CN110079625A - A kind of PCR primer, kit and method detecting balantidium Coli - Google Patents
A kind of PCR primer, kit and method detecting balantidium Coli Download PDFInfo
- Publication number
- CN110079625A CN110079625A CN201910285849.0A CN201910285849A CN110079625A CN 110079625 A CN110079625 A CN 110079625A CN 201910285849 A CN201910285849 A CN 201910285849A CN 110079625 A CN110079625 A CN 110079625A
- Authority
- CN
- China
- Prior art keywords
- pcr
- balantidium coli
- detection
- pcr primer
- xmc
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6893—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for protozoa
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of PCR primer, kit and methods for detecting balantidium Coli, belong to Biochemistry and Molecular Biology field.The PCR primer are as follows: xmc-F CAAGTTTCTGCCCTATCATGC, xmc-R TAAGTTTCAGTCTTGCGACCA.Detection kit includes PCR primer, and for quickly detecting balantidium Coli.Detection method includes: the DNA that (1) extracts measuring samples；(2) PCR reaction system is established；(3) PCR reaction detection is carried out to measuring samples；(4) electrophoresis and sequencing are carried out to pcr amplification product.Method of the invention can real-time monitoring reaction, quickly detect, have many advantages, such as high specificity, for simply and quickly detect balantidium Coli offer convenience.
Description
Technical field
The invention belongs to Biochemistry and Molecular Biology field, and in particular to a kind of detection balantidium Coli
PCR primer, kit and method.
Background technique
Balantidium Coli is the major reason for causing dysentery, especially in the crowd of compromised immune, colon
Pouch infusorian is likely to become a kind of important pathogen.Balantidium Coli (balantidium coli) parasitizes host
Colon, infection cause balantidium Coli sick, are in worldwide distribution, Major Epidemic is in subtropical and tropical zones.At present
Know that many animals including people such as pig, orangutan, monkey, rat, cavy, horse, ox, sheep, ostrich, hawk etc. can infect, infects
Range from asymptomatic, mild diarrhea to bloody stool and fulminant dysentery.
Since Malmsten in 1857 has found in the excrement of two dysentery patients for the first time, which has given humans and animals
Health brings serious influence, while also resulting in huge economic loss.For example the animals such as machin are fine by colon pouch
Caterpillar infection, not only brings economic loss to aquaculture, also seriously affects animal quality and animal tracking studies testing result
Accuracy, while animal feeding personnel, veterinarian and related intimate contact crowd's health are threatened, therefore quick and precisely
Ground detects balantidium Coli infection conditions, and cause of disease is removed in control in time, keeps the cleaning of animal, with important public
Hygienic meaning and research significance.
Detection currently used for experimental animal balantidium Coli still uses fecal smear or precipitating dye method etc. to pass
Unite detection means, although these methods require equipment and instrument not high, but since body volume is smaller, usually by impurity effect compared with
Greatly, recall rate is lower when microexamination；Decoration method needs reagent preparation type more, complex steps, it is desirable that microscope work person
Very familiar all kinds of protozoons and oocysts figure, have superpower resolving ability and preferable eyesight, be otherwise affected by human factors compared with
Greatly.For large batch of sample detection, need a large amount of manpower and material resources, especially microscope observer eyes easily tired, it is difficult
To be completed in a short time the work of a large amount of test samples.Especially balantidium Coli trophozoite is in vitro fecal specimens
It is easily dead under extraneous extreme environmental conditions or in dye liquor, deformation, even dissolve, seriously affect the accurate of testing result
Degree found a large amount of balantidium Coli trophozoites using excrement direct smear examination on the day of once occurring over-sampling in an experiment,
Second day repetition test sample but all the case where not finding for one.This fragility of balantidium Coli trophozoite, promotes sample
Product examine surveys worker and must take sample on the day of sampling and detect completion, and such as remote way sample presentation cannot in time or sample size is excessive
Delay to second day, is then difficult to ensure the accuracy of result, it is most likely that cause false negative, cause animals showing positive hidden in group
Property infect, lead to heavy losses, it is seen that in the traditional detections means such as smear or precipitating dye method very to sample storage condition
It is harsh.Therefore new quick detection balantidium Coli side is researched and developed using modern molecular biology knowledge and instrument and equipment
Method makes operating instruction or standard, very urgently.And PCR method has that sensitivity is high, specificity is good, the reaction time is short and
It the advantages such as is not influenced by Sample preservation condition, can control in disease's spread and play a significant role in early prevention.
Summary of the invention
The object of the present invention is to provide a kind of PCR primer, kit and methods for detecting balantidium Coli.The present invention
A kind of PCR primer is provided, and constructs kit, can quickly, real-time detection, provided for base more easy, fast and accurately
The method for detecting balantidium Coli.
The present invention is achieved through the following technical solutions:
A kind of PCR primer detecting balantidium Coli, including following PCR primer:
xmc-F CAAGTTTCTGCCCTATCATGC
xmc-R TAAGTTTCAGTCTTGCGACCA。
The PCR primer amplified fragment of detection balantidium Coli of the invention is 18S rRNA, and amplification length is
730bp。
The kit of detection balantidium Coli of the invention, including above-mentioned PCR primer.
A method of the non-disease diagnostic purpose of detection balantidium Coli detects knot using above-mentioned PCR primer
Intestines pouch infusorian.
The method of the non-disease diagnostic purpose of detection balantidium Coli of the invention, includes the following steps:
(1) DNA of measuring samples is extracted.
(2) PCR reaction system is established: by the PCR reaction system of every 25 μ l volume in terms of,
(3) PCR reaction detection is carried out to measuring samples.
(4) electrophoresis and sequencing are carried out to pcr amplification product.
The DNA of said extracted measuring samples is the DNA that measuring samples are extracted according to excrement genome DNA extracting reagent kit.
The concrete operation step of step (1) are as follows:
1. taking the in vitro fecal sample of 100-300mg, it is placed in centrifuge tube, 1mL Buffer SW, vortex oscillation 3- is added
5min is dispersed in sample in solution, then is centrifuged 1min with the revolving speed of 12000rpm, discards supernatant；
2. 1mL Buffer SL is added into centrifuge tube, vortex oscillation 3-5min is dispersed in sample in solution, sets
Then the 20min and every 5min vortex oscillation 15s in 65 DEG C of water-baths is centrifuged 5min with the revolving speed of 12000rpm, by supernatant
It moves in clean centrifuge tube；
3. isometric Buffer GL is added into 2. supernatant that step obtains, it is mixed by inversion 15-25 times, then sets
It is centrifuged 5min in placing 5min on ice, then with the revolving speed of 12000rpm, retains supernatant；
4. adsorption column is fitted into collecting pipe, the supernatant for then 3. obtaining step is added in adsorption column, with
The revolving speed of 12000rpm is centrifuged 1min, outwells the waste liquid in collecting pipe, then adsorption column is placed back in collecting pipe；
5. 500 μ L Buffer GW1 (whether preoperation inspection is added dehydrated alcohol) are added into adsorption column, with
The revolving speed of 12000rpm is centrifuged 1min, outwells the waste liquid in collecting pipe, then adsorption column is placed back in collecting pipe；
6. 500 μ L Buffer GW2 (whether preoperation inspection is added dehydrated alcohol) are added into adsorption column, with
The revolving speed of 12000rpm is centrifuged 1min, outwells the waste liquid in collecting pipe, then adsorption column is placed back in collecting pipe；
7. repeating step 6.；
8. being centrifuged 2min with the revolving speed of 12000rpm, the waste liquid in collecting pipe is outwelled, adsorption column is placed in and is dried at room temperature；
9. adsorption column is placed in a clean centrifuge tube, 50-100 μ L is vacantly added dropwise to the intermediate position of adsorption column
Buffer GE is placed at room temperature for 2-5min, then is centrifuged 1min with the revolving speed of 12000rpm to get DNA solution is arrived.
As a preferred option of the technical scheme, the PCR response procedures are as follows: 94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 45s, 59-68
DEG C annealing 1min, 72 DEG C of extension 1min；After so circulation 35 times, 72 DEG C re-extend 10min.
As the further preferred of technical solution, the optimum annealing temperature of the PCR reaction is 63-65 DEG C.
As a preferred option of the technical scheme, pcr amplification product is subjected on 1.5% Ago-Gel electrophoresis, then will
There is the pcr amplification product of purpose band to carry out glue recycling, clone and sequencing, extracts plasmid after accurate.
The utilization of PCR primer of the invention in the kit of preparation detection balantidium Coli.
The present invention selectes gene 18S therein according to the balantidium Coli sequence delivered in GeneBank
RRNA designs and synthesizes a pair of of specific primer (xmc-F, xmc-R), using the DNA of balantidium Coli as mould by screening
Plate carries out PCR amplification, obtains the specific band of 730bp being consistent with expected size, and amplified production carries out after gel recycles
Sequencing, sequencing results are compared with 18S rRNA segment has been delivered, and homology does not find variation phenomenon up to 100%.
Result judgement: PCR primer (xmc-F, xmc-R) of the invention has amplified production 730bp, nucleotides sequence such as sequence table
It is shown.
Beneficial effects of the present invention:
(1) primer of the invention is good for the specificity of balantidium Coli detection, not to the purity requirement of template
Height, DNA or RNA semifinished product can be used as template, only have infusorian to have band through PCR detection, other do not have band.
(2) primer of the invention for balantidium Coli detection sensibility it is preferable, excrement extract DNA content down to
4.205×10-5It still can be detected when ng/ μ L.
(3) primer of the invention is achievable for the general 2-3h of balantidium Coli detection, more compared to other primers
It is time saving.
(4) have experiments have shown that PCR amplification length is easier to operate between 500-1000bp, base mispairing rate compared with
Low, band is easy explanation, and lays the groundwork for subsequent LAMP detection method.Primer of the invention is examined for balantidium Coli
The pcr amplification product segment of survey is 730bp, and operability is good, and base mispairing rate is low, and band is easy explanation.
(5) primer of the invention is wider for the annealing temperature range of choice of the PCR amplification of balantidium Coli detection,
It may occur in which specific amplification band, especially the specific amplification item in the case where annealing temperature is 63-65 DEG C at 59-68 DEG C
Band is most bright, and wider annealing region makes it easy to practical application.
(6) primer of the invention is used to detect in the in vitro excrement clinical sample of 50 portions of machins to whether contain colon pouch
Infusorian, testing result are consistent with the degree of conformity of microscopy, it is seen that the accuracy of method detection balantidium Coli of the invention
It is good.
Detailed description of the invention
Fig. 1 is the specific detection result of PCR method of the present invention, wherein M:DL 2000DNA Marker, 1~5: pouch
Infusorian, amoeba, whipworm, trichina, Cryptosporidium, 6: negative control.
Fig. 2 is the sensitivity Detection result of PCR method of the present invention, wherein M:DL 2000DNA Marker, 1~8: concentration
10 times of gradient dilutions are respectively 100~10-7(original concentration is 42.051ng/ μ L), 9: negative control.
Fig. 3 is the annealing temperature optimum results of PCR method of the present invention, wherein M:DL 2000DNA Marker, 1~10:
Annealing temperature is respectively 59 DEG C, 60 DEG C, 61 DEG C, 62 DEG C, 63 DEG C, 64 DEG C, 65 DEG C, 66 DEG C, 67 DEG C, 68 DEG C, and 11: negative control.
Fig. 4 is the present invention for the in vitro excrement clinical sample testing result of machin, wherein M:DL 2000DNA
Marker, 1~22: clinical sample detection number.
Specific embodiment
The present invention is illustrated with the following example, but is not the limitation to use scope of the invention.
Embodiment
1, the preparation of material
(1) sample
The in vitro monkey excrement sample of Guangxi province machin feed lot.
Amoeba, whipworm, trichina and Cryptosporidium sample, are protected by Veterinary Institute of Guangxi Zhuang Autonomous Region laboratory
It deposits.
(2) main agents and instrument
| Title | Source |
| Excrement genome DNA extracting reagent kit | Beijing CoWin Bioscience Co., Ltd. |
| 2×ES Taq MasterMix | Beijing CoWin Bioscience Co., Ltd. |
| 2 × ES Taq MasterMix kit | Beijing CoWin Bioscience Co., Ltd. |
| DL 2000DNA Marker | Beijing CoWin Bioscience Co., Ltd. |
| Quick Ago-Gel DNA QIAquick Gel Extraction Kit | Beijing CoWin Bioscience Co., Ltd. |
| The small extraction reagent kit of rapid plasmid | Beijing CoWin Bioscience Co., Ltd. |
| PCR instrument | TIANGEN Biotech (Beijing) Co., Ltd. |
2, the design and synthesis of PCR primer
It is template according to the balantidium Coli sequence 18S rRNA delivered in GeneBank, it is soft using oligo7
Part designs and synthesizes PCR primer xmc-F, xmc-R, and theoretical amplification length is 730bp, and the sequence of primer is as follows:
xmc-F CAAGTTTCTGCCCTATCATGC
xmc-R TAAGTTTCAGTCTTGCGACCA。
Primer is synthesized by Guangzhou Hua Da Gene Tech. Company Limited.
3, the DNA extracting of measuring samples
DNA extracting is extracted according to excrement genome DNA extracting reagent kit, and specific steps operation is as follows:
1. taking the in vitro fecal sample of 100-300mg, it is placed in centrifuge tube, 1mL Buffer SW, vortex oscillation 3- is added
5min is dispersed in sample in solution, then is centrifuged 1min with the revolving speed of 12000rpm, discards supernatant；
2. 1mL Buffer SL is added into centrifuge tube, vortex oscillation 3-5min is dispersed in sample in solution, sets
Then the 20min and every 5min vortex oscillation 15s in 65 DEG C of water-baths is centrifuged 5min with the revolving speed of 12000rpm, by supernatant
It moves in clean centrifuge tube；
3. isometric Buffer GL is added into 2. supernatant that step obtains, it is mixed by inversion 15-25 times, then sets
It is centrifuged 5min in placing 5min on ice, then with the revolving speed of 12000rpm, retains supernatant；
4. adsorption column is fitted into collecting pipe, the supernatant for then 3. obtaining step is added in adsorption column, with
The revolving speed of 12000rpm is centrifuged 1min, outwells the waste liquid in collecting pipe, then adsorption column is placed back in collecting pipe；
5. 500 μ L Buffer GW1 (whether preoperation inspection is added dehydrated alcohol) are added into adsorption column, with
The revolving speed of 12000rpm is centrifuged 1min, outwells the waste liquid in collecting pipe, then adsorption column is placed back in collecting pipe；
6. 500 μ L Buffer GW2 (whether preoperation inspection is added dehydrated alcohol) are added into adsorption column, with
The revolving speed of 12000rpm is centrifuged 1min, outwells the waste liquid in collecting pipe, then adsorption column is placed back in collecting pipe；
7. repeating step 6.；
8. being centrifuged 2min with the revolving speed of 12000rpm, the waste liquid in collecting pipe is outwelled, adsorption column is placed in and is dried at room temperature；
9. adsorption column is placed in a clean centrifuge tube, 50-100 μ L is vacantly added dropwise to the intermediate position of adsorption column
Buffer GE is placed at room temperature for 2-5min, then is centrifuged 1min with the revolving speed of 12000rpm to get DNA solution is arrived.
4, PCR reaction system is established
According to 2 × ES Taq MasterMix kit specification, by the PCR reaction system of every 25 μ l volume in terms of,
5, PCR reaction detection
(1) specific detection
The DNA for extracting balantidium Coli, amoeba, whipworm, trichina and Cryptosporidium respectively is template, will be to be checked
DNA sample is placed in PCR pipe, and 2 × ES Taq MasterMix, RNase-Free water reaction solution and specificity is then added
Primer xmc-F, xmc-R mix centrifugation, then PCR reaction system are placed in PCR instrument.PCR response procedures are as follows: 94 DEG C of pre- changes
Property 5min, 94 DEG C of denaturation 45s, 59-68 DEG C of annealing 1min, 72 DEG C of extension 1min；After so circulation 35 times, 72 DEG C are re-extended
10min。
The specific detection result of PCR is as shown in Figure 1, it will be seen from figure 1 that balantidium Coli of the invention
Pcr amplification product is 730bp, and result sizes are consistent；And amoeba, whipworm, trichina and Cryptosporidium comparison liquid are not detected
Product.
(2) sensitivity Detection
Using balantidium Coli DNA as template, PCR amplification is carried out with PCR primer (xmc-F, xmc-R), then takes 7 μ L
Pcr amplification product carries out electrophoresis (DL2000DNA Marker) on 1.5% Ago-Gel, will there is the PCR of purpose band
Product carries out glue recycling, clone, sequencing with quick Ago-Gel DNA QIAquick Gel Extraction Kit, with rapid plasmid is small proposes examination after accurate
Agent box extracts plasmid and surveys concentration.After measured, Nucleic acid quality concentration is 42.051ng/ μ L, with balantidium Coli weight
Group plasmid 18S rRNA carries out 10 times of gradient dilutions, 8 dilutions, and each dilution respectively takes 7 μ L templates to carry out the examination of PCR sensibility
It tests, as a result as shown in Figure 2.Figure it is seen that the minimum DNA concentration detected level of result is 4.205 × 10-5Ng/ μ L, explanation
The PCR rapid detection method for the balantidium Coli that the present invention establishes has good sensibility.
(3) optimization of PCR annealing temperature
1. the DNA for extracting balantidium Coli is template, DNA sample to be checked is placed in PCR pipe, reaction is then added
Liquid and specific primer xmc-F, xmc-R mix centrifugation, then PCR reaction system are placed in PCR instrument.PCR response procedures
Are as follows: 94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 45s, 59 DEG C of annealing 1min, 72 DEG C of extension 1min；After so circulation 35 times, 72 DEG C again
Extend 10min.Then pcr amplification product is subjected to electrophoresis on 1.5% Ago-Gel.
2. the DNA for extracting balantidium Coli is template, DNA sample to be checked is placed in PCR pipe, reaction is then added
Liquid and specific primer xmc-F, xmc-R mix centrifugation, then PCR reaction system are placed in PCR instrument.PCR response procedures
Are as follows: 94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 45s, 60 DEG C of annealing 1min, 72 DEG C of extension 1min；After so circulation 35 times, 72 DEG C again
Extend 10min.Then pcr amplification product is subjected to electrophoresis on 1.5% Ago-Gel.
3. the DNA for extracting balantidium Coli is template, DNA sample to be checked is placed in PCR pipe, reaction is then added
Liquid and specific primer xmc-F, xmc-R mix centrifugation, then PCR reaction system are placed in PCR instrument.PCR response procedures
Are as follows: 94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 45s, 61 DEG C of annealing 1min, 72 DEG C of extension 1min；After so circulation 35 times, 72 DEG C again
Extend 10min.Then pcr amplification product is subjected to electrophoresis on 1.5% Ago-Gel.
4. the DNA for extracting balantidium Coli is template, DNA sample to be checked is placed in PCR pipe, reaction is then added
Liquid and specific primer xmc-F, xmc-R mix centrifugation, then PCR reaction system are placed in PCR instrument.PCR response procedures
Are as follows: 94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 45s, 62 DEG C of annealing 1min, 72 DEG C of extension 1min；After so circulation 35 times, 72 DEG C again
Extend 10min.Then pcr amplification product is subjected to electrophoresis on 1.5% Ago-Gel.
5. the DNA for extracting balantidium Coli is template, DNA sample to be checked is placed in PCR pipe, reaction is then added
Liquid and specific primer xmc-F, xmc-R mix centrifugation, then PCR reaction system are placed in PCR instrument.PCR response procedures
Are as follows: 94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 45s, 63 DEG C of annealing 1min, 72 DEG C of extension 1min；After so circulation 35 times, 72 DEG C again
Extend 10min.Then pcr amplification product is subjected to electrophoresis on 1.5% Ago-Gel.
6. the DNA for extracting balantidium Coli is template, DNA sample to be checked is placed in PCR pipe, reaction is then added
Liquid and specific primer xmc-F, xmc-R mix centrifugation, then PCR reaction system are placed in PCR instrument.PCR response procedures
Are as follows: 94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 45s, 64 DEG C of annealing 1min, 72 DEG C of extension 1min；After so circulation 35 times, 72 DEG C again
Extend 10min.Then pcr amplification product is subjected to electrophoresis on 1.5% Ago-Gel.
7. the DNA for extracting balantidium Coli is template, DNA sample to be checked is placed in PCR pipe, reaction is then added
Liquid and specific primer xmc-F, xmc-R mix centrifugation, then PCR reaction system are placed in PCR instrument.PCR response procedures
Are as follows: 94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 45s, 65 DEG C of annealing 1min, 72 DEG C of extension 1min；After so circulation 35 times, 72 DEG C again
Extend 10min.Then pcr amplification product is subjected to electrophoresis on 1.5% Ago-Gel.
8. the DNA for extracting balantidium Coli is template, DNA sample to be checked is placed in PCR pipe, reaction is then added
Liquid and specific primer xmc-F, xmc-R mix centrifugation, then PCR reaction system are placed in PCR instrument.PCR response procedures
Are as follows: 94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 45s, 66 DEG C of annealing 1min, 72 DEG C of extension 1min；After so circulation 35 times, 72 DEG C again
Extend 10min.Then pcr amplification product is subjected to electrophoresis on 1.5% Ago-Gel.
9. the DNA for extracting balantidium Coli is template, DNA sample to be checked is placed in PCR pipe, reaction is then added
Liquid and specific primer xmc-F, xmc-R mix centrifugation, then PCR reaction system are placed in PCR instrument.PCR response procedures
Are as follows: 94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 45s, 67 DEG C of annealing 1min, 72 DEG C of extension 1min；After so circulation 35 times, 72 DEG C again
Extend 10min.Then pcr amplification product is subjected to electrophoresis on 1.5% Ago-Gel.
10. the DNA for extracting balantidium Coli is template, DNA sample to be checked is placed in PCR pipe, reaction is then added
Liquid and specific primer xmc-F, xmc-R mix centrifugation, then PCR reaction system are placed in PCR instrument.PCR response procedures
Are as follows: 94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 45s, 68 DEG C of annealing 1min, 72 DEG C of extension 1min；After so circulation 35 times, 72 DEG C again
Extend 10min.Then pcr amplification product is subjected to electrophoresis on 1.5% Ago-Gel.
10. 1. electrophoresis result as shown in figure 3, from figure 3, it can be seen that primer of the invention be used for balantidium Coli
The annealing region of the PCR amplification of detection is wider, may occur in which specific amplification band at 59-68 DEG C, is especially annealing
Specific amplification band is most bright when temperature is 63 DEG C, 64 DEG C and 65 DEG C.
(4) clinical applications result
By primer (xmc-F, xmc-R) of the invention for detecting the in vitro excrement clinical sample of 50 portions of machins, DNA is extracted
For template, DNA sample to be checked is placed in PCR pipe, 2 × ES Taq MasterMix, RNase-Free water is then added
Reaction solution and specific primer xmc-F, xmc-R mix centrifugation, then PCR reaction system are placed in PCR instrument.PCR reaction interval
Sequence are as follows: 94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 45s, 64 DEG C of annealing 1min, 72 DEG C of extension 1min；After so circulation 35 times, 72 DEG C
Re-extend 10min.PCR testing result, which is shown in 50 parts of clinical samples, has 12 parts for the positive, wherein 22 parts of sample detection results are such as
Shown in Fig. 4.PCR testing result is consistent with the degree of conformity of microscopy, it is seen that the standard of method detection balantidium Coli of the invention
True property is good.
Sequence table
<110>Veterinary Institute of Guangxi Zhuang Autonomous Region
<120>a kind of PCR primer, kit and method for detecting balantidium Coli
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> PRT
<213>artificial sequence (Artificial Sequence)
<400> 1
Cys Ala Ala Gly Thr Thr Thr Cys Thr Gly Cys Cys Cys Thr Ala Thr
1 5 10 15
Cys Ala Thr Gly Cys
20
<210> 2
<211> 21
<212> PRT
<213>artificial sequence (Artificial Sequence)
<400> 2
Thr Ala Ala Gly Thr Thr Thr Cys Ala Gly Thr Cys Thr Thr Gly Cys
1 5 10 15
Gly Ala Cys Cys Ala
20
Claims (9)
1. a kind of PCR primer for detecting balantidium Coli, which is characterized in that including following PCR primer:
xmc-F CAAGTTTCTGCCCTATCATGC
xmc-R TAAGTTTCAGTCTTGCGACCA。
2. the PCR primer of detection balantidium Coli according to claim 1, which is characterized in that the PCR primer expands
Increasing segment is 18S rRNA, amplification length 730bp.
3. a kind of kit for detecting balantidium Coli, which is characterized in that the kit includes such as claims 1 or 2
The PCR primer.
4. a kind of method for the non-disease diagnostic purpose for detecting balantidium Coli, which is characterized in that the method is using such as
Any PCR primer of claim 1-3 detects balantidium Coli.
5. the method for the non-disease diagnostic purpose of detection balantidium Coli according to claim 4, which is characterized in that
Include the following steps:
(1) DNA of measuring samples is extracted；
(2) PCR reaction system is established: by the PCR reaction system of every 25 μ l volume in terms of,
(3) PCR reaction detection is carried out to measuring samples；
(4) electrophoresis and sequencing are carried out to pcr amplification product.
6. the method for the non-disease diagnostic purpose of detection balantidium Coli according to claim 5, which is characterized in that
The PCR response procedures are as follows: 94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 45s, 59-68 DEG C of annealing 1min, 72 DEG C of extension 1min；Such as
After this circulation 35 times, 72 DEG C re-extend 10min.
7. the method for the non-disease diagnostic purpose of detection balantidium Coli according to claim 6, which is characterized in that
The optimum annealing temperature of the PCR reaction is 63-65 DEG C.
8. the method for the non-disease diagnostic purpose of detection balantidium Coli according to claim 5, which is characterized in that
Pcr amplification product is subjected to electrophoresis on 1.5% Ago-Gel, then carries out the pcr amplification product for having purpose band
Glue recycling, clone and sequencing, extract plasmid after accurate.
9. a kind of PCR primer a method according to any one of claims 1-3 is in the kit of preparation detection balantidium Coli
With.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910285849.0A CN110079625A (en) | 2019-04-10 | 2019-04-10 | A kind of PCR primer, kit and method detecting balantidium Coli |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910285849.0A CN110079625A (en) | 2019-04-10 | 2019-04-10 | A kind of PCR primer, kit and method detecting balantidium Coli |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110079625A true CN110079625A (en) | 2019-08-02 |
Family
ID=67414685
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910285849.0A Pending CN110079625A (en) | 2019-04-10 | 2019-04-10 | A kind of PCR primer, kit and method detecting balantidium Coli |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110079625A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011109440A1 (en) * | 2010-03-01 | 2011-09-09 | Caris Life Sciences Luxembourg Holdings | Biomarkers for theranostics |
| CN102443652A (en) * | 2011-12-28 | 2012-05-09 | 宁波大学 | LAMP (Lysosomal Associated Membrane Protein) detection kit for cryptocaryon irritans of large yellow croaker and detection method of LAMP detection kit |
| CN103276088A (en) * | 2013-05-31 | 2013-09-04 | 深圳市疾病预防控制中心 | Kit for simultaneously detecting three diarrhea protozoa and detection method |
| CN104372069A (en) * | 2013-08-12 | 2015-02-25 | 中国科学院海洋研究所 | Specific probe capable of rapidly detecting pseudocohnilembus persalinus, detection method and applications thereof |
| CN106701927A (en) * | 2016-12-09 | 2017-05-24 | 国家开发投资公司 | Rapid detection of gold algae method and test kit based on cyclo-mediated isothermal expansion |
-
2019
- 2019-04-10 CN CN201910285849.0A patent/CN110079625A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011109440A1 (en) * | 2010-03-01 | 2011-09-09 | Caris Life Sciences Luxembourg Holdings | Biomarkers for theranostics |
| CN102443652A (en) * | 2011-12-28 | 2012-05-09 | 宁波大学 | LAMP (Lysosomal Associated Membrane Protein) detection kit for cryptocaryon irritans of large yellow croaker and detection method of LAMP detection kit |
| CN103276088A (en) * | 2013-05-31 | 2013-09-04 | 深圳市疾病预防控制中心 | Kit for simultaneously detecting three diarrhea protozoa and detection method |
| CN104372069A (en) * | 2013-08-12 | 2015-02-25 | 中国科学院海洋研究所 | Specific probe capable of rapidly detecting pseudocohnilembus persalinus, detection method and applications thereof |
| CN106701927A (en) * | 2016-12-09 | 2017-05-24 | 国家开发投资公司 | Rapid detection of gold algae method and test kit based on cyclo-mediated isothermal expansion |
Non-Patent Citations (1)
| Title |
|---|
| 石团员等: "浙江猪结肠小袋纤毛虫的分离，培养和分子鉴定", 《中国畜牧兽医学会家畜寄生虫学分会第六次代表大会暨第十一次学术研讨会》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104046700B (en) | The detection kit of a kind of Rapid identification donkey hide, horse skin and mule skin | |
| CN106520977B (en) | The primer and method of ring mediated isothermal amplification method detection causing root rot disease of Medicago sativa bacterium | |
| CN102286617B (en) | Real-time fluorescence quantitative polymerase chain reaction (PCR) kit for incorporeity and rickettsia | |
| Moskwa et al. | The first identification of a blood-sucking abomasal nematode Ashworthius sidemi in cattle (Bos taurus) using simple polymerase chain reaction (PCR) | |
| Ding et al. | Quantitative detection and proliferation dynamics of a novel Spiroplasma eriocheiris pathogen in the freshwater crayfish, Procambarus clarkii | |
| Huang et al. | Molecular detection of Bartonella spp. in China and St. Kitts | |
| Gadelhaq et al. | Molecular characterization of Eimeria species naturally infecting Egyptian Baldi Chickens | |
| CN101481742B (en) | Detection kit for Mycoplasma hyopneumoniae and use thereof | |
| CN101899501A (en) | Constant temperature amplification detection kit and method for detecting food allergen crustacean gene | |
| CN110358816A (en) | A kind of primer sets, kit and application for chicken derived cell PCR detection | |
| CN101381767A (en) | Universal real time fluorescent PCR detection method of trichinella | |
| CN101624634B (en) | Field fast high-sensitive detecting kit of monodon baculovirus and detecting method | |
| CN110079625A (en) | A kind of PCR primer, kit and method detecting balantidium Coli | |
| CN104164515B (en) | A kind of Honghu myxobolus specific PCR detection primer and detection method thereof | |
| CN1693479A (en) | Kit with fluorescent quantitative RT-PCR detection technique used for cell keratin 19(Ck19)mRNA | |
| Aydın et al. | Molecular survey of Anaplasma and Ehrlichia species in cattle from Karaman of Turkey, including a novel tandem report of Anaplasma marginale msp1a gene | |
| CN101643792B (en) | On-site rapid high-sensitivity detection kit and detection method of taura syndrome virus (TSV) | |
| Feng et al. | Development of a loop-mediated isothermal amplification method for detection of Perkinsus spp. in mollusks | |
| Zhan et al. | Detection of two pathogenic marine ciliates Ancistrum haliotis and A. crassum (Ciliophora: Scuticociliatia) by fluorescence in situ hybridization | |
| CN105821160A (en) | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) kit for porcine kobuvirus and application thereof | |
| CN108018367B (en) | PCR primer and method for detecting amoeba | |
| CN104178575B (en) | Method and the kit of a kind of quick discriminating campylobacter fetus and venereal disease subspecies | |
| Hsu et al. | Detection and species identification of Cryptosporidium from Taiwan feeding animals | |
| CN104450952B (en) | The quick detection primer of flavobacterium columnare and detection method | |
| CN116716413A (en) | Specific primer combination, kit thereof and application of specific primer combination in detection of ampullaria gigas |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |