CN110106177B - dsRNA of locusta migratoria fatty acid elongase gene LmElo as well as preparation method and application thereof - Google Patents

dsRNA of locusta migratoria fatty acid elongase gene LmElo as well as preparation method and application thereof Download PDF

Info

Publication number
CN110106177B
CN110106177B CN201910411773.1A CN201910411773A CN110106177B CN 110106177 B CN110106177 B CN 110106177B CN 201910411773 A CN201910411773 A CN 201910411773A CN 110106177 B CN110106177 B CN 110106177B
Authority
CN
China
Prior art keywords
fatty acid
dsrna
acid elongase
seq
lmelo
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910411773.1A
Other languages
Chinese (zh)
Other versions
CN110106177A (en
Inventor
张建珍
杨洋
赵小明
刘卫敏
马恩波
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanxi University
Original Assignee
Shanxi University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanxi University filed Critical Shanxi University
Priority to CN201910411773.1A priority Critical patent/CN110106177B/en
Publication of CN110106177A publication Critical patent/CN110106177A/en
Application granted granted Critical
Publication of CN110106177B publication Critical patent/CN110106177B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
    • A01N57/10—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds
    • A01N57/16—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds containing heterocyclic radicals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00—Production
    • C12N2330/50—Biochemical production, i.e. in a transformed host cell

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Pest Control & Pesticides (AREA)
  • Agronomy & Crop Science (AREA)
  • Microbiology (AREA)
  • Environmental Sciences (AREA)
  • Biochemistry (AREA)
  • Dentistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to dsRNA of a migratory locust fatty acid elongase gene LmElo, and a preparation method and application thereof. The preparation method of dsRNA of the locusta migratoria fatty acid elongase gene LmElo comprises the following steps: a, designing and synthesizing an upstream primer sequence and a downstream primer sequence; b, combining the upstream and downstream primers of the locusta migratoria fatty acid elongase gene LmElo, obtaining a full-length fragment of the fatty acid elongase gene through PCR amplification, purifying the obtained product, cloning and transforming the product into escherichia coli, sequencing, verifying and obtaining the full-length nucleotide sequence of the gene, wherein the nucleotide sequence is SEQ ID NO: 1; c, based on the migratory locust fatty acid elongase gene sequence SEQ ID NO: 1, designing dsRNA upstream and downstream primers, wherein the sequences of the primers are respectively SEQ ID NO: 3 and SEQ ID NO: 4, the upstream primer and the downstream primer both carry T7 promoter sequences; d, synthesizing dsRNA through transcription.

Description

dsRNA of locusta migratoria fatty acid elongase gene LmElo as well as preparation method and application thereof
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to dsRNA of a migratory locust fatty acid elongase gene LmElo, and a preparation method and application thereof.
Background
Locusta migratoria is an agricultural pest with great harm, has extremely wide distribution range, strong migration capability and great destructive power, thereby causing serious harm to agriculture. The current methods commonly used for controlling locusts depend on chemical control, i.e. chemical pesticides. However, long-term use of chemical pesticides can not only cause drug resistance of pests to reduce control efficiency, but also destroy ecological environment and cause harm to other non-target organisms. Therefore, development of a novel pest control method is urgently required.
RNA interference (RNAi) technology awarded by Nobel in 2006 is a specific post-transcriptional gene silencing technology caused by double-stranded RNA molecules. The technology opens up a new way for the research of gene function, human disease treatment, crop pest control and the like. The pest control by RNA interference has the following characteristics: 1. The insecticidal has specificity and no killing effect on non-target organisms; 2. RNA is easy to degrade in nature and has no residue; 3. is nontoxic and harmless to the environment and is relatively safe. Research shows that the RNA interference technology can effectively control specific crop pests and has very important application prospect in the field of pest control. The key for realizing pest control based on the technology is to screen out specific dsRNA which can kill pests efficiently.
The main components of insect epidermis include chitin, protein and lipid, wherein the lipid substances have important functions of resisting dry environment and preventing invasion of exogenous pathogenic microorganisms. Fatty acid elongases are key enzymes in the lipid synthesis pathway of insect epidermis, and when the enzymes are deleted, long-chain fatty acid synthesis is hindered, and products generated after the action of the fatty acid elongases also usually function as pheromones, thereby influencing the developmental reproduction of insects. In fruit flies, partial research has shown that there is a fatty acid elongase gene EloF specifically expressed in female fruit flies, which participates in the synthesis of long-chain fatty acids and affects the mating of fruit flies, and is of great biological significance.
Disclosure of Invention
The invention provides dsRNA of a migratory locust fatty acid elongase gene LmElo, a preparation method and application thereof.
In order to achieve the purpose, the invention adopts the following technical scheme:
a dsRNA of locusta migratoria fatty acid elongase gene LmElo, the nucleotide sequence of the dsRNA is SEQ ID NO: 2.
a preparation method of dsRNA of a migratory locust fatty acid elongase gene LmElo comprises the following steps:
a, searching locusta migratoria fatty acid elongase genes by adopting a bioinformatics method based on a transcriptome database of locusta migratoria, obtaining a sequence of the locusta migratoria fatty acid elongase genes LmElo after sequence analysis, splicing and comparison, designing an upstream primer sequence and a downstream primer sequence, and synthesizing;
b, selecting five-year migratory locust nymphs which are healthy in growth and have the same size as each half of migratory locust, quickly dissecting the epidermis of the nymphs, extracting RNA, reversely transcribing the extracted RNA into first-strand cDNA which is used as a template, combining and designing an upstream primer and a downstream primer of a migratory locust fatty acid elongase gene LmElo, obtaining a full-length fragment of the fatty acid elongase gene through PCR amplification, purifying an obtained product, cloning and transforming the purified product into escherichia coli, sequencing, comparing a sequencing result with a transcriptome search result, verifying and obtaining the full length of a nucleotide sequence of the gene, wherein the nucleotide sequence is SEQ ID NO: 1;
c, based on the migratory locust fatty acid elongase gene sequence SEQ ID NO: 1, designing dsRNA upstream and downstream primers, wherein the sequences of the primers are respectively SEQ ID NO: 3 and SEQ ID NO: 4, the upstream primer and the downstream primer both carry T7 promoter sequences;
d, taking the fatty acid elongase gene cloning vector escherichia coli as a template, and carrying out the steps of SEQ ID NO: 3 and SEQ ID NO: 4, upstream and downstream primers, performing PCR amplification, purifying the amplified PCR product, and transcribing to synthesize dsRNA.
An application of dsRNA of locusta migratoria fatty acid elongase gene LmElo in preventing and controlling pests.
Compared with the prior art, the invention has the following advantages:
1. the dsRNA of the migratory locust fatty acid elongase gene LmElo can obviously inhibit the expression of the migratory locust fatty acid elongase gene LmElo, so that the migratory locust is difficult to molt and dies or is dehydrated and dies after molting;
2. the dsRNA of the locusta migratoria fatty acid elongase gene LmElo provided by the invention has specificity and high efficiency when being used for controlling locusta migratoria pests, does not have the condition that the control efficiency is reduced because the pests have drug resistance, does not damage the ecological environment, and does not cause harm to other non-target organisms.
Drawings
FIG. 1 shows that the nucleotide sequences of the four 1 st day migratory locust nymphs respectively injected by the test of the embodiment of the invention are SEQ ID NO: 2 dsLmElo and dsGFP, results of transcriptional impact on migratory locust fatty acid elongase gene after 24 h;
FIG. 2 shows that the nucleotide sequence of the locust plantlet injection in the experiment of the embodiment of the invention is SEQ ID NO: 2, the results of the post-dsRNA effect on migratory locust development are compared;
FIG. 3 shows that the nucleotide sequence of the locust plantlet injection in the experiment of the embodiment of the present invention is SEQ ID NO: 2 dsRNA versus migratory locust epidermal permeability results are plotted.
Detailed Description
In order to further explain the technical scheme of the invention, the invention is further explained by combining the drawings and the embodiment.
A dsRNA of locusta migratoria fatty acid elongase gene LmElo, the nucleotide sequence of the dsRNA is SEQ ID NO: 2.
a preparation method of dsRNA of a migratory locust fatty acid elongase gene LmElo comprises the following steps:
a, searching locusta migratoria fatty acid elongase genes by adopting a bioinformatics method based on a transcriptome database of locusta migratoria, obtaining an LmElo sequence of the locusta migratoria fatty acid elongase genes after sequence analysis, splicing and comparison, designing an upstream primer sequence and a downstream primer sequence by adopting primerpremier5.0 software, and sending the upstream primer sequence and the downstream primer sequence to a biological engineering (Shanghai) company Limited for synthesis;
b, selecting five-year migratory locust nymphs which are healthy in growth and have the same size as each half of the migratory locust, quickly dissecting the epidermis of the nymphs under a body microscope, freezing the nymphs in liquid nitrogen, carrying out 3-head biological repetition, setting four biological repetitions, extracting RNA according to a Trizol kit of TaKaRa company, carrying out reverse transcription on the extracted RNA into first-strand cDNA by adopting M-MLV reverse transcriptase, taking the first-strand cDNA as a template, combining with upstream and downstream primers of a migratory locust fatty acid elongase gene LmElo, obtaining a full-length fatty acid elongase gene fragment through PCR amplification, purifying an obtained product, cloning and transforming the full-length fatty acid elongase gene into escherichia coli, sending the escherichia coli to Huada biotechnology limited for sequencing, comparing a sequencing result with a transcription group search result, verifying and obtaining the full-length nucleotide sequence of the gene, wherein the nucleotide sequence of the migratory: 1;
c, based on the migratory locust fatty acid elongase gene sequence SEQ ID NO: 1, designing dsRNA upstream and downstream primers by using primer premier5.0 software, wherein the sequences are respectively SEQ ID NO: 3 and SEQ ID NO: 4, the upstream and downstream primers carry the T7 promoter sequence, and all primers are synthesized by Shanghai bioengineering, Inc.
d, taking the fatty acid elongase gene cloning vector escherichia coli as a template, and carrying out the steps of SEQ ID NO: 3 and SEQ ID NO: 4 as upstream and downstream primers, performing PCR amplification, purifying the amplified PCR product with Gel Extraction Kit (Sigma) Kit, and performing T7RiboMAXTMExpress RNAi System (Promega) kit indicates that dsRNA is synthesized by in vitro transcription, dsGFP is synthesized by taking green fluorescent protein gene GFP as a control, NaNoDrop 2000(Thermoscientific) is used for quantification, the final concentration of the dsGFP is up to 2.0 mu g/mu l, and the dsGFP is stored in a super low-temperature refrigerator at minus 80 ℃ for later use.
An application of dsRNA of locusta migratoria fatty acid elongase gene LmElo in preventing and controlling pests.
Migratory locust fatty acid elongase gene dsRNA lethal migratory locust test:
1. migratory locust fatty acid elongase gene dsRNA injection
Selecting the nymphs which are healthy in growth, consistent in size and half 40 in male and female, and are of four ages at day 1 for testing. The synthesized dsLMLELO was gently injected 5. mu.l into the 2-3 abdominal section of the nymph flank using a 25. mu.l format microsyringe by the blood flow method. Meanwhile, 40 nymphs are selected as a control group. The same volume and concentration of dsGFP was injected into the control group. Feeding locusta migratoria after injection in a constant temperature biochemical incubator at 30 deg.C (light: dark time is 14h:10h, temperature is 30 + -2 deg.C, humidity is 60%), and feeding fresh wheat seedling and wheat bran every day.
2. Migratory locust fatty acid elongase gene silencing detection
Each collection of 9 injected dsGFP and dsLmELO, 24h after nymph body total RNA extraction, and reverse transcription into first strand cDNA, each set of 3 biological repeats, each biological repeat 3 nymphs. And respectively detecting the relative expression quantity of the target gene LmELO and the housekeeping gene Rpl-32 by adopting a Real-time PCR method, and calculating the silencing efficiency, wherein the Rpl-32 is an internal reference gene, and the value of P is less than 0.001. As shown in fig. 1, the results showed that the treatment group had a significantly reduced expression of the fatty acid elongase gene with a silencing efficiency of 92% after injection of dsLmELO, compared to the control group.
3. Phenotypic observation of five-instar nymphs after dsRNA injection
As shown in fig. 2, after four-year nymphs injected with dsRNA, all of the control groups successfully molted to five-year nymphs after six days, and the growth and development conditions after molting were good. After the experimental group is injected with dsLMLELO, 24 nymphs cannot successfully molt until death, and 7 nymphs can successfully molt until the next age, but death occurs due to dehydration on day 1 of five ages, and the death rate of the two phenotypes reaches 77.5%.
4. Eosin staining assay for nymphs after dsRNA injection
After four-year-old nymphs inject dsRNA, selecting an experimental group with difficult molting and a control group nymphs which are molting in the same quantity, putting the experimental group and the control group nymphs into 0.5% eosin solution, heating the solution in a water bath kettle at 45 ℃ for 30min, and then washing the solution for multiple times, wherein the result is shown in figure 3.
While there have been shown and described what are at present considered to be the essential features and advantages of the invention, it will be apparent to those skilled in the art that the invention is not limited to the details of the foregoing exemplary embodiments, but is capable of other specific forms without departing from the spirit or essential characteristics thereof. The present embodiments are therefore to be considered in all respects as illustrative and not restrictive, the scope of the invention being indicated by the appended claims rather than by the foregoing description, and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein. Any reference sign in a claim should not be construed as limiting the claim concerned.
Furthermore, it should be understood that although the present description refers to embodiments, not every embodiment may contain only a single embodiment, and such description is for clarity only, and those skilled in the art should integrate the description, and the embodiments may be combined as appropriate to form other embodiments understood by those skilled in the art.
Sequence listing
<110> university of Shanxi
<120> dsRNA of locusta migratoria fatty acid elongase gene LmElo, and preparation method and application thereof
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>2076
<212>DNA
<213> migratory locust (Locusa migratoria)
<400>1
agaaatttca gcttgtgtgt ttcggatgtc tcaattgtaa tattcgacag ttgttttcaa 60
cagtgagtaa gaggtttcag cgcgtgtttc gagcttggaa cgctacctcc gtgcatcaga 120
agttttatgg tggactcgga ctctcgtaaa aggagataga gcgttcagct ctacggttgg 180
actgaagtgc cttctacttt cacttccgtt tcaaaagcgt caccgatcga cttcgagaca 240
gtacttctat tggagccaaa acatcacatt tcaccatgga gacaccgatg gagaggatct 300
acaatctata caactacatt atctgtgaca tggctgaccc tcggacgatg gagtggcctc 360
tggtgggcag tccgtggccg gtgatgtcga tcgtgttcct ctatctctac ttcgtcaaca 420
gtctgggtcc acgcctgatg cgggatgtcc agcccttccg catcgagcga atcatgatag 480
cgtacaatgc tttccagata gctgtaaacc tgtacatatt ttacaagtgc acgcagctcg 540
gatgggtcga taagtacagt tggctgtgcg aaccagtgga tttttcggat gctcctgatg 600
cactcgaggt ggcgagtata tgctggttgt acttcatcgt caaggtgacc gatcttcttg 660
acacagtttt cttcgtcctt cgaaagaagt acaaccagat aacatttctc catgtatatc 720
atcacgctgc catggtcttt gggacgtgga tagcttccaa atatttacca ggaggccatg 780
gcaccttcgt ggggttcctg aacacgtttg tacatgtcat aatgtacagt tattacctga 840
tgactattat caaccctgaa tacaagaagt ctatttggtg gaagaagcat atcactcagc 900
tacaaatgac gcagttcctg atgatcacgg tgcacgccgc gcagctgctg ttccgggact 960
gcggctaccc gcagtgggtc ggctacgtcg tggtgccgca gaacgccttc atgttcgtcc 1020
tcttctacga cttctaccgg aaagcctacg gcggcgataa gaagaacgtc tgacgatgtg 1080
ggggctgcgt gaaattgttg tggactttgt gcgacgtaag acttccgata aactgttgca 1140
aatggcagtt catttcgctt ccggtacgat gactgggagc atttcaaaga atcatttccc 1200
agcgtatcga gattttttat ttactgcgat tcttgtccct ttttttgtta tgatgttgag 1260
agttaattaa taacgtttta taataagtga taaggaccca ggagatgagg tagaggaaga 1320
aacttattct tcagtccact acgagccaag aaatgatcgg aaaagaacca ccgaaagaat 1380
cgaatgaaaa aaatgaaaag cagagaaatc ttcaaataca aggaaataca gtgagatttt 1440
catgtgtctg taaactactg cacagaagtg caagaatcaa aaaacaagaa aagtgtcgca 1500
aaaaaaactg aaaatgtgaa catttttgtt taggcctgca acgactgctt atttcggaga 1560
tactaataat atccagatcc agcaaaaact tcgaatgttg cttgtttctc ggttaaattt 1620
atgtcaaaat ctatggaata tttcaaatta catgatacaa tttccaaatc gtaatgtgaa 1680
tttgtacgaa acaggtaata actgcacata tttcggatat tcttaaaacg ccatgttatt 1740
ttagaaaaac gttaaaaatt cgctaacata tcgtcaaatg acatttttgc agtatttgat 1800
cttcattaca ttcagattca aaaagatatt tcagcaattt ctcgttaaat tatatgtaac 1860
agtattgttt tcgactcgat ctgaggtata tattctcagc atctagttta gcaccttttc 1920
cccattatgg atattgtttg tatctcgcat aactagagaa aatcttcttg tattacacaa 1980
gctatcttca gaggcttgtc tgtaacattt ttgctcacat atgtgtaact acattttgtt 2040
tcgaagatgt tgtaaatgtt cacattaaat gacaca 2076
<210>2
<211>433
<212>DNA
<213> migratory locust (Locusa migratoria)
<400>2
tggagccaaa acatcacatt tcaccatggagacaccgatg gagaggatct acaatctata 60
caactacatt atctgtgaca tggctgaccc tcggacgatg gagtggcctc tggtgggcag 120
tccgtggccg gtgatgtcga tcgtgttcct ctatctctac ttcgtcaaca gtctgggtcc 180
acgcctgatg cgggatgtcc agcccttccg catcgagcga atcatgatag cgtacaatgc 240
tttccagata gctgtaaacc tgtacatatt ttacaagtgc acgcagctcg gatgggtcga 300
taagtacagt tggctgtgcg aaccagtgga tttttcggat gctcctgatg cactcgaggt 360
ggcgagtata tgctggttgt acttcatcgt caaggtgacc gatcttcttg acacagtttt 420
cttcgtcctt cga 433
<210>4
<211>40
<212>DNA
<213> migratory locust (Locusa migratoria)
<400>4
ttaatacgac tcactatagg gtggagccaa aacatcacat 40
<210>4
<211>39
<212>DNA
<213> migratory locust (Locusa migratoria)
<400>4
taatacgact cactataggg tcgaaggacg aagaaaact 39

Claims (3)

1. The dsRNA of the migratory locust fatty acid elongase gene LmElo is characterized in that: the nucleotide sequence of the dsRNA is SEQ ID NO: 2.
2. a preparation method of dsRNA of a migratory locust fatty acid elongase gene LmElo is characterized by comprising the following steps: the method comprises the following steps:
a, searching locusta migratoria fatty acid elongase genes by adopting a bioinformatics method based on a transcriptome database of locusta migratoria, obtaining a sequence of the locusta migratoria fatty acid elongase genes LmElo after sequence analysis, splicing and comparison, designing an upstream primer sequence and a downstream primer sequence, and synthesizing;
b, selecting five-year migratory locust nymphs which are healthy in growth and have the same size as each half of migratory locust, quickly dissecting the epidermis of the nymphs, extracting RNA, reversely transcribing the extracted RNA into first-strand cDNA which is used as a template, combining and designing an upstream primer and a downstream primer of a migratory locust fatty acid elongase gene LmElo, obtaining a full-length fragment of the fatty acid elongase gene through PCR amplification, purifying an obtained product, cloning and transforming the purified product into escherichia coli, sequencing, comparing a sequencing result with a transcriptome search result, verifying and obtaining the full length of a nucleotide sequence of the gene, wherein the nucleotide sequence is SEQ ID NO: 1;
c, based on the migratory locust fatty acid elongase gene sequence SEQ ID NO: 1, designing dsRNA upstream and downstream primers, wherein the sequences of the primers are respectively SEQ ID NO: 3 and SEQ ID NO: 4, the upstream primer and the downstream primer both carry T7 promoter sequences;
d, taking the fatty acid elongase gene cloning vector escherichia coli as a template, and carrying out the steps of SEQ ID NO: 3 and SEQ ID NO: 4, upstream and downstream primers, performing PCR amplification, purifying the amplified PCR product, and transcribing to synthesize dsRNA.
3. The method for preparing dsRNA of a migratory locust fatty acid elongase gene LmElo as claimed in claim 2, wherein the dsRNA comprises the following steps: in said step dPurification and transcription synthesis of dsRNA specific operation is that after purification by Gel Extraction Kit (Sigma) Kit, according to T7RiboMAXTMThe Express RNAi System (Promega) kit indicates the synthesis of dsRNA by in vitro transcription.
CN201910411773.1A 2019-05-17 2019-05-17 dsRNA of locusta migratoria fatty acid elongase gene LmElo as well as preparation method and application thereof Active CN110106177B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910411773.1A CN110106177B (en) 2019-05-17 2019-05-17 dsRNA of locusta migratoria fatty acid elongase gene LmElo as well as preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910411773.1A CN110106177B (en) 2019-05-17 2019-05-17 dsRNA of locusta migratoria fatty acid elongase gene LmElo as well as preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN110106177A CN110106177A (en) 2019-08-09
CN110106177B true CN110106177B (en) 2020-09-29

Family

ID=67490651

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910411773.1A Active CN110106177B (en) 2019-05-17 2019-05-17 dsRNA of locusta migratoria fatty acid elongase gene LmElo as well as preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN110106177B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111454959B (en) * 2020-03-31 2021-09-28 山西大学 Migratory locust Spinless gene dsRNA and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2017077212A (en) * 2015-10-21 2017-04-27 国立大学法人徳島大学 Screening method for pest control component
CN109504685A (en) * 2018-12-20 2019-03-22 山西大学 The application of E93 gene and its dsRNA in control of insect
CN109628459A (en) * 2018-12-20 2019-04-16 山西大学 The application of HR4 gene and its dsRNA in control of insect

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2017077212A (en) * 2015-10-21 2017-04-27 国立大学法人徳島大学 Screening method for pest control component
CN109504685A (en) * 2018-12-20 2019-03-22 山西大学 The application of E93 gene and its dsRNA in control of insect
CN109628459A (en) * 2018-12-20 2019-04-16 山西大学 The application of HR4 gene and its dsRNA in control of insect

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Molecular mechanisms influencing efficiency of RNA interference in insects;Cooper等;《PEST MANAGEMENT SCIENCE》;20190130;第75卷(第1期);第18-28页 *
飞蝗几丁质酶家族基因功能及RNAi介导的害虫防治应用研究;李大琪;《中国博士学位论文全文数据库 农业科技辑》;20170531;D046-5 *

Also Published As

Publication number Publication date
CN110106177A (en) 2019-08-09

Similar Documents

Publication Publication Date Title
CN109504685B (en) E93 gene and application of dsRNA thereof in pest control
CN101805746B (en) Chitinase genes of insects and application of dsRNA thereof
CN103201385A (en) Down-regulating gene expression in insect pests
CN104774843B (en) Applications of the Knickkopf genes dsRNA in control of insect
CN107988231A (en) Migratory locusts coria epidermal protein gene 6 and its application in locust control
CN110106177B (en) dsRNA of locusta migratoria fatty acid elongase gene LmElo as well as preparation method and application thereof
CN110184274B (en) E75 gene and application of dsRNA thereof in pest control
CN109628459B (en) HR4 gene and application of dsRNA thereof in pest control
CN110172463B (en) Application of Knickkopf3-5&#39; gene dsRNA of migratory locust in pest control
CN110106179B (en) dsRNA of locusta migratoria fatty acid synthetase gene LmFAS3 as well as preparation method and application thereof
CN101818159B (en) Insect chitin synthetase 1 gene segment, dsRNA and application thereof
CN112662689B (en) Migratory locust Rab11A gene and application of dsRNA thereof in migratory locust control
CN110144351B (en) dsRNA of locusta migratoria fatty acid synthetase gene L mFAS2, and preparation method and application thereof
CN111394371B (en) Migratory locust V-ATPase-V1 structural domain gene and application of dsRNA thereof in pest control
CN111440810B (en) Migratory locust V-ATPase-V0 structural domain gene and application of dsRNA thereof in pest control
CN107699569A (en) Migratory locusts coria epidermal protein gene 1 and its application in locust control
CN111394354B (en) dsRNA of locusta migratoria fatty acid synthetase gene LmFAS, preparation method and application
CN110951730B (en) dsRNA of cryptopteris viridis V-ATPase-A gene, artificial feed and application thereof
CN110358777B (en) Migratory locust HMGR gene and application of dsRNA thereof in migratory locust control
CN102876691A (en) Beta-N-acetylglucosaminidase genes of insects and application thereof
CN109504684B (en) Application of Ran gene and dsRNA thereof in pest control
CN115011577B (en) Insect m 6 A-methylation transferase METTL3 gene fragment, dsRNA thereof and application thereof
CN115029357B (en) Insect m 6 dsRNA of A methylation reading protein elF3-S6 gene and application thereof
CN113481202B (en) Fall webworm Rop gene dsRNA, bacterial expression liquid and application thereof
CN112391390A (en) Migratory locust clathrin heavy chain gene and synthesis and application of targeting dsRNA thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant