CN110066774A

CN110066774A - Corn receptoroid kinase gene ZmRLK7 and its application

Info

Publication number: CN110066774A
Application number: CN201910363484.9A
Authority: CN
Inventors: 何春梅; 汪黎明; 王娟; 关海英; 刘铁山; 刘强; 刘春晓; 董瑞
Original assignee: Maize Research Institute of Shandong Academy of Agricultural Sciences
Current assignee: Maize Research Institute of Shandong Academy of Agricultural Sciences
Priority date: 2019-04-30
Filing date: 2019-04-30
Publication date: 2019-07-30
Anticipated expiration: 2039-04-30
Also published as: WO2020221029A1; CN110066774B

Abstract

The invention discloses corn receptoroid kinase gene ZmRLK7 and its applications, the invention provides the sequence of corn receptoroid kinase gene ZmRLK7 and its effects in adjusting plant height, Biomass and yield, the expression quantity of the gene is raised, plant will be made short and small, biomass and yield reduce；The gene expression amount is lowered, plant becomes larger, biomass and output increased, a kind of high-yield corn can be cultivated using the present invention, further to provide genetic resources to improve cereal crop yield.

Description

Corn receptoroid kinase gene ZmRLK7 and its application

Technical field

The present invention relates to corn receptoroid kinase gene ZmRLK7 and its applications, are related to genetic engineering field.

Background technique

Corn is not only important cereal crops, but also is important feed and the raw material of industry, cultivates superior corn kind, improves Corn per unit area yield occupies very important status in the development of national economy.Corn yield depends on single plant yield and plants close Degree, and single plant yield can subdivision be further grain number per spike and Single seed weight.Relative to other complicated economical characters, grain characters are lost Power transmission is high, is easy measurement, is both the mode character of genetic research and the important goal character of genetic improvement.Maize genetic money Source is abundant, however is present in the abundant natural variation in corn and does not excavate completely so far, controls the heredity of Main Agronomic Characters Basis do not obtain yet it is deep illustrate, the pass for influencing grain characters is excavated using linkage analysis and whole-genome association method Key gene, and its function and regulatory mechanism are parsed, constructing relevant regulated and control network and being applied to breeding research has important reality And theory significance.

In recent years, by the method for genome comparison analysis or association analysis, a batch participates in regulation grain shape and produces in rice The gene of amount character is cloned successively, and molecular mechanism is also resolved in succession, and the research of related gene is less in corn.Mesh Before, by way of homologous clone, some genes with rice yield DNA homolog have been cloned and have reported in corn, and table Reveal the function of guarding with gene in rice.Control homologous gene of the GS3 and GW2 gene in corn of rice grain shape by Clone, and two genes and corn kernel grain shape are developed and grain weight is significantly positively correlated.Corn Mn1 and ZmINCW1 are rice milking stage Two homologous genes of gene OsGIF1, the overexpression of Mn1 gene increase maize grain yield, and by corn ZmINCW1 base It, can the table that reduces of its complementary mass of 1000 kernel because of arabidopsis thaliana transformation AtcwINV2 (ZmINCW1 homologous gene in arabidopsis) mutant Type increases seed production.Gene is provided to the exploitation of gene relevant to these yield in corn for the culture of high-yield corn Resource.But above-mentioned related gene is mostly to have preferable influence to a certain corn character, and develop to a variety of correlation with yield Shape all has the gene well influenced, either to raising breeding efficiency, or all has high-quality meaning to increasing economic efficiency.

Summary of the invention

The present invention overcomes above-mentioned the deficiencies in the prior art, provide corn receptoroid kinase gene ZmRLK7 and its application, ZmRLK7 gene is based on expression quantitative trait locus (expression quantitative trait loci, eQTL) point What analysis method obtained, the expression quantity of the gene is raised, plant will be made short and small, biomass and yield reduce；By the gene expression Amount is lowered, and plant becomes larger, biomass and output increased.

Corn receptoroid kinase gene ZmRLK7, nucleotide sequence is as shown in SEQ1.

Further, the amino acid sequence of above-mentioned corn receptoroid kinase gene ZmRLK7 is encoded as shown in SEQ2.

Further, above-mentioned corn receptoroid kinase gene ZmRLK7 is located at the regulation hot spot region of the 7th chromosome, is one The Receptor-like protein ki-nase gene of a full asphalt mixture.

In arabidopsis compared with wild type, adopted ZmRLK7 gene Arabidopsis plant of becoming a full member is short and small, antisense gene arabidopsis Plant increases.

The present invention also provides the recombinant expression carriers of the receptoroid kinase gene ZmRLK7 containing above-mentioned corn.

Further, the recombinant expression carrier includes corn receptoroid kinase gene ZmRLK7 segment, by the gene Segment is connected in carrier pCAMBIA3301 by KpnI restriction enzyme site, and identification is forward and reverse, obtains corn Ubiquitin starting Son respectively drives the recombinant plasmid PUbi::Sense-ZmRLK7 and PUbi::Antisense-ZmRLK7 of forward and reverse gene expression.

The recombinant expression carrier for the overexpression of corn ZmRLK7 gene, Antisense Suppression, RNA interference and CRISPR/Cas9 gene editing.

Above-mentioned receptoroid kinase gene ZmRLK7 or above-mentioned recombinant expression carrier are improving plant height, are increasing and plant Application in strain biomass and raising seed production.

Above-mentioned receptoroid kinase gene ZmRLK7 or above-mentioned recombinant expression carrier are obtaining the application in high-yield corn.

Plant height, increase biomass and the method for improving seed production are improved the present invention also provides a kind of, Include the following steps:

S1 vector construction: the full length coding region amplification gene ZmRLK7 leads to the genetic fragment after amplified fragments sequencing is correct It crosses KpnI restriction enzyme site to be connected in carrier pCAMBIA3301, identifies that forward and reverse rear choose obtains corn Ubiquitin promoter The recombinant plasmid PUbi::Antisense-ZmRLK7 of the expressing genes in reverse of driving；

S2 Agrobacterium-mediated Transformation: the recombinant plasmid transformed AGL1 Agrobacterium of expressing genes in reverse described in step S1 is experienced In state cell；

S3 plant transformation: the Agrobacterium of the recombinant plasmid obtained containing step S2 is transferred in YEP fluid nutrient medium and is received Thallus is transformed into maturity period harvest seed in arabidopsis using flower-dipping method and obtains transgenosis T1 generation kind by the thallus after collection culture Son, or transgenic corn plant is obtained by above-mentioned mediated by agriculture bacillus maize immature embryos genetic transformation.

The utility model has the advantages that

Present invention discloses the sequence of corn receptoroid kinase gene ZmRLK7 and its adjust plant height, biomass and Effect in yield can regulate and control growth and development and its comprehensive resistance of the plants such as arabidopsis, tobacco, corn using the gene. The expression quantity of the gene rises, and keeps plant short and small, and biomass and yield reduce；Gene expression amount decline, plant become larger, biology Amount and output increased.A kind of high-yield corn can be cultivated using the present invention, further to provide to improve cereal crop yield Genetic resources.

Detailed description of the invention

Fig. 1 gene cloning and carrier qualification figure.

Fig. 2 Agrobacterium-mediated Transformation qualification figure.

Fig. 3 mediated by agriculture bacillus heredity maize immature embryos genetic transformation procedure chart.

Fig. 4 transgenic corns qualification figure.

Fig. 5 gene expression pattern figure.

Fig. 6 transgenic arabidopsis phenotypic map.

Fig. 7 transgenic corns seed phenotype statistical chart.

Fig. 8 transgenic corn plant phenotypic map.

Fig. 9 ZmRLK7 gene subcellular localization figure.

Specific embodiment

The building of expression vector of the embodiment 1 containing receptoroid kinase gene ZmRLK7

1, construction of expression vector

The pCAMBIA3301 that Plant Transformation binary vector used is transformation is tested, which carries glufosinate resistance gene Bar.Using corn B73 cDNA as template, with RLK7-F:5 '-GGTACCTAGTACAAACAATTCATGGGGTCT-3 ' (SEQ ID ) and RLK7-R:5 '-No.3GGTACCAAGGCTGCTACAAAAACCGACATT-3 ' (SEQ ID No.4) is primer, utilizes height The full length coding region fidelity enzymatic amplification ZmRLK7, underscore part are restriction enzyme KpnI restriction enzyme site.PCR reaction system is 25 μ l, including following component: 2 × High-fidelity Master Mix, 12.5 μ l, upstream and downstream primer (10 μM of concentration) each 1 μ 2 μ l of l, cDNA adds 8.5 μ l of aqua sterilisa.PCR program are as follows: 98 DEG C of initial denaturation 1min；98 DEG C of denaturation 10s, 68 DEG C of annealing 15s, 72 DEG C extend 45s, recycle 35 times；72 DEG C excessively extend 5min.

It after amplified fragments sequencing is correct, is connected in carrier pCAMBIA3301, is identified positive and negative by KpnI restriction enzyme site To obtaining the recombinant plasmid PUbi::Sense-ZmRLK7 that corn Ubiquitin promoter respectively drives forward and reverse gene expression With PUbi::Antisense-ZmRLK7.

Fig. 1 is to construct successful carrier digestion as a result, as shown, when carrying out digestion to plasmid with BamHI, PstI, is divided Not Huo get the big band of 1.2Kb+ and the big band of 3.7Kb+ band when be to be connected into Sense-ZmRLK7；2.2Kb+1.2Kb+ is obtained respectively It is to be connected into Antisense-ZmRLK7 when the band of the big band of 631bp+410bp+ and the big band of 2.6Kb+2Kb+701bp+520bp+.

2, Agrobacterium competence is converted

By the above recombinant plasmid transformed AGL1 Agrobacterium competent cell, method refers to competence specification.Take -70 DEG C of guarantors The Agrobacterium competent cell deposited melts in ice bath, and 1 μ g recombinant plasmid is added into 100 μ l competent cells, mixes gently, After ice bath 30min, liquid nitrogen flash freezer 5min；It is subsequently placed in 37 DEG C of water-baths and is incubated for 5min, ice bath 2min；Be added 800 μ l YEP (Yeast extract；10g·L^-1Tryptone；5gL-1 sodium chloride；PH 7.0) fluid nutrient medium, and on 28 DEG C of shaking tables Shaken cultivation 2-3h.After collecting thallus, it is coated on containing kanamycin and rifampin YEP plate, in 28 DEG C of incubators It is inverted culture 48-72h.

It after cultivating 72h, chooses monoclonal and shakes bacterium upgrading grain, use primer UBQ1Forward respectively: CTTTTTGTTCGCTTGGTTGTGATGA(SEQ ID No.5)；Sense-ZmRLK7:TCGCAAGCATTGGGATTGTAGAG (SEQ ID No.6) Antisense-ZmRLK7:AAGCGTGACGCGTCCGAGCTAC (SEQ ID No.7) carries out PCR identification, Qualification result is as shown in Figure 2.Positive plasmid (P) and Sense-ZmRLK7 (1,2 swimming lane) amplify 509bp size strip respectively； Positive plasmid (P) Antisense-ZmRLK7 (3,4 swimming lane) amplifies 777bp size strip respectively.Show Agrobacterium-mediated Transformation at Function.

Genetic transformation of the 3 ZmRLK7 gene of embodiment in arabidopsis and corn

1, flower-dipping method arabidopsis thaliana transformation

Agrobacterium containing recombinant plasmid is transferred in 200ml YEP fluid nutrient medium, to OD600=0.8~1.2 When, 5000rmin^-1, centrifugation 10min collection thallus.Thallus 5% sucrose solution of 200ml (L-77 containing 0.02%Silwet) It is resuspended, mixes.Spray is immersed into 30s in bacterium solution, is gently fluctuated.Arabidopsis after infecting is placed in dark and is cultivated for 24 hours, It is subsequently placed under light and normally cultivates 3-5d, carry out second and convert.Maturity period harvests seed to get transgenosis T1 is arrived for seed.

2, mediated by agriculture bacillus heredity maize immature embryos genetic transformation

Agrobacterium containing recombinant plasmid is transferred in 200ml YEP fluid nutrient medium, to OD600=0.8~1.2 When, 5000rmin^-1, centrifugation 10min collection thallus.HiII maize immature embryos with 1.5-2mm after pollination are receptor, are lost Pass conversion.It transformation time 5 minutes, then puts and co-cultures on the induction medium, be placed on after 7 days on screening and culturing medium until growing Resistant calli.Resistant calli is transferred to regeneration culture medium, regeneration plant transplant and self-fertility.Conversion process As shown in Figure 3.

3, the Molecular Detection result of transgenic line

3.1PCR identification

It takes the leaf tissue of transgenosis and non-transgenic material to extract DNA, is expanded with following primer, Ubi- Forward:5 '-GACTCTAATCATAAAAACCCATCTC-3 ' (SEQ ID No.8) and RLK-Reverse:5 '- AAGCGTGACGCGTCCGA GCTAC-3 ' (SEQ ID No.9) is primer.Forward primer is promoter special primer, is reversely drawn Object is gene specific primer, and amplification is as shown in figure 4, expand not shaping band, and transgenosis (is swum in non-transgenic control (WT) Road 1-19) and positive plasmid (P) in can amplify purpose band, also have false positive plant for example Sense-ZmRLK7 amplification swim Road 17.

3.2 Gene Expression Profile Analysis

The tissue of corn different development stage is taken, liquid nitrogen flash freezer extracts RNA with Trizol kit, then using random Six primers carry out reverse transcription, obtain single-stranded cDNA.Using corn endogenous gene Actin as reference gene, real time fluorescent quantitative is carried out PCR(qRT-PCR).Real-Time PCR, Opticon MonitorTM are carried out using Bole's 7500Real-Time PCR instrument Software analyzes experimental result.As a result as shown in figure 5, children of the gene in primary root with 15-25 days after pollination High expression in embryo, illustrates to play a crucial role in the gene Kernel in blade almost without expression.

4, transgenic line characters of progenies is identified

Plant transgenic arabidopsis and corn offspring, take blade to extract DNA in seedling stage and carry out PCR detection, positive plant into Row plant and seed/seed carry out phenotype statistics.

Arabidopsis phenotypic results are as shown in fig. 6, the results show that compared with wild type, adopted ZmRLK7 gene arabidopsis of becoming a full member Plant is short and small, and antisense gene Arabidopsis plant increases.Since result proves that the gene is negative regulation base in transgenic arabidopsis Cause, therefore only convert antisense gene structure in corn and carry out functional verification.

Corn phenotypic results are as shown in Figure 7 and Figure 8, compared with non-transgenic control, the visible antisense gene corn of Fig. 7 Seed grain thickness dramatically increases, and improves about 20%, and 100-grain weight dramatically increases, and improves about 24%；The visible antisense gene corn of Fig. 8 is planted Strain early growth gesture is stronger, robust plant.Be indicated above the gene expression dose lower, increase the size and seed of plant Grain thickness, 100-grain weight.

5, the subcellular localization of Corn Protoplast conversion and gene

By ZmRLK7 and the gene constructed fusion expression vector of GFP, big upgrading grain is spare.Corn seed is sowed in vermiculite, light Lower budding is long to 1-2cm, goes to dark place and cultivates 10-11 days.Second leaf middle section is taken to be cut into the filament of about 1mm, addition prepares Enzymolysis liquid, in room temperature dark place be incubated for 4h.It is taken out after incubation, with 75 μm of strainer filterings, 100 X g are centrifuged 2min, collect beautiful Rice protoplast, is slightly washed twice with buffer solution, is incubated for 45min~1h on ice, during which microscopy protoplast state.It is resuspended primary Plastid simultaneously adjusts concentration to~10-5 cell/100 μ l.Each transformation experiment respectively takes 20 μ g plasmids, and 100 μ l plasms are added Body cell flicks mixing, and PEG solution is added and mixes well, and stands 15min in 28 DEG C of dark places.It is collected by centrifugation and is resuspended cell, is turned Tissue culture plate is moved to, 28 DEG C of incubators are protected from light culture 12-16h.With fluorescence microscopy, photograph.

(shallow bright colored portion is that the gene is glimmering to the subcellular localization of ZmRLK7 albumen as shown in Figure 9 on cell membrane and nuclear membrane The positioning of signal), illustrate position that the gene works on film, this have in secondary structure analysis with the gene one across Spanning domain and a conservative serine/threonine kinase structure field result are consistent.

SEQUENCE LISTING

<110>academy of agricultural sciences, Shandong Province corn institute

<120>corn receptoroid kinase gene ZmRLK7 and its application

<130> 2019

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 3586

<212> DNA

<213>gene order

<400> 1

atggggtctc cccctctaca atcccaatgc ttgcgagagg cgccacctca cagagccagc 60

catccaccgc attgccgccc ccctcgcctc tcctcacgtc acccgcccgt ctcagcctca 120

ccaccgaggc gcgcgctgcc aatgccgcca cggtcccgcg ccgcggcacc gaggctcgcg 180

tttctcgtgc cgctcgcctt cgccttcgcc ttgctgctgg tgccgccgtg ccactgcgtc 240

aacgagcagg gccaggcgct gctgcgatgg aaggacaccc tgcggccggc gggcggcgcg 300

ctggcgtcgt ggcgcgccgg ggacgcgagt ccgtgccggt ggaccggcgt gtcgtgcaac 360

gcgcgcggcg acgtcgtcgg gctgagcatc acctcggtcg atctgcaggg ccctctcccg 420

gccaacctgc agccgcttgc agcgtcgctg aagacgctgg agctctctgg cacgaacctc 480

accggcgcga tacccaagga gatcggcgag tacggcgagc tgaccaccct cgaccttagc 540

aagaaccagc tcaccggcgc ggtccccgcc gagctgtgcc ggctggccaa gcttgagtcg 600

ctcgcgctca actccaactc cctgcgtgga gccatcccgg acgacatcgg caacctcacc 660

agcctgacgt atctgacgct ctacgacaat gagctcagtg ggccgatccc gcccagcatc 720

ggcaacctga agaagctgca ggtgctccgc gccggcggga accaggggat gaagggtccc 780

ctgccgcagg agatcggcgg atgcactgac ctcaccatgc tcgggctcgc ggagaccggc 840

gtctcaggga gcctcccgga gacgatcggg cagctcaaga agatccagac cattgccatc 900

tacaccactc tgctctccgg ccggatcccg gagtccatcg gcaactgcac ccagctcacc 960

agcctgtacc tgtaccagaa ttctctctcc gggccgatac ctccgcagct cggctacctc 1020

aagaagctcc agactctgct tctatggcag aaccagctcg tcggcgcaat tcccccggaa 1080

ctcggacagt gcaaggagct cacgctcatt gacctgtcgc tgaattcgct taccgggagc 1140

atcccggcga gtttgggcgg gctacctaat ctccagcagc tgcagctgag cacgaaccag 1200

ctcactggca ccataccgcc ggagctctcc aactgcacgt cgctgacgga catcgaggtc 1260

gacaacaact tgctgtccgg ggcgatcagc atcgacttcc cgagactgcg caacctcacc 1320

ctgttctacg cgtggaagaa ccggctcact ggcggcgtgc cgacgagcct cgccgaggcc 1380

ccgagcttgc aggcggttga cctgtcatac aacaacctca ccggtcccat ccccaaggcg 1440

ctgttcgggc tccagaactt gaccaagctg ctgcttctca acaacgagct gaccgggctc 1500

ataccgtcgg agatcggtaa ctgcaccaac ctgtacagac tccggctcaa cggcaacagg 1560

ctgtccggcg cgattcccgc cgagatcggc aacctcaaga acctaaactt cctcgacatg 1620

agtgagaacc acctcgtcgg cccggtgccc gcggccatat cggggtgcgc cagcctcgag 1680

ttcctcgacc tgcactccaa tgctctgtcc ggcgcattgc cggacacgtt gccgcgcagt 1740

ctccagctca ttgacgtctc cgacaaccag ctcaccgggc cgttgagctc cagcatcggg 1800

tcattgccgg agctgacgaa gctgtacatg ggaaacaacc ggctgaccgg tggcatcccg 1860

cccgagctcg gttcgtgtga gaagctccag ctgctggacc tcggcggcaa cgcgttctcc 1920

ggtggcatcc cgtcggagct cgggatgcta ccgtcattgg agatctcgct taacctcagc 1980

tgcaaccggc tttcagggga gataccgtcg cagttcgccg gccttgacaa gctcggcagc 2040

ctcgacctgt cgcacaacga gctctccggg agccttgagc cgctcgcggc gctgcagaac 2100

ctcgtcacgt tgaacatatc ctacaatacc ttctctgggg agctcccgaa cactcccttc 2160

ttccagaagc tgcccctcag cgacctagcc ggcaaccgcc atctcgtcgt cagcgacggc 2220

tccgacgagt cctcccggcg tggcgtcatc tcgtcattca agatagccat atccatcctc 2280

gccgcagcca gcgcgctgct cctggttgcc gccgcctata tgctcgcccg cacgcaccgc 2340

cgcggcggcg gccgcatcat ccacggcgag ggctcgtggg aggtgacact gtaccagaag 2400

ctcgacatca ccatggacga cgtgctccga gggctgacgt ccgcgaacat gatcggcacc 2460

ggcagctcag gggccgtgta caaggtggac acccccaacg gctacaccct cgccgtgaag 2520

aagatgtggt cgtcggacga ggtgacgtcg gcggcgttcc gcagcgagat cgcggcgctg 2580

ggctccatcc gccaccgcaa catcgtgcgc ctcctcgggt gggccgcgaa cggcggcacg 2640

aggctgctct tctacagcta cctccccaac ggcagcctga gcggcctcct gcacggcggc 2700

cgcgccgcca agggctcgcc cgcggacgag tggggcgcgc gctacgagat cgcgctcggc 2760

gtcgcccacg ccgtggcgta cctgcaccac gactgcgtgc cggccatcct gcacggcgac 2820

gtcaagtcca tgaacgtgct gctcggcgcg tcctacgagc cgtacctcgc tgacttcggc 2880

ctcgcccgcg tcctggccgc cgcgagctcc atgctcgaca ccggcaagca gccccgcatc 2940

gccggctcgt acggctacat ggcaccagag tacgcgtcga tgcagcggat cagcgagaag 3000

agcgacgtgt acagcttcgg cgtcgtgttg ctggagatct tgacggggcg gcacccgctg 3060

gacccgacgc tgtccggcgg cgcgcacctg gtgcagtggc tgcgcgagca cgtgcaggcg 3120

aagcgtgacg cgtccgagct actggacgcg cggctccggg ccagggcggg cgaggcggac 3180

gtgcacgaga tgcggcaggt gctgtccgtg gccacgctgt gcgtgtcgcg ccgcgcggac 3240

gaccggcccg ccatgaagga cgtggtggcg ctgctcaagg agatccggcg ccccgcggcg 3300

gtggacgacg cgaagcagcg gccacccacg gccgccgcgc cggtgtcgcc ggtgagcgcg 3360

cactcgaggg gccaatcgtc gagctgctcc ttcgccgtgt cggagtactc tgcctgacgg 3420

gacgcgaatt tttgcgagtg tagtgaacct agtaaattac tactaacatc ttagcgagcc 3480

gtaaacagtg ttgattagcc aaagatgtac tactggtaat gttgtactta ggtgtaatct 3540

gccattgtac attactctcg agaatgtcgg tttttgtagc agcctt 3586

<210> 2

<211> 1138

<212> PRT

<213>amino acid sequence

<400> 2

Met Gly Ser Pro Pro Leu Gln Ser Gln Cys Leu Arg Glu Ala Pro Pro

1 5 10 15

His Arg Ala Ser His Pro Pro His Cys Arg Pro Pro Arg Leu Ser Ser

20 25 30

Arg His Pro Pro Val Ser Ala Ser Pro Pro Arg Arg Ala Leu Pro Met

35 40 45

Pro Pro Arg Ser Arg Ala Ala Ala Pro Arg Leu Ala Phe Leu Val Pro

50 55 60

Leu Ala Phe Ala Phe Ala Leu Leu Leu Val Pro Pro Cys His Cys Val

65 70 75 80

Asn Glu Gln Gly Gln Ala Leu Leu Arg Trp Lys Asp Thr Leu Arg Pro

85 90 95

Ala Gly Gly Ala Leu Ala Ser Trp Arg Ala Gly Asp Ala Ser Pro Cys

100 105 110

Arg Trp Thr Gly Val Ser Cys Asn Ala Arg Gly Asp Val Val Gly Leu

115 120 125

Ser Ile Thr Ser Val Asp Leu Gln Gly Pro Leu Pro Ala Asn Leu Gln

130 135 140

Pro Leu Ala Ala Ser Leu Lys Thr Leu Glu Leu Ser Gly Thr Asn Leu

145 150 155 160

Thr Gly Ala Ile Pro Lys Glu Ile Gly Glu Tyr Gly Glu Leu Thr Thr

165 170 175

Leu Asp Leu Ser Lys Asn Gln Leu Thr Gly Ala Val Pro Ala Glu Leu

180 185 190

Cys Arg Leu Ala Lys Leu Glu Ser Leu Ala Leu Asn Ser Asn Ser Leu

195 200 205

Arg Gly Ala Ile Pro Asp Asp Ile Gly Asn Leu Thr Ser Leu Thr Tyr

210 215 220

Leu Thr Leu Tyr Asp Asn Glu Leu Ser Gly Pro Ile Pro Pro Ser Ile

225 230 235 240

Gly Asn Leu Lys Lys Leu Gln Val Leu Arg Ala Gly Gly Asn Gln Gly

245 250 255

Met Lys Gly Pro Leu Pro Gln Glu Ile Gly Gly Cys Thr Asp Leu Thr

260 265 270

Met Leu Gly Leu Ala Glu Thr Gly Val Ser Gly Ser Leu Pro Glu Thr

275 280 285

Ile Gly Gln Leu Lys Lys Ile Gln Thr Ile Ala Ile Tyr Thr Thr Leu

290 295 300

Leu Ser Gly Arg Ile Pro Glu Ser Ile Gly Asn Cys Thr Gln Leu Thr

305 310 315 320

Ser Leu Tyr Leu Tyr Gln Asn Ser Leu Ser Gly Pro Ile Pro Pro Gln

325 330 335

Leu Gly Tyr Leu Lys Lys Leu Gln Thr Leu Leu Leu Trp Gln Asn Gln

340 345 350

Leu Val Gly Ala Ile Pro Pro Glu Leu Gly Gln Cys Lys Glu Leu Thr

355 360 365

Leu Ile Asp Leu Ser Leu Asn Ser Leu Thr Gly Ser Ile Pro Ala Ser

370 375 380

Leu Gly Gly Leu Pro Asn Leu Gln Gln Leu Gln Leu Ser Thr Asn Gln

385 390 395 400

Leu Thr Gly Thr Ile Pro Pro Glu Leu Ser Asn Cys Thr Ser Leu Thr

405 410 415

Asp Ile Glu Val Asp Asn Asn Leu Leu Ser Gly Ala Ile Ser Ile Asp

420 425 430

Phe Pro Arg Leu Arg Asn Leu Thr Leu Phe Tyr Ala Trp Lys Asn Arg

435 440 445

Leu Thr Gly Gly Val Pro Thr Ser Leu Ala Glu Ala Pro Ser Leu Gln

450 455 460

Ala Val Asp Leu Ser Tyr Asn Asn Leu Thr Gly Pro Ile Pro Lys Ala

465 470 475 480

Leu Phe Gly Leu Gln Asn Leu Thr Lys Leu Leu Leu Leu Asn Asn Glu

485 490 495

Leu Thr Gly Leu Ile Pro Ser Glu Ile Gly Asn Cys Thr Asn Leu Tyr

500 505 510

Arg Leu Arg Leu Asn Gly Asn Arg Leu Ser Gly Ala Ile Pro Ala Glu

515 520 525

Ile Gly Asn Leu Lys Asn Leu Asn Phe Leu Asp Met Ser Glu Asn His

530 535 540

Leu Val Gly Pro Val Pro Ala Ala Ile Ser Gly Cys Ala Ser Leu Glu

545 550 555 560

Phe Leu Asp Leu His Ser Asn Ala Leu Ser Gly Ala Leu Pro Asp Thr

565 570 575

Leu Pro Arg Ser Leu Gln Leu Ile Asp Val Ser Asp Asn Gln Leu Thr

580 585 590

Gly Pro Leu Ser Ser Ser Ile Gly Ser Leu Pro Glu Leu Thr Lys Leu

595 600 605

Tyr Met Gly Asn Asn Arg Leu Thr Gly Gly Ile Pro Pro Glu Leu Gly

610 615 620

Ser Cys Glu Lys Leu Gln Leu Leu Asp Leu Gly Gly Asn Ala Phe Ser

625 630 635 640

Gly Gly Ile Pro Ser Glu Leu Gly Met Leu Pro Ser Leu Glu Ile Ser

645 650 655

Leu Asn Leu Ser Cys Asn Arg Leu Ser Gly Glu Ile Pro Ser Gln Phe

660 665 670

Ala Gly Leu Asp Lys Leu Gly Ser Leu Asp Leu Ser His Asn Glu Leu

675 680 685

Ser Gly Ser Leu Glu Pro Leu Ala Ala Leu Gln Asn Leu Val Thr Leu

690 695 700

Asn Ile Ser Tyr Asn Thr Phe Ser Gly Glu Leu Pro Asn Thr Pro Phe

705 710 715 720

Phe Gln Lys Leu Pro Leu Ser Asp Leu Ala Gly Asn Arg His Leu Val

725 730 735

Val Ser Asp Gly Ser Asp Glu Ser Ser Arg Arg Gly Val Ile Ser Ser

740 745 750

Phe Lys Ile Ala Ile Ser Ile Leu Ala Ala Ala Ser Ala Leu Leu Leu

755 760 765

Val Ala Ala Ala Tyr Met Leu Ala Arg Thr His Arg Arg Gly Gly Gly

770 775 780

Arg Ile Ile His Gly Glu Gly Ser Trp Glu Val Thr Leu Tyr Gln Lys

785 790 795 800

Leu Asp Ile Thr Met Asp Asp Val Leu Arg Gly Leu Thr Ser Ala Asn

805 810 815

Met Ile Gly Thr Gly Ser Ser Gly Ala Val Tyr Lys Val Asp Thr Pro

820 825 830

Asn Gly Tyr Thr Leu Ala Val Lys Lys Met Trp Ser Ser Asp Glu Val

835 840 845

Thr Ser Ala Ala Phe Arg Ser Glu Ile Ala Ala Leu Gly Ser Ile Arg

850 855 860

His Arg Asn Ile Val Arg Leu Leu Gly Trp Ala Ala Asn Gly Gly Thr

865 870 875 880

Arg Leu Leu Phe Tyr Ser Tyr Leu Pro Asn Gly Ser Leu Ser Gly Leu

885 890 895

Leu His Gly Gly Arg Ala Ala Lys Gly Ser Pro Ala Asp Glu Trp Gly

900 905 910

Ala Arg Tyr Glu Ile Ala Leu Gly Val Ala His Ala Val Ala Tyr Leu

915 920 925

His His Asp Cys Val Pro Ala Ile Leu His Gly Asp Val Lys Ser Met

930 935 940

Asn Val Leu Leu Gly Ala Ser Tyr Glu Pro Tyr Leu Ala Asp Phe Gly

945 950 955 960

Leu Ala Arg Val Leu Ala Ala Ala Ser Ser Met Leu Asp Thr Gly Lys

965 970 975

Gln Pro Arg Ile Ala Gly Ser Tyr Gly Tyr Met Ala Pro Glu Tyr Ala

980 985 990

Ser Met Gln Arg Ile Ser Glu Lys Ser Asp Val Tyr Ser Phe Gly Val

995 1000 1005

Val Leu Leu Glu Ile Leu Thr Gly Arg His Pro Leu Asp Pro Thr

1010 1015 1020

Leu Ser Gly Gly Ala His Leu Val Gln Trp Leu Arg Glu His Val

1025 1030 1035

Gln Ala Lys Arg Asp Ala Ser Glu Leu Leu Asp Ala Arg Leu Arg

1040 1045 1050

Ala Arg Ala Gly Glu Ala Asp Val His Glu Met Arg Gln Val Leu

1055 1060 1065

Ser Val Ala Thr Leu Cys Val Ser Arg Arg Ala Asp Asp Arg Pro

1070 1075 1080

Ala Met Lys Asp Val Val Ala Leu Leu Lys Glu Ile Arg Arg Pro

1085 1090 1095

Ala Ala Val Asp Asp Ala Lys Gln Arg Pro Pro Thr Ala Ala Ala

1100 1105 1110

Pro Val Ser Pro Val Ser Ala His Ser Arg Gly Gln Ser Ser Ser

1115 1120 1125

Cys Ser Phe Ala Val Ser Glu Tyr Ser Ala

1130 1135

<210> 3

<211> 30

<212> DNA

<213>artificial sequence

<400> 3

ggtacctagt acaaacaatt catggggtct 30

<210> 4

<211> 30

<212> DNA

<213>artificial sequence

<400> 4

ggtaccaagg ctgctacaaa aaccgacatt 30

<210> 5

<211> 25

<212> DNA

<213>artificial sequence

<400> 5

ctttttgttc gcttggttgt gatga 25

<210> 6

<211> 23

<212> DNA

<213>artificial sequence

<400> 6

tcgcaagcat tgggattgta gag 23

<210> 7

<211> 22

<212> DNA

<213>artificial sequence

<400> 7

aagcgtgacg cgtccgagct ac 22

<210> 8

<211> 25

<212> DNA

<213>artificial sequence

<400> 8

gactctaatc ataaaaaccc atctc 25

<210> 9

<211> 22

<212> DNA

<213>artificial sequence

<400> 9

aagcgtgacg cgtccgagct ac 22

Claims

1. corn receptoroid kinase gene ZmRLK7, which is characterized in that nucleotide sequence is as shown in SEQ1.

2. corn receptoroid kinase gene ZmRLK7 as described in claim 1, which is characterized in that encode the corn receptoroid The amino acid sequence of kinase gene ZmRLK7 is as shown in SEQ2.

3. corn receptoroid kinase gene ZmRLK7 as described in claim 1, which is characterized in that the corn receptoroid kinases Gene ZmRLK7 is located at the regulation hot spot region of the 7th chromosome, is the Receptor-like protein ki-nase gene an of full asphalt mixture.

4. the recombinant expression carrier of the receptoroid kinase gene ZmRLK7 containing corn as described in claim 1.

5. recombinant expression carrier as claimed in claim 4, which is characterized in that by corn receptoroid kinase gene ZmRLK7 segment It is connected in carrier pCAMBIA3301 by KpnI restriction enzyme site, after identification is forward and reverse, obtains corn Ubiquitin promoter Respectively drive the recombinant plasmid PUbi::Sense-ZmRLK7 and PUbi::Antisense-ZmRLK7 of forward and reverse gene expression.

6. recombinant expression carrier as described in claim 4 or 5, which is characterized in that the recombinant expression carrier is used for corn Overexpression, Antisense Suppression, RNA interference and the CRISPR/Cas9 gene editing of ZmRLK7 gene.

7. the described in any item receptoroid kinase gene ZmRLK7 of claim 1-3 or recombinant expression described in claim 4 or 5 Carrier is improving plant height, increases biomass and is improving the application in seed production.

8. the described in any item receptoroid kinase gene ZmRLK7 of claim 1-3 or recombinant expression described in claim 4 or 5 Carrier is obtaining the application in high-yield corn.

9. a kind of method for improving plant height, increasing biomass and improving seed production, which is characterized in that including Following steps:

S1 vector construction: expanding the full length coding region sequence of gene as described in claim 1, after amplified fragments sequencing is correct, The genetic fragment is connected in carrier pCAMBIA3301 by KpnI restriction enzyme site, identifies that forward and reverse rear such as right of choosing is wanted The recombinant plasmid PUbi::Antisense-ZmRLK7 of expressing genes in reverse described in asking 5；

S2 Agrobacterium-mediated Transformation: the recombinant plasmid transformed AGL1 Agrobacterium competence of expressing genes in reverse described in step S1 is thin In born of the same parents；

S3 plant transformation: the Agrobacterium containing recombinant plasmid that step S2 is obtained, which is transferred in YEP fluid nutrient medium, collects training Thallus is transformed into maturity period harvest seed in arabidopsis using flower-dipping method and obtains transgenosis T1 for seed by the thallus after supporting, or Transgenic corn plant is obtained by above-mentioned mediated by agriculture bacillus maize immature embryos genetic transformation.