tggtcctggg gacgttgatc cagtgcttcg actgggacac tgtcggcggc 1440

gtccccaaag ttgacatggc cgaaggggct ggactcaccc tcccgaaggc tgtttctctt 1500

gacgccatgt gcaaaccgcg ccaagtcatg cttgatgtcc ttcagaagtt gtga 1554

<210> 14

<211> 1548

<212> DNA

<213> Unknown (Unknown)

<400> 14

atggataagg cctatatcgc cgtcctctcc ggcgccttcc tattcttgct ccactacctc 60

gtgggccgtg ccagcggcgg cggcaagggc aagggccaac agcttccgcc gagccctccg 120

gccatcccgt tcctcggcca cctccatctt atcaagactc cgttccacgc ggcgctgacc 180

cggctcgcgg cgcgccatgg cccggtgttc tccatgcgca tggggtcccg ccgcgccgtg 240

gtcgtgtcct cgccggagtg cgccaagggg tgcttcacgg agcacgacgt gaacttcgcc 300

aaccgcccga tgttcccgtc gatgcggctc gtgtccttcg acggcgcctt gctctccgtg 360

tccagctacg gcccgtactg gcgcaacctc cgccgcgtcg ccaccgtcca gctgctctcc 420

gcgcaccgcg tcgcgtgcat gacccccgtc atcgccgcgg aggtgcgcgc catggtgcgg 480

aggatggacc acgccgccgc ggccgtccca ggcggcgccg cgcgcatcca gctgaagcgg 540

aggctgttcg agctctccct cagcgtcctc atggagacca tcgcgcagac caagacgtcc 600

cgcaccgagg ccaacgccga cacggacatg tcgcccgagg cgcacgagtt caagcagatc 660

atcgacgagc tcgtgccgta cctcggcacg gccaaccggt gggattacct gccggtgttg 720

cggtggttct acgtgtacgg cgtgaggaac aggatcctcg atgctgtgag cagaagagac 780

gcgttcttga agcgactcat cgacggggag cggcggaggc tcgacgatgg caaggagagc 840

gaaaataaga gcatgattgc ggtgctgctc actttgcaga agtctgagcc agaggtctac 900

actgacacta tgatcatagc tctgtgcgcg aacttatttg gcgccggaac ggagaccacg 960

tccaccacga cggaatgggc catgtcgctc ctgctgaacc acccggaggc cctcaagaag 1020

gcgcaggccg agatcgacgc cgccgtggga acctcccgcc tggtgaccgc ggacgacgtg 1080

tctcacctcg cctacctgca gtgcatcatg aacgagacgc tgcgcctgta ccctgccgcg 1140

ccgctgctgc tgccgcacga gtcctccgca gattgcaagg tcggcggcta cgacgtgccc 1200

cgcggcacga tgctgctggt gaacgcgtac gccatccaca gggacccggc ggtgtgggag 1260

gacccggccg agttcaggcc ggagcggttc gaggacgacg gaaaggccga ggggcggctg 1320

ctgatgccgt tcgggatggg gcggcgcaag tgccccgggg aggcgctcgc gctgcggacc 1380

attgggctgg tgctcggaac gctgatccag tgtttcgact gggacagggt tgatggagtt 1440

gaggtcgaca tggccgagag cggcgggctg accatatcca gggccgtccc gttggaggcc 1500

atgtgcaagc cgcgtgcagc tatgcgtgat gttcttcagg agctctga 1548

<210> 15

<211> 1548

<212> DNA

<213> Unknown (Unknown)

<400> 15

atggataagg cctatatcgc cgtcctctcc ggcgccttcc tattcttgct ccactacctc 60

gtgggccgtg ccagcggcgg cggcaagggc aagggccaac agcttccgcc gagccctccg 120

gccatcccgt tcctcggcca cctccatctt gtcaagactc cgttccacgc ggcgctgacc 180

cggctggcgg cgcgccatgg cccggtgttc tccatgcgca tggggtcccg ccgcgccgtg 240

gtcgtgtcct cgccggagtg cgccaaggag tgcttcacgg agcacgacgt gaacttcgcc 300

aaccgcccga tgttcccgtc gatgcggctc gtgtccttcg acggcgcctt gctctccatg 360

tccagctacg gcccgtactg gcgcaacctc cgccgcgtcg ccaccgtcca gctgctctcc 420

gcgcaccgcg tcgcgtgcat gacccccgtc atcgccgcgg aggtgcgcgc catggtgcgg 480

aggatggacc acgccgccgc ggccgcccca ggcggcgccg cgcgcatcca gatgaagcgg 540

aggctgttcg agctctccct cagcgtcctc atggagacaa tcgcgcagac caagacgtcc 600

cgcaccgagg ccaacgccga cacggacatg tcgcccgagg cgcacgagtt caagcagatc 660

atcgacgagc tcgtgccata cctcggcacg gccaaccggt gggattacct gccggtgttg 720

cggtggttcg acgtgtacgg cgtgaggaac aggatcctcg atgctgtgag cagaagagac 780

gcgttcttga agcgactcat cgacggggag cggcggaggc tccacgatgg caaggagagc 840

gaaaataaga gcatgatcgc ggtgctgctc actttgcaga agtctgagcc agaggtctac 900

actgacacta tgatcatagc tctgtgcgcg aacttatttg gcgccggaac ggagaccacg 960

tccaccacga cggaatgggc catgtcgctc ctgctgaacc acccggaggc cctcaagaag 1020

gcgcaggccg agatcgacgc cgccgtggga acctcccgcc tggtgaccgc ggacgacgtg 1080

tctcacctcg cctacctgca gtgcatcatg aacgagacgc tgcgcctgta ccctgccgcg 1140

ccgctgctgc tgccgcacga gtcctccgca gattgcaagg tcggcggcta cgacgtgccc 1200

cgcggcacga tgctgctggt gaacgcgtac gccatccaca gggacccggc ggtgtgggag 1260

gacccggccg agttcaggcc ggagcggttc gaggacgacg gaaaggccga ggggcggctg 1320

ctgatgccgt tcgggatggg gcggcgcaag tgccccgggg aggcgctcgc gctgcggacc 1380

attgggatgg tgctcggaac gctgatccag tgtttcgact gggacagggt tgatggagtt 1440

gaggtcgaca tggccgagag cggcgggctg accatatcca gggccgtccc gttggaggcc 1500

atgtgcaagc cgcgtgcagc tatgcgtgat gttcttcagg agctctga 1548

<210> 16

<211> 1566

<212> DNA

<213> Unknown (Unknown)

<400> 16

atggataagg cctacgtggc cgtgctctcc ttcgccttcc tcttcgtgct ccactacctc 60

gtcggccgtg ctggcggcaa cggccgcaag ggagataatg gcaaggggaa ggcagcgcag 120

cggctgcctc ccagccctcc cgccgtcccg ttcctcggcc acctccacct cgtcaagacg 180

ccattccacg aggcgctggc cggcctcgcc gcgcgccacg gcccggtgtt ctccatgcgc 240

atgggctccc gcggcgcggt ggtcgtgtcc tcgcccgagt gcgccaagga gtgcttcacg 300

gagcacgacg tggccttcgc caaccgcccc aggttcgcca cgcaggagct cgtgtccttc 360

ggcggcgccg cgctcgccac ggccagctac gggccctact ggcgcaacct ccgccgcgtc 420

gccgccgtgc agctcctctc cgcgcaccgc gtcgcctgca tgtcctccgt tatctccgcc 480

gaggtgcgcg ccatggtgcg ccggatgagc cacgcggccg cggcggcgcc cgacggcgcc 540

gcgcgcatcc agctcaagcg gaggctgttc gaggtctccc tcagcgtgct catggagacc 600

atcgcgcaga ccaagacctc ccgcaccgag gccaacgccg acacggacat gtcgcccgag 660

gcgcacgagt tcaagcagat cgtcgacgag atcgtgccgc acctcggcac ggccaacctg 720

tgggactacc tgcccgtgct gcagtggttc gacgtgttcg gcgtgaggaa caagatcatg 780

gccgctgtga gcaggaggga cgcgttccta cggaggctca tcgacgccga gcggcagagg 840

atggacgacg gcggcgacag cgataagaag agcatgatcg ccgtgctgct ctcgttgcag 900

aagtcagagc cggaggtgta cacggatacc atgatcatgg cactttgcgg gaacttattt 960

ggcgcgggaa cggagaccac atcgtccacg acagaatggg ccatgtcgct tcttctgaac 1020

cacccggagg cgctcaagaa ggcacaggca gagatcgacg gcgtcgtggg caactcccgc 1080

ctgatcactg cagaagacgt gccccgcctc ggctacctgc actgcatcat caacgagacc 1140

gtgcgcatgt acccggccgc tccgctgctc ctgccgcacg agtcgtccgc ggactgcaag 1200

gtcggcggct acgacgtgcc ccgcggcacg ctgctgatcg tgaacgcgta cgccatccac 1260

agggacccgg ctgtgtggga ggaccctgcc gagttcaggc cggagcggtt cgaggacggg 1320

aaggccgagg ggcggctcct gatgccgttc gggatggggc ggcgcaagtg ccccggggag 1380

acgctcgcgc tgcggaccat cggcctggtg ctcggcacgc tgatccagtg cttcgactgg 1440

gaccgagtcg atggcctcga gattgacatg accgcgggtg gcgggctgac catgcccagg 1500

gccgtcccgt tggaggccac gtgcaagcct cgtgcagcta tgcgcgatgt tcttctggag 1560

ctctga 1566

<210> 17

<211> 1171

<212> DNA

<213> Unknown (Unknown)

<400> 17

ggtaccgtaa tcatggtcat agctgtttcc tgtgtgaaat tgttatccgc tcacaattcc 60

acacaacata cgagccggaa gcataaagtg taaagcctgg ggtgcctaat gagtgagcta 120

actcacatta attgcgttgc gctcactgcc cgctttccag tcgggaaacc tgtcgtgcca 180

gctgcattaa tgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg gctagagcag 240

cttgccaaca tggtggagca cgacactctc gtctactcca agaatatcaa agatacagtc 300

tcagaagacc aaagggctat tgagactttt caacaaaggg taatatcggg aaacctcctc 360

ggattccatt gcccagctat ctgtcacttc atcaaaagga cagtagaaaa ggaaggtggc 420

acctacaaat gccatcattg cgataaagga aaggctatcg ttcaagatgc ctctgccgac 480

agtggtccca aagatggacc cccacccacg aggagcatcg tggaaaaaga agacgttcca 540

accacgtctt caaagcaagt ggattgatgt gaacatggtg gagcacgaca ctctcgtcta 600

ctccaagaat atcaaagata cagtctcaga agaccaaagg gctattgaga cttttcaaca 660

aagggtaata tcgggaaacc tcctcggatt ccattgccca gctatctgtc acttcatcaa 720

aaggacagta gaaaaggaag gtggcaccta caaatgccat cattgcgata aaggaaaggc 780

tatcgttcaa gatgcctctg ccgacagtgg tcccaaagat ggacccccac ccacgaggag 840

catcgtggaa aaagaagacg ttccaaccac gtcttcaaag caagtggatt gatgtgatat 900

ctccactgac gtaagggatg acgcacaatc ccactatcct tcgcaagacc ttcctctata 960

taaggaagtt catttcattt ggagaggaca cgctgaaatc accagtctct ctctacaaat 1020

ctatctctct cgagtcaaca caacatatac aaaacaaacg aatctcaagc aatcaagcat 1080

tctacttcta ttgcagcaat ttaaatcatt tcttttaaag caaaagcaat tttctgaaaa 1140

ttttcaccat ttacgaacga tagccagatc t 1171

<210> 18

<211> 3693

<212> DNA

<213> Unknown (Unknown)

<400> 18

aagcttgaga aatatgagtc gaggcatgga tacactaagt tcccctgaag tgagcatgat 60

ctttgatgct gagatgattc ccagagcaag atagtttgtg ctgcaagtga cacaattgta 120

atgaaaccac cactcaacga atttacttgt ggctttgaca tgtcgtgtgc tctgtttgta 180

tttgtgagtg ccggttggta attatttttg ttaatgtgat tttaaaacct cttatgtaaa 240

tagttacttt atctattgaa gtgtgttctt gtggtctata gtttctcaaa gggaaattaa 300

aatgttgaca tcccatttac aattgataac ttggtataca caaactttgt aaatttggtg 360

atatttatgg tcgaaagaag gcaataccca ttgtatgttc caatatcaat atcaatacga 420

taacttgata atactaacat atgattgtca ttgtttttcc agtatcaata tacattaagc 480

tactacaaaa ttagtataaa tcactatatt ataaatcttt ttcggttgta acttgtaatt 540

cgtgggtttt taaaataaaa gcatgtgaaa attttcaaat aatgtgatgg cgcaatttta 600

ttttccgagt tccaaaatat tgccgcttca ttaccctaat ttgtggcgcc acatgtaaaa 660

caaaagacga ttcttagtgg ctatcactgc catcacgcgg atcactaata tgaaccgtcg 720

attaaaacag atcgacggtt tatacatcat tttattgtac acacggatcg atatctcagc 780

cgttagattt aatatgcgat ctgattgctc aaaaaataga ctctccgtct ttgcctataa 840

aaacaatttc acatctttct cacccaaatc tactcttaac cgttcttctt cttctacaga 900

catcaatttc tctcgagagc tcaggcgaag aacaggtatg atttgtttgt aattagatca 960

ggggtttagg tctttccatt actttttaat gttttttctg ttactgtctc cgcgatctga 1020

ttttacgaca atagagtttc gggttttgtc ccattccagt ttgaaaataa aggtccgtct 1080

tttaagtttg ctggatcgat aaacctgtga agattgagtc tagtcgattt attggatgat 1140

ccattcttca tcgttttttt cttgcttcga agttctgtat aaccagattt gtctgtgtgc 1200

gattgtcatt acctagccgt gtatcgagaa ctagggtttt cgagtcaatt ttgccccttt 1260

tggttatatc tggttcgata acgattcatc tggattaggg ttttaagtgg tgacgtttag 1320

tattccaatt tcttcaaaat ttagttatgg ataatgaaaa tccccaattg actgttcaat 1380

ttcttgttaa atgcgcagat ggcggcgacc atggcgtcca acgctgcggc tgcggctgcg 1440

gtgtccctgg accaggccgt ggctgcgtcg gcagcgttct cgtcgcggaa gcagctgcgg 1500

ctgcctgccg cagcgcgcgg agggatgcgg gtgcgggtgc gggcgcgggg tcggcgggag 1560

gcggtggtgg tggcgtccgc gtcgtcgtcg tcggtggcag cgccggcggc gaaggctgag 1620

atgctacacg gtgcaagcag ccggccggca accgctcgca aatcttccgg cctttcggga 1680

acggtcagga ttccgggcga taagtccata tcccaccggt cgttcatgtt cggcggtctt 1740

gccagcggtg agacgcgcat cacgggcctg cttgaaggtg aggacgtgat caataccggg 1800

aaggccatgc aggctatggg agcgcgtatc cgcaaggaag gtgacacatg gatcattgac 1860

ggcgttggga atggcggtct gctcgcccct gaggcccctc tcgacttcgg caatgcggcg 1920

acgggctgca ggctcactat gggactggtc ggggtgtacg acttcgatag cacgttcatc 1980

ggagacgcct cgctcacaaa gcgcccaatg ggccgcgttc tgaacccgtt gcgcgagatg 2040

ggcgtacagg tcaaatccga ggatggtgac cgtttgcccg ttacgctgcg cgggccgaag 2100

acgcctaccc cgattaccta ccgcgtgcca atggcatccg cccaggtcaa gtcagccgtg 2160

ctcctcgccg gactgaacac tccgggcatc accacggtga tcgagcccat catgaccagg 2220

gatcataccg aaaagatgct tcaggggttt ggcgccaacc tgacggtcga gacggacgct 2280

gacggcgtca ggaccatccg ccttgagggc aggggtaaac tgactggcca agtcatcgat 2340

gttccgggag acccgtcgtc cacggccttc ccgttggttg cggcgctgct cgtgccgggg 2400

agtgacgtga ccatcctgaa cgtcctcatg aacccgacca ggaccggcct gatcctcacg 2460

cttcaggaga tgggagccga catcgaggtg atcaacccgc gcctggcagg cggtgaagac 2520

gttgcggatc tgcgcgtgcg ctcctctacc ctgaagggcg tgacggtccc ggaagatcgc 2580

gcgccgtcca tgatagacga gtatcctatt ctggccgtcg ccgctgcgtt cgccgaaggg 2640

gccacggtca tgaacggtct tgaggaactc cgcgtgaagg aatcggatcg cctgtcggcg 2700

gtggccaatg gcctgaagct caacggtgtt gactgcgacg agggtgagac ctcactcgtg 2760

gtccgtggcc ggcctgatgg caagggcctc ggcaacgcca gtggagcggc cgtcgccacg 2820

cacctcgatc atcgcatcgc gatgtccttc ttggtgatgg gtctcgtctc agagaacccg 2880

gtgaccgtcg atgacgccac gatgatagcg acgagcttcc cagagttcat ggatctgatg 2940

gcgggcctcg gggccaagat cgaactgtct gacacgaagg ccgcttgata attagagttt 3000

ttcagatccg cgtttgtgtt ttctgggttt ctcacttaag cgtctgcgtt ttacttttgt 3060

attgggtttg gcgtttagta gtttgcggta gcgttcttgt tatgtgtaat tacgcttttt 3120

cttcttgctt cagcagtttc ggttgaaata taaatcgaat caagtttcac tttatcagcg 3180

ttgttttaaa ttttggcatt aaattggtga aaattgcttc aattttgtat ctaaatagaa 3240

gagacaacat gaaattcgac ttttgacctc aaatcttcga acatttattt cctgatttca 3300

cgatggatga ggataacgaa agggcggttc ctatgtccgg gaaagttccc gtagaagaca 3360

atgagcaaag ctactgaaac gcggacacga cgtcgcattg gtacggatat gagttaaacc 3420

gactcaattc ctttattaag acataaaccg attttggtta aagtgtaaca gtgagctgat 3480

ataaaaccga aacaaaccgg tacaagtttg attgagcaac ttgatgacaa acttcagaat 3540

tttggttatt gaatgaaaat catagtctaa tcgtaaaaaa tgtacagaag aaaagctaga 3600

gcagaacaaa gattctatat tctggttcca atttatcatc gctttaacgt ccctcagatt 3660

tgatcagctg cgagaaaagg atccccgggt acc 3693

<210> 19

<211> 515

<212> PRT

<213> Unknown (Unknown)

<400> 19

Met Asp Lys Ala Tyr Ile Ala Val Leu Ser Gly Ala Phe Leu Phe Leu

1 5 10 15

Leu His Tyr Leu Val Gly Arg Ala Ser Gly Gly Gly Lys Gly Lys Gly

20 25 30

Gln Gln Leu Pro Pro Ser Pro Pro Ala Ile Pro Phe Leu Gly His Leu

35 40 45

His Leu Val Lys Thr Pro Phe His Ala Ala Leu Thr Arg Leu Ala Ala

50 55 60

Arg His Gly Pro Val Phe Ser Met Arg Met Gly Ser Arg Arg Ala Val

65 70 75 80

Val Val Ser Ser Pro Glu Cys Ala Lys Glu Cys Phe Thr Glu His Asp

85 90 95

Val Asn Phe Ala Asn Arg Pro Met Phe Pro Ser Met Arg Leu Val Ser

100 105 110

Phe Asp Gly Ala Leu Leu Ser Met Ser Ser Tyr Gly Pro Tyr Trp Arg

115 120 125

Asn Leu Arg Arg Val Ala Thr Val Gln Leu Leu Ser Ala His Arg Val

130 135 140

Ala Cys Met Thr Pro Val Ile Ala Ala Glu Val Arg Ala Met Val Arg

145 150 155 160

Arg Met Asp His Ala Ala Ala Ala Ala Pro Gly Gly Ala Ala Arg Ile

165 170 175

Gln Met Lys Arg Arg Leu Phe Glu Leu Ser Leu Ser Val Leu Met Glu

180 185 190

Thr Ile Ala Gln Thr Lys Thr Ser Arg Thr Glu Ala Asn Ala Asp Thr

195 200 205

Asp Met Ser Pro Glu Ala His Glu Phe Lys Gln Ile Ile Asp Glu Leu

210 215 220

Val Pro Tyr Leu Gly Thr Ala Asn Arg Trp Asp Tyr Leu Pro Val Leu

225 230 235 240

Arg Trp Phe Asp Val Tyr Gly Val Arg Asn Arg Ile Leu Asp Ala Val

245 250 255

Ser Arg Arg Asp Ala Phe Leu Lys Arg Leu Ile Asp Gly Glu Arg Arg

260 265 270

Arg Leu His Asp Gly Lys Glu Ser Glu Asn Lys Ser Met Ile Ala Val

275 280 285

Leu Leu Thr Leu Gln Lys Ser Glu Pro Glu Val Tyr Thr Asp Thr Met

290 295 300

Ile Ile Ala Leu Cys Ala Asn Leu Phe Gly Ala Gly Thr Glu Thr Thr

305 310 315 320

Ser Thr Thr Thr Glu Trp Ala Met Ser Leu Leu Leu Asn His Pro Glu

325 330 335

Ala Leu Lys Lys Ala Gln Ala Glu Ile Asp Ala Ala Val Gly Thr Ser

340 345 350

Arg Leu Val Thr Ala Asp Asp Val Ser His Leu Ala Tyr Leu Gln Cys

355 360 365

Ile Met Asn Glu Thr Leu Arg Leu Tyr Pro Ala Ala Pro Leu Leu Leu

370 375 380

Pro His Glu Ser Ser Ala Asp Cys Lys Val Gly Gly Tyr Asp Val Pro

385 390 395 400

Arg Gly Thr Met Leu Leu Val Asn Ala Tyr Ala Ile His Arg Asp Pro

405 410 415

Ala Val Trp Glu Asp Pro Ala Glu Phe Arg Pro Glu Arg Phe Glu Asp

420 425 430

Asp Gly Lys Ala Glu Gly Arg Leu Leu Met Pro Phe Gly Met Gly Arg

435 440 445

Arg Lys Cys Pro Gly Glu Ala Leu Ala Leu Arg Thr Ile Gly Met Val

450 455 460

Leu Gly Thr Leu Ile Gln Cys Phe Asp Trp Asp Arg Val Asp Gly Val

465 470 475 480

Glu Val Asp Met Ala Glu Ser Gly Gly Leu Thr Ile Ser Arg Ala Val

485 490 495

Pro Leu Glu Ala Met Cys Lys Pro Arg Ala Ala Met Arg Asp Val Leu

500 505 510

Gln Glu Leu

515

<210> 20

<211> 67

<212> PRT

<213> Unknown (Unknown)

<400> 20

Met Phe Pro Ser Met Arg Leu Val Ser Phe Asp Gly Ala Leu Leu Ser

1 5 10 15

Met Ser Ser Tyr Gly Pro Tyr Trp Arg Asn Leu Arg Arg Val Ala Thr

20 25 30

Val Gln Leu Leu Ser Ala His Arg Val Ala Cys Met Thr Pro Val Ile

35 40 45

Ala Ala Glu Val Arg Ala Met Val Arg Arg Met Asp His Ala Ala Ala

50 55 60

Ala Ala Pro

65

<210> 21

<211> 1563

<212> DNA

<213> Unknown (Unknown)

<400> 21

atggataagg cctacgtggc cgtgctctcc ttcgccttcc tcttcgtgat ccactacctc 60

gtgggacgtg ctggccgcaa gggcaatggc aagggcaagg gaacgcagcg gttgcctccc 120

agccctccgg ccgtcccgtt cctcggccac ctccacctcg tcaagacgcc gttccacgag 180

gcgctggccg gcctcgccgc gcgccacggg ccggtgttct ccatgcgcat ggggtcccgc 240

cgcgcgctgg tcgtgtcctc gcccgagtgc gccaaggagt gcttcacgga gcacgacgtg 300

gtgttcgcca accggccgag gttcgccacg caggacctcg tgtccttcgg gggcgccgcg 360

ctcgccgcgg ccagctacgg gccctactgg cgcaacctcc ggcgcgtggc caccgtgcag 420

ctcctctccg cgcaccgcgt cgcctgcatg tccgccgtcg tcgccgccga ggtgcgcgcc 480

atggcgcgcc gcatgggccg cgcggccgcg gcggcgcccg gcggcgccgc gcgcgtccag 540

ctcaagcgga ggctgttcga ggtctccctc agcgtgctca tggagaccat cgcgcgcacc 600

aagacgtccc gcgccgaggc ggacgccgac tcggacatgt cgcccgaggc gcacgaattc 660

aagcagatcg tcgacgagat cgtgccgcac ctcggcacgg ccaacctgtg ggactacctg 720

ccggtgctgc ggtggctcga cgtgttcggc gtgaggaaca agatcacggc cgctgtgggc 780

aggagggacg cgttcctgcg gcggctcatc gacgcggagc ggcggaggct ggacgacggc 840

ggcggcgaca gcgacagcga caagaagagc atgatagccg tgctgctctc gttgcagaag 900

tcagagccgg aggtgtacac ggataccatg atcatggcac tttgcgggaa cttatttggc 960

gccggaacgg agaccacgtc gaccacgaca gaatgggcca tgtcgctcct cctgaaccac 1020

ccggaggcgc tgaagaaggc acaggcagag atcgacgcag tcgtgggcac ctcccgccta 1080

ctcgccgcag aggacgtgcc ccgactcggc tacctgcacc gcgtcatcag cgagaccctg 1140

cgcatgtacc cggccgcccc gctgctcctg ccgcacgagt cgtcggcgga ctgcaaggtc 1200

ggcggctacg acgtggcccg cggcacgctg ctcatcgtga acgcgtacgc catccacagg 1260

gacccgctgg tgtgggagga cccggacgag ttcaggccgg agcggttcga ggacggcaag 1320

gccgaggggc ggctcctgat gccgttcggg atggggcggc gcaagtgccc tggggagacc 1380

ctcgcgctgc ggaccatcag cctggtgctc ggcacgctga tccagtgctt cgactgggac 1440

cgagtcgacg gcctcgagat cgacatggcc gcgggcggcg ggctcactct gcccagggcc 1500

gtcccgttgg aggccacgtg caagcctcgt gcagctgtgc gccatcttct tctggagctt 1560

tga 1563

<210> 22

<211> 520

<212> PRT

<213> Unknown (Unknown)

<400> 22

Met Asp Lys Ala Tyr Val Ala Val Leu Ser Phe Ala Phe Leu Phe Val

1 5 10 15

Ile His Tyr Leu Val Gly Arg Ala Gly Arg Lys Gly Asn Gly Lys Gly

20 25 30

Lys Gly Thr Gln Arg Leu Pro Pro Ser Pro Pro Ala Val Pro Phe Leu

35 40 45

Gly His Leu His Leu Val Lys Thr Pro Phe His Glu Ala Leu Ala Gly

50 55 60

Leu Ala Ala Arg His Gly Pro Val Phe Ser Met Arg Met Gly Ser Arg

65 70 75 80

Arg Ala Leu Val Val Ser Ser Pro Glu Cys Ala Lys Glu Cys Phe Thr

85 90 95

Glu His Asp Val Val Phe Ala Asn Arg Pro Arg Phe Ala Thr Gln Asp

100 105 110

Leu Val Ser Phe Gly Gly Ala Ala Leu Ala Ala Ala Ser Tyr Gly Pro

115 120 125

Tyr Trp Arg Asn Leu Arg Arg Val Ala Thr Val Gln Leu Leu Ser Ala

130 135 140

His Arg Val Ala Cys Met Ser Ala Val Val Ala Ala Glu Val Arg Ala

145 150 155 160

Met Ala Arg Arg Met Gly Arg Ala Ala Ala Ala Ala Pro Gly Gly Ala

165 170 175

Ala Arg Val Gln Leu Lys Arg Arg Leu Phe Glu Val Ser Leu Ser Val

180 185 190

Leu Met Glu Thr Ile Ala Arg Thr Lys Thr Ser Arg Ala Glu Ala Asp

195 200 205

Ala Asp Ser Asp Met Ser Pro Glu Ala His Glu Phe Lys Gln Ile Val

210 215 220

Asp Glu Ile Val Pro His Leu Gly Thr Ala Asn Leu Trp Asp Tyr Leu

225 230 235 240

Pro Val Leu Arg Trp Leu Asp Val Phe Gly Val Arg Asn Lys Ile Thr

245 250 255

Ala Ala Val Gly Arg Arg Asp Ala Phe Leu Arg Arg Leu Ile Asp Ala

260 265 270

Glu Arg Arg Arg Leu Asp Asp Gly Gly Gly Asp Ser Asp Ser Asp Lys

275 280 285

Lys Ser Met Ile Ala Val Leu Leu Ser Leu Gln Lys Ser Glu Pro Glu

290 295 300

Val Tyr Thr Asp Thr Met Ile Met Ala Leu Cys Gly Asn Leu Phe Gly

305 310 315 320

Ala Gly Thr Glu Thr Thr Ser Thr Thr Thr Glu Trp Ala Met Ser Leu

325 330 335

Leu Leu Asn His Pro Glu Ala Leu Lys Lys Ala Gln Ala Glu Ile Asp

340 345 350

Ala Val Val Gly Thr Ser Arg Leu Leu Ala Ala Glu Asp Val Pro Arg

355 360 365

Leu Gly Tyr Leu His Arg Val Ile Ser Glu Thr Leu Arg Met Tyr Pro

370 375 380

Ala Ala Pro Leu Leu Leu Pro His Glu Ser Ser Ala Asp Cys Lys Val

385 390 395 400

Gly Gly Tyr Asp Val Ala Arg Gly Thr Leu Leu Ile Val Asn Ala Tyr

405 410 415

Ala Ile His Arg Asp Pro Leu Val Trp Glu Asp Pro Asp Glu Phe Arg

420 425 430

Pro Glu Arg Phe Glu Asp Gly Lys Ala Glu Gly Arg Leu Leu Met Pro

435 440 445

Phe Gly Met Gly Arg Arg Lys Cys Pro Gly Glu Thr Leu Ala Leu Arg

450 455 460

Thr Ile Ser Leu Val Leu Gly Thr Leu Ile Gln Cys Phe Asp Trp Asp

465 470 475 480

Arg Val Asp Gly Leu Glu Ile Asp Met Ala Ala Gly Gly Gly Leu Thr

485 490 495

Leu Pro Arg Ala Val Pro Leu Glu Ala Thr Cys Lys Pro Arg Ala Ala

500 505 510

Val Arg His Leu Leu Leu Glu Leu

515 520

<210> 23

<211> 520

<212> PRT

<213> Unknown (Unknown)

<400> 23

Met Asp Lys Ala Tyr Val Ala Val Leu Ser Phe Ala Phe Leu Phe Val

1 5 10 15

Ile His Tyr Leu Val Gly Arg Ala Gly Arg Lys Gly Asn Gly Lys Gly

20 25 30

Lys Gly Thr Gln Arg Leu Pro Pro Ser Pro Pro Ala Val Pro Phe Leu

35 40 45

Gly His Leu His Leu Val Lys Thr Pro Phe His Glu Ala Leu Ala Gly

50 55 60

Leu Ala Ala Arg His Gly Pro Val Phe Ser Met Arg Met Gly Ser Arg

65 70 75 80

Arg Ala Leu Val Val Ser Ser Pro Glu Cys Ala Lys Glu Cys Phe Thr

85 90 95

Glu His Asp Val Val Phe Ala Asn Arg Pro Met Phe Pro Ser Met Arg

100 105 110

Leu Val Ser Phe Asp Gly Ala Leu Leu Ser Met Ser Ser Tyr Gly Pro

115 120 125

Tyr Trp Arg Asn Leu Arg Arg Val Ala Thr Val Gln Leu Leu Ser Ala

130 135 140

His Arg Val Ala Cys Met Thr Pro Val Ile Ala Ala Glu Val Arg Ala

145 150 155 160

Met Val Arg Arg Met Asp His Ala Ala Ala Ala Ala Pro Gly Gly Ala

165 170 175

Ala Arg Val Gln Leu Lys Arg Arg Leu Phe Glu Val Ser Leu Ser Val

180 185 190

Leu Met Glu Thr Ile Ala Arg Thr Lys Thr Ser Arg Ala Glu Ala Asp

195 200 205

Ala Asp Ser Asp Met Ser Pro Glu Ala His Glu Phe Lys Gln Ile Val

210 215 220

Asp Glu Ile Val Pro His Leu Gly Thr Ala Asn Leu Trp Asp Tyr Leu

225 230 235 240

Pro Val Leu Arg Trp Leu Asp Val Phe Gly Val Arg Asn Lys Ile Thr

245 250 255

Ala Ala Val Gly Arg Arg Asp Ala Phe Leu Arg Arg Leu Ile Asp Ala

260 265 270

Glu Arg Arg Arg Leu Asp Asp Gly Gly Gly Asp Ser Asp Ser Asp Lys

275 280 285

Lys Ser Met Ile Ala Val Leu Leu Ser Leu Gln Lys Ser Glu Pro Glu

290 295 300

Val Tyr Thr Asp Thr Met Ile Met Ala Leu Cys Gly Asn Leu Phe Gly

305 310 315 320

Ala Gly Thr Glu Thr Thr Ser Thr Thr Thr Glu Trp Ala Met Ser Leu

325 330 335

Leu Leu Asn His Pro Glu Ala Leu Lys Lys Ala Gln Ala Glu Ile Asp

340 345 350

Ala Val Val Gly Thr Ser Arg Leu Leu Ala Ala Glu Asp Val Pro Arg

355 360 365

Leu Gly Tyr Leu His Arg Val Ile Ser Glu Thr Leu Arg Met Tyr Pro

370 375 380

Ala Ala Pro Leu Leu Leu Pro His Glu Ser Ser Ala Asp Cys Lys Val

385 390 395 400

Gly Gly Tyr Asp Val Ala Arg Gly Thr Leu Leu Ile Val Asn Ala Tyr

405 410 415

Ala Ile His Arg Asp Pro Leu Val Trp Glu Asp Pro Asp Glu Phe Arg

420 425 430

Pro Glu Arg Phe Glu Asp Gly Lys Ala Glu Gly Arg Leu Leu Met Pro

435 440 445

Phe Gly Met Gly Arg Arg Lys Cys Pro Gly Glu Thr Leu Ala Leu Arg

450 455 460

Thr Ile Ser Leu Val Leu Gly Thr Leu Ile Gln Cys Phe Asp Trp Asp

465 470 475 480

Arg Val Asp Gly Leu Glu Ile Asp Met Ala Ala Gly Gly Gly Leu Thr

485 490 495

Leu Pro Arg Ala Val Pro Leu Glu Ala Thr Cys Lys Pro Arg Ala Ala

500 505 510

Val Arg His Leu Leu Leu Glu Leu

515 520

<210> 24

<211> 1563

<212> DNA

<213> Unknown (Unknown)

<400> 24

atggacaagg cctacgtggc cgtgctcctg ttcgccttcc tcttcgtgat ccactacctc 60

gtgggccgcg ccggccgcaa gggcaacggc aagggcaagg gcacccagcg cctcccgccg 120

ctgccgccgg ccgtgccgtt cctcggccac ctccacctcg tgaagacccc gttccacgag 180

gccctcgccg gcctcgccgc ccgccacggc ccggtgttcc tgatgcgcat gggcctgcgc 240

cgcgccctcg tggtgctgct gccggagtgc gccaaggagt gcttcaccga gcacgacgtg 300

gtgttcgcca accgcccgat gttcccgctg atgcgcctcg tgctgttcga cggcgccctc 360

ctcctgatgc tgctgtacgg cccgtactgg cgcaacctcc gccgcgtggc caccgtgcag 420

ctcctcctgg cccaccgcgt ggcctgcatg accccggtga tcgccgccga ggtgcgcgcc 480

atggtgcgcc gcatggacca cgccgccgcc gccgccccgg gcggcgccgc ccgcgtgcag 540

ctcaagcgcc gcctcttcga ggtgctgctc ctggtgctca tggagaccat cgcccgcacc 600

aagaccctgc gcgccgaggc cgacgccgac ctggacatgc tgccggaggc ccacgagttc 660

aagcagatcg tggacgagat cgtgccgcac ctcggcaccg ccaacctctg ggactacctc 720

ccggtgctcc gctggctcga cgtgttcggc gtgcgcaaca agatcaccgc cgccgtgggc 780

cgccgcgacg ccttcctccg ccgcctcatc gacgccgagc gccgccgcct cgacgacggc 840

ggcggcgacc tggacctgga caagaagctg atgatcgccg tgctcctcct gctccagaag 900

ctggagccgg aggtgtacac cgacaccatg atcatggccc tctgcggcaa cctcttcggc 960

gccggcaccg agaccaccct gaccaccacc gagtgggcca tgctgctcct cctcaaccac 1020

ccggaggccc tcaagaaggc ccaggccgag atcgacgccg tggtgggcac cctgcgcctc 1080

ctcgccgccg aggacgtgcc gcgcctcggc tacctccacc gcgtgatcct ggagaccctc 1140

cgcatgtacc cggccgcccc gctcctcctc ccgcacgagc tgctggccga ctgcaaggtg 1200

ggcggctacg acgtggcccg cggcaccctc ctcatcgtga acgcctacgc catccaccgc 1260

gacccgctcg tgtgggagga cccggacgag ttccgcccgg agcgcttcga ggacggcaag 1320

gccgagggcc gcctcctcat gccgttcggc atgggccgcc gcaagtgccc gggcgagacc 1380

ctcgccctcc gcaccatcct gctcgtgctc ggcaccctca tccagtgctt cgactgggac 1440

cgcgtggacg gcctcgagat cgacatggcc gccggcggcg gcctcaccct cccgcgcgcc 1500

gtgccgctcg aggccacctg caagccgcgc gccgccgtgc gccacctcct cctcgagctc 1560

tga 1563

Claims (5)

1. A herbicide-resistant gene is characterized in that the nucleotide sequence of the herbicide-resistant gene is shown in SEQ ID No. 15.

2. The herbicide-resistant gene of claim 1, wherein the amino acid sequence of the protein encoded by the herbicide-resistant gene is represented by SEQ ID No. 19.

3. Use of the herbicide-resistant gene of claim 1 for the preparation of herbicide-resistant plant cells, wherein said plant is rice.

4. The use according to claim 3, wherein said use is obtained by constructing a T-DNA expression cassette comprising a herbicide-resistant gene and then transforming a plant gene with said T-DNA expression cassette by: the promoter, the herbicide resistant gene shown in SEQ ID NO.15 and the terminator are functionally connected.

5. The use according to claim 4, wherein the promoter is the CaMV35S promoter and the terminator is the CaMV35S terminator.

Images