CN110055322A - For the circulation miRNA marker of Diagnosis of Acute Myocardial Infarction and its application - Google Patents
For the circulation miRNA marker of Diagnosis of Acute Myocardial Infarction and its application Download PDFInfo
- Publication number
- CN110055322A CN110055322A CN201910391352.7A CN201910391352A CN110055322A CN 110055322 A CN110055322 A CN 110055322A CN 201910391352 A CN201910391352 A CN 201910391352A CN 110055322 A CN110055322 A CN 110055322A
- Authority
- CN
- China
- Prior art keywords
- mir
- primer
- myocardial infarction
- seq
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of miRNA markers to diagnose the application of acute myocardial infarction AMI, using its product and detection method, is related to Medical Molecular Biology technical field.MiR-26a-1, miR-146a or miR-199a-1 provided by the invention can marker of the single or use in conjunction as myocardial infarction auxiliary early diagnosis, the early stage apparent increase that blood plasma level occurs in myocardial infarction.MiRNA is discharged into blood earlier than intracellular protein class marker in acute myocardial infarction patients blood, therefore is detected its blood plasma level and be can be used as the biomarker of acute myocardial infarction AMI auxiliary early diagnosis.Three miRNA markers that the present invention filters out can be used as the marker of the early diagnosis of heart disease, to greatly improve the sensibility and specificity of medical diagnosis on disease.
Description
Technical field
The present invention relates to Medical Molecular Biology technical fields, more particularly, to the application of miRNA a kind of, using its production
Product and detection method.
Background technique
Acute myocardial infarction AMI (AMI) is myocardium acute, duration hypoxic-ischemic caused by coronary artery stenosis and blocking, is led
One of the main reason for causing myocardial necrosis, being mortality, has seriously endangered whole world human health.Acute myocardial infarction AMI
Disease incidence in China is in rising trend 55/,100,000 or so, and in recent years.Acute myocardial infarction AMI is related to a variety of pathology
And Physiological factors, it is a kind of complicated, critical illness, mortality and disability rate are high.To acute myocardial infarction AMI mesh
Preceding common remedy measures are that thrombolysis or early stage intravascular stent interventional therapy restore blood fortune circulation, have greatly saved Acute myocardial stalk
Dead patient.Biomarker can effectively help early diagnosis of acute myocardial infarction, can promote individuation, precision treatment mesh
Target is realized.
Patient's waiting time can be reduced to the early diagnosis of acute myocardial infarction AMI, best occasion for the treatment is held, to protection
Heart function, mitigation myocardial damage and redemption life are most important.Early diagnosis of acute myocardial infarction marker packet traditional at present
Serum myoglobin (MYO), troponin (cTn) etc. are included, clinical line auxiliary acute myocardial infarction AMI has been widely used in
Early diagnosis.Troponin I/T is considered as " goldstandard " for diagnosing acute myocardial infarction AMI, is the generally acknowledged acute heart of Present clinical
Flesh Infarction Patients early diagnosis marker.After cardiac muscle cell's ischemic necrosis of patients of acute myocardial infarction, the integrality of cell
It is destroyed, the substance in cardiac muscle cell includes that MYO, cTn etc. can be constantly discharged into peripheral blood, so that myocardial infarction be made to obtain
With detection.But cTnI/cTnT as acute myocardial infarction AMI marker in terms of specificity there is also deficiency,
His disease for example such as acute ischemic stroke, chronic renal failure and infectious shock etc. can cause blood cTnI/
CTnT is increased, therefore urgently finds new acute myocardial infarction AMI specificity early diagnosis marker.
It MicroRNA(miRNA is) intracellular a kind of in upper highly conserved non-coding RNA of evolving, mature miRNA long
Degree is about 22 nucleotide.MiRNA exists with single stranded form, is carried out to said target mrna in post-transcriptional level by complementary pairing mode
Regulation, so that controlling gene is expressed.MiRNA participates in various physiological processes, including cell differentiation, development, proliferation, apoptosis and inverse
Border response etc..MiRNA plays important regulating and controlling effect during the occurrence and development of many diseases.In recent years the study found that
MiRNA is present in the circulatory system by a variety of transporting mechanisms such as excretion body, such as serum, blood plasma etc..MiRNA tool in blood
The characteristics of thering is stability is strong, is easy to regular inspection to survey, and there is significant correlation with disease in the level of miRNA.In recent years,
With chip gene expression profile and realtime quantitative inspection (PCR) technology extensive use and genomics it is fast
Speed development, miRNA molecule application value in the medical diagnosis on disease and clinical conversion are increasingly taken seriously.Studies have shown that circulation
The expression and cardiovascular disease of miRNA has significant correlation.Such as Wang has found that miR-208 has and is used as the heart
The marker potential value of injury of muscle.Tijsen etc. is research shows that miR-423 can be used as the biomarker etc. of heart failure.
However, by the end of currently, circulation miRNA be used for diagnose Early acute myocardial infarction report it is also less, it is existing
Acute myocardial infarction AMI miRNA diagnosis marker for miRNA expression before and after percutaneous coronary intervention (pci) (PCI) without becoming
The research of change feature.
In view of this, the present invention is specifically proposed.
Summary of the invention
The first purpose of this invention is to provide miR-26a-1, miR-146a or miR-199a-1 any one or group
The application in the product of Diagnosing Cardiac disease is closed, to alleviate the deficiency in existing heart disease miRNA diagnosis marker technology.
Second object of the present invention is to provide a kind of reagent for Diagnosing Cardiac disease.
Third object of the present invention is to provide a kind of kit for Diagnosing Cardiac disease.
Fourth object of the present invention is to provide miR-26a-1, miR-146a or miR-199a-1 any one or group
The detection method of conjunction, to alleviate the insufficient problem of the detection specificity to above-mentioned three kinds of miRNA in the prior art.
Product the present invention provides following any one or more substance of (a)-(c) in preparation for Diagnosing Cardiac disease
In application:
(a) miR-26a-1；
(b) miR-146a；
(c) miR-199a-1.
Further, the nucleotide sequence of the miR-26a-1 is as shown in SEQ ID No.1, the core of the miR-146a
Nucleotide sequence is as shown in SEQ ID No.2, and the nucleotide sequence of the miR-199a-1 is as shown in SEQ ID No.3.
Further, the product is reagent or kit.
Further, the heart disease is myocardial infarction, preferably acute myocardial infarction AMI.
The present invention also provides a kind of reagent for Diagnosing Cardiac disease, the reagent includes following (A)-(C) any
One or more substances:
(A) for detecting the primer of miR-26a-1；
(B) for detecting the primer of miR-146a；
(C) for detecting the primer of miR-199a-1.
The present invention also provides a kind of kit for Diagnosing Cardiac disease, the kit includes following (A)-(C)
Reagent described in any one or more substance or claim 5:
(A) for detecting the primer of miR-26a-1；
(B) for detecting the primer of miR-146a；
(C) for detecting the primer of miR-199a-1.
Further, the kit further includes reverse transcriptase, buffer, dNTPs, MgCl2, DEPC water, Taq enzyme and
DNA fluorescent dye and standard items and/or reference substance.
Further,
The primer for detecting miR-26a-1 has the upstream primer of the sequence as shown in SEQ ID No.4 and such as SEQ ID
The downstream primer of sequence shown in No.5；
The primer for detecting miR-146a has the upstream primer of the sequence as shown in SEQ ID No.6 and such as SEQ ID
The downstream primer of sequence shown in No.7；
The primer for detecting miR-199a-1 has the upstream primer of the sequence as shown in SEQ ID No.8 and such as SEQ ID
The downstream primer of sequence shown in No.9.
Further, the heart disease is myocardial infarction, preferably acute myocardial infarction AMI.
In addition, being detected the present invention also provides a kind of detection method of any one or more substance of following (a)-(c)
Method includes: to extract sample rna to carry out quantitative fluorescent PCR reaction, obtains the phase of any one or more substance of (a)-(c)
To expression quantity；
(a)-(c) are as follows:
(a) miR-26a-1；
(b) miR-146a；
(c) miR-199a-1.
MiR-26a-1, miR-146a or miR-199a-1 marker group provided by the invention assists early as heart disease
The phase marker of diagnosis is advantageous in that miRNA itself only has 18-25 nucleotide, and mature body is stable in the presence of cell
In matter, therefore miRNA very likely discharges into blood circulation earlier than structural proteins substance in acute myocardial infarction AMI serum
In system, detecting its level can be used as the biomarker of acute myocardial infarction AMI auxiliary early diagnosis.Also, the miR- filtered out
Tri- markers of 26a-1, miR-146a or miR-199a-1 can be used as the marker of the early diagnosis of heart disease, thus greatly
The big sensibility and specificity for improving medical diagnosis on disease.In conjunction with serum miR-26a-1, miR-146a of unconventionality expression in heart disease
And miR-199a-1, and corresponding heart disease auxiliary diagnostic box is developed, the early stage of China's acute myocardial infarction AMI is examined
Disconnected status centainly has good facilitation.
Detailed description of the invention
It, below will be to specific in order to illustrate more clearly of the specific embodiment of the invention or technical solution in the prior art
Embodiment or attached drawing needed to be used in the description of the prior art be briefly described, it should be apparent that, it is described below
Attached drawing is some embodiments of the present invention, for those of ordinary skill in the art, before not making the creative labor
It puts, is also possible to obtain other drawings based on these drawings.
Fig. 1 a be the miR-26a-1 that provides of the embodiment of the present invention 2 patients of acute myocardial infarction PCI it is preoperative, postoperative group and
The result figure of normal health control group differential expression；
Fig. 1 b be the miR-146a that provides of the embodiment of the present invention 2 patients of acute myocardial infarction PCI it is preoperative, postoperative group and normal strong
The result figure of health control group differential expression；
Fig. 1 c be the miR-199a-1 that provides of the embodiment of the present invention 2 patients of acute myocardial infarction PCI it is preoperative, postoperative group and normal
The result figure of healthy control group differential expression；
Fig. 2 a is that the miR-26a-1 that the embodiment of the present invention 3 provides analyzes result figure in the preoperative ROC of patients of acute myocardial infarction PCI；
Fig. 2 d is that the miR-26a-1 that the embodiment of the present invention 3 provides analyzes result figure in the postoperative ROC of patients of acute myocardial infarction PCI；
Fig. 2 b is that the miR-146a that the embodiment of the present invention 3 provides analyzes result figure in the preoperative ROC of patients of acute myocardial infarction PCI；
Fig. 2 e is that the miR-146a that the embodiment of the present invention 3 provides analyzes result figure in the postoperative ROC of patients of acute myocardial infarction PCI；
Fig. 2 c is that the miR-199a-1 that the embodiment of the present invention 3 provides analyzes result in the preoperative ROC of patients of acute myocardial infarction PCI
Figure；
Fig. 2 f is that the miR-199a-1 that the embodiment of the present invention 3 provides analyzes result in the postoperative ROC of patients of acute myocardial infarction PCI
Figure；
Fig. 3 a is that miR-26a-1, miR-146a and miR-199a-1 that the embodiment of the present invention 3 provides are combined in acute myocardial infarction AMI
The preoperative ROC of patient PCI analyzes result figure；
Fig. 3 b is that miR-26a-1, miR-146a and miR-199a-1 that the embodiment of the present invention 3 provides are combined in acute myocardial infarction AMI
The postoperative ROC of patient PCI analyzes result figure.
Specific embodiment
Technical solution of the present invention is clearly and completely described below in conjunction with embodiment, it is clear that described reality
Applying example is a part of the embodiment of the present invention, instead of all the embodiments.Based on the embodiments of the present invention, the common skill in this field
Art personnel every other embodiment obtained without making creative work belongs to the model that the present invention protects
It encloses.
Product the present invention provides following any one or more substance of (a)-(c) in preparation for Diagnosing Cardiac disease
In application:
(a) miR-26a-1；
(b) miR-146a；
(c) miR-199a-1.
MiRNA is made of 18-25 nucleotide, and mature body is stabilized in cytoplasm, the variation of expression
Earlier than the variation of protein translation, also earlier than the appearance of disease symptoms, the expression for thus detecting Peripheral Circulation miRNA becomes
Change, it is possible to give a clue for the occurrence and development of heart disease, and then clinic can be instructed to be early diagnosed, effectively control disease
The development of disease.Using Peripheral Circulation miRNA as early diagnosis of acute myocardial infarction marker than traditional protein marker
It will be more efficient.
In one preferred embodiment, pass through such as lower section provided by the present invention for the miRNA of Diagnosing Cardiac disease
Method screens to obtain:
(1) serum miRNA differential expression spectrum analysis: selection acute myocardial infarction AMI case and matched normal healthy controls, selection
Acute myocardial infarction AMI case PCI preoperative and PCI postoperative blood sample detects its blood plasma miRNA express spectra and content, analysis disease
The variation of miRNA expression between example and normal healthy controls, analyzes the variation of the preoperative and postoperative expression of case PCI, and screening is special
The miRNAs of different expression.
(2) it screens disease relevant plasma miRNAs: more optimized quantitative analysis being carried out to the blood plasma miRNA s screened, really
Determine acute myocardial infarction AMI correlation miRNAs.
(3) it the development of blood plasma miRNA s screening and diagnostic kit: is opened according to acute myocardial infarction AMI relevant plasma miRNAs
The miRNAs auxiliary diagnostic box of hair, realizes the purpose of early diagnosis of acute myocardial infarction.
In one preferred embodiment, the nucleotide sequence of miR-26a-1 are as follows: 5 '-
UUCAAGUAAUCCAGGAUAGGCU-3 ' (SEQ ID No.1), the nucleotide sequence of miR-146a are as follows: 5 '-
UGAGAACUGAAUUCCAUGGGUU-3 ' (SEQ ID No.2), the nucleotide sequence of miR-199a-1 are as follows: 5 '-
CCCAGUGUUCAGACUACCUGUUC-3 ' (SEQ ID No.3).
Wherein, the miR-26a-1 involved in the present invention can be with are as follows: with the identical sequence of sequence shown in SEQ ID NO.1
Column, the bioactive functions piece of sequence shown in the sequence or SEQ ID NO.1 perhaps containing sequence shown in SEQ ID NO.1
Section or SEQ ID NO.1 shown in sequence variant.All sequences for having functional nucleotide sequence shown in SEQ ID NO.1, all should
It is interpreted as protection scope of the present invention, without should only be interpreted as and the identical sequence of sequence shown in SEQ ID NO.1.
MiR-146a involved in the present invention can be with are as follows: with the identical sequence of sequence shown in SEQ ID NO.2, or
Sequence containing sequence shown in SEQ ID NO.2 perhaps the bioactive functions segment of sequence shown in SEQ ID NO.2 or
The variant of sequence shown in SEQ ID NO.2.All sequences for having functional nucleotide sequence shown in SEQ ID NO.2, all should be understood as
Protection scope of the present invention, without should only be interpreted as and the identical sequence of sequence shown in SEQ ID NO.2.
MiR-199a-1 involved in the present invention can be with are as follows: with the identical sequence of sequence shown in SEQ ID NO.3, or
Person contain sequence shown in SEQ ID NO.3 sequence or SEQ ID NO.3 shown in sequence bioactive functions segment, or
The variant of sequence shown in person SEQ ID NO.3.All sequences for having functional nucleotide sequence shown in SEQ ID NO.3, all it should be understood that
For protection scope of the present invention, without should only be interpreted as and the identical sequence of sequence shown in SEQ ID NO.3.
In one preferred embodiment, product is reagent or kit.
In one preferred embodiment, heart disease is myocardial infarction, preferably acute myocardial infarction AMI.
The present invention also provides a kind of reagents for Diagnosing Cardiac disease, including following (A)-(C) any one or it is more
Kind substance:
(A) for detecting the primer of miR-26a-1；
(B) for detecting the primer of miR-146a；
(C) for detecting the primer of miR-199a-1.
The present invention also provides a kind of kits for Diagnosing Cardiac disease, including following (A)-(C) any one or
Many kinds of substance or above-mentioned reagent:
(A) for detecting the primer of miR-26a-1；
(B) for detecting the primer of miR-146a；
(C) for detecting the primer of miR-199a-1.
MiR-26a-1, miR-146a or the miR-199a-1 provided in reagent or kit provided by the invention can make
Risk for myocardial infarction related disease is estimated and is detected.Its high sensitivity, high specificity, can discovery early suffer from heart failure
The risk of disease is exhausted, convenient for the prevention and treatment of early stage.
In one preferred embodiment, kit further includes reverse transcriptase, buffer, dNTPs, MgCl2、DEPC
Water, Taq enzyme and DNA fluorescent dye and standard items and/or reference substance.
The plurality of reagents needed for setting experiment in kit can guarantee to make when being tested using this kit
With more convenient, operate simpler.
In one preferred embodiment, the upstream primer for detecting miR-26a-1 is miR-26a-1-F, downstream
Primer is miR-26a-1-R；Upstream primer for detecting miR-146a is miR-146a-F, downstream primer miR-146a-
R；Upstream primer for detecting miR-199a-1 is miR-199a-1-F, downstream primer miR-199a-1-R.Above-mentioned primer
Nucleotide sequence it is as shown in the table:
| Primer | Sequence (5 ' -3 ') | Serial number |
| miR-26a-1-F | TTCAAGTAATCCAGGATAGGCT | SEQ ID No.4 |
| miR-26a-1-R | TTTTTTTTTTTTT | SEQ ID No.5 |
| miR-146a-F | TGAGAACTGAATTCCATGGGTT | SEQ ID No.6 |
| miR-146a-R | TTTTTTTTTTTTT | SEQ ID No.7 |
| miR-199a-1-F | CCCAGTGTTCAGACTACCTGTTC | SEQ ID No.8 |
| miR-199a-1-R | TTTTTTTTTTTTT | SEQ ID No.9 |
In one preferred embodiment, heart disease is myocardial infarction, preferably acute myocardial infarction AMI.
In addition, the present invention also provides a kind of detection methods of any one or more substance of following (a)-(c), comprising:
It extracts sample rna and carries out quantitative fluorescent PCR reaction, obtain the relative expression quantity of any one or more substance of (a)-(c)；
Wherein (a)-(c) are as follows:
(a) miR-26a-1；
(b) miR-146a；
(c) miR-199a-1.
MiR-26a-1, miR-146a or miR-199a-1 provided in the present invention can be used as acute myocardial infarction AMI correlation
The risk of disease is estimated and is detected.Can discovery early suffer from the risk of acute myocardial infarction AMI, convenient for the prevention and treatment of early stage.
In order to facilitate it is clearer understand the contents of the present invention, be described in detail as follows now in conjunction with specific embodiment.
1 sample process of embodiment
1. receiving patients of acute myocardial infarction 31 and physical examination normal health compareing 27, extracted outside 5 mL using anticoagulant blood vessel
All blood finally takes upper plasma in the centrifuge tube of RNase/DNase-free in 4 DEG C of two step centrifugations of progress.
2. blood plasma total serum IgE extracts: use TRI Reagent extract RNA from blood plasma:
(1) crack: 0.75 mL TRI Reagent+0.25 mL serum acutely mixes；
(2) internal reference: the nematode cel-mir-39 of 50 pM synthesis is added into lysate, provides internal control for checking research
System；
(3) two-phase laminated flow: above-mentioned+0.2 mL chloroform of lysate stands 10 min after acutely mixing, 4 DEG C, 12000 g are centrifuged 10
min；
(4) RNA precipitate :+3 μ L glycogen of+0.6 mL isopropanol of aqueous layer precipitates a few hours；
(5) RNA:1 mL75% ethyl alcohol is cleaned, 4 DEG C, 12000 g are centrifuged 5 min；
(6) RNA dissolves: 10 μ L DEPC water are added and dissolve RNA.
2 Real-time PCR of embodiment detection
Use miRNA detection kit (including the reverse transcription reagent box, specificity miRNA of Japanese precious biotech firm (Takara)
Primer and probe, fluorescence quantitative detection kit etc.) detection serum in miR-26a-1, miR-146a and miR-199a-1 and
Object of reference miRNA(cel-mir-39) level, using the average value of result three times (Ct value) as the Ct value of specific miRNA.
The standardization of 3 data of embodiment
According to miR-26a-1, miR-146a, miR-199a-1 in the Sample serum measured and referring to miRNA(cel-mir-39)
Ct value.Using cel-mir-39 as reference, acquire relative amount of the specific miRNA in serum, with PCR detect in it is classical
2Δ CtMode indicate specific miRNA in serum level (Δ Ct be target miRNA with referring to cel-mir-39 Ct value it
Difference).As a result as shown in Figure 1 to Figure 3.It can be seen that the circulation miR- of acute myocardial infarction patients PCI perioperatively from Fig. 1 a
26a-1 expression illustrates that miR-26a-1 can be developed into diagnosis marker obviously higher than normal healthy controls.From Fig. 1 b
It can be seen that the circulation miR-146a expression of acute myocardial infarction patients PCI perioperatively is obviously higher than normal healthy controls,
Illustrate that miR-146a can be developed into diagnosis marker.It can be seen that acute myocardial infarction patients PCI operation consent from Fig. 1 c
Circulation miR-199a-1 expression afterwards illustrates that miR-199a-1 can be developed into diagnosis mark obviously higher than normal healthy controls
Will object.It can be seen that circulation miR-26a-1 analyzes AUC value in the preoperative ROC curve of PCI as diagnosis marker from Fig. 2 a
For 0.965(p < 0.001), illustrate as diagnosis marker accuracy rate with higher.It can be seen from figure 2d that circulation miR-
26a-1 is 0.939(p < 0.001 in the postoperative ROC curve analysis AUC value of PCI as diagnosis marker), illustrate as diagnosis
Marker accuracy rate with higher.It can be seen that recycling miR-146a as diagnosis marker in PCI operation consent from Fig. 2 b
ROC curve analysis AUC value be 0.911(p < 0.001), illustrate be used as diagnosis marker accuracy rate with higher.From Fig. 2 e
In it can be seen that circulation miR-146a as diagnosis marker PCI postoperative ROC curve analysis AUC value for 0.932(p <
0.001), illustrate as diagnosis marker accuracy rate with higher.It can be seen that circulation miR-199a-1 conduct from Fig. 2 c
Diagnosis marker is 0.855(p < 0.001 in the preoperative ROC curve analysis AUC value of PCI), illustrate have as diagnosis marker
There is higher accuracy rate.It can be seen that circulation miR-199a-1 is bent in the postoperative ROC of PCI as diagnosis marker from Fig. 2 f
Line analysis AUC value is 0.823(p < 0.001), illustrate as diagnosis marker accuracy rate with higher.It can from Fig. 3 a
When miR-26a-1, miR-146a, miR-199a-1 are used in combination as diagnosis marker out, in the preoperative ROC curve of PCI
Analysis AUC value is 0.913(p < 0.001), illustrate as diagnosis marker accuracy rate with higher.It can be seen that from Fig. 3 b
When miR-26a-1, miR-146a, miR-199a-1 are used in combination as diagnosis marker, in the postoperative ROC curve of PCI point
Analysis AUC value is 0.890 (p < 0.001), is illustrated as diagnosis marker accuracy rate with higher.
Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention., rather than its limitations；To the greatest extent
Pipe present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that: its according to
So be possible to modify the technical solutions described in the foregoing embodiments, or to some or all of the technical features into
Row equivalent replacement；And these are modified or replaceed, various embodiments of the present invention technology that it does not separate the essence of the corresponding technical solution
The range of scheme.
Claims (10)
1. application of following any one or more miRNA of (a)-(c) in the product that preparation is used for Diagnosing Cardiac disease:
(a) miR-26a-1；
(b) miR-146a；
(c) miR-199a-1.
2. application according to claim 1, which is characterized in that the nucleotide sequence of the miR-26a-1 such as SEQ ID
Shown in No.1, the nucleotide sequence of the miR-146a is as shown in SEQ ID No.2, the nucleotide sequence of the miR-199a-1
As shown in SEQ ID No.3.
3. application according to claim 1, which is characterized in that the product is reagent or kit.
4. application according to claim 1-3, which is characterized in that the heart disease is myocardial infarction, preferably
For acute myocardial infarction AMI.
5. a kind of reagent for Diagnosing Cardiac disease, which is characterized in that the reagent include following (A)-(C) any one or
Many kinds of substance:
(A) for detecting the primer of miR-26a-1；
(B) for detecting the primer of miR-146a；
(C) for detecting the primer of miR-199a-1.
6. a kind of kit for Diagnosing Cardiac disease, which is characterized in that the kit includes following (A)-(C) any one
Reagent described in kind or many kinds of substance or claim 5:
(A) for detecting the primer of miR-26a-1；
(B) for detecting the primer of miR-146a；
(C) for detecting the primer of miR-199a-1.
7. kit according to claim 6, which is characterized in that the kit further include reverse transcriptase, buffer,
dNTPs、MgCl2, DEPC water, Taq enzyme and DNA fluorescent dye and standard items and/or reference substance.
8. reagent according to claim 5, claim 6 or kit as claimed in claim 7, which is characterized in that
The primer for detecting miR-26a-1 has the upstream primer of the sequence as shown in SEQ ID No.4 and such as SEQ ID
The downstream primer of sequence shown in No.5；
The primer for detecting miR-146a has the upstream primer of the sequence as shown in SEQ ID No.6 and such as SEQ ID
The downstream primer of sequence shown in No.7；
The primer for detecting miR-199a-1 has the upstream primer of the sequence as shown in SEQ ID No.8 and such as SEQ ID
The downstream primer of sequence shown in No.9.
9. reagent according to claim 5, claim 6 or kit as claimed in claim 7, which is characterized in that institute
Stating heart disease is myocardial infarction, preferably acute myocardial infarction AMI.
10. a kind of following detection method of any one or more substance of (a)-(c), which is characterized in that institute's detection method includes:
It extracts sample rna and carries out fluorescent quantitation qPCR reaction, obtain the relative expression of any one or more substance of (a)-(c)
Amount；
(a)-(c) are as follows:
(a) miR-26a-1；
(b) miR-146a；
(c) miR-199a-1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910391352.7A CN110055322A (en) | 2019-05-12 | 2019-05-12 | For the circulation miRNA marker of Diagnosis of Acute Myocardial Infarction and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910391352.7A CN110055322A (en) | 2019-05-12 | 2019-05-12 | For the circulation miRNA marker of Diagnosis of Acute Myocardial Infarction and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110055322A true CN110055322A (en) | 2019-07-26 |
Family
ID=67322928
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910391352.7A Pending CN110055322A (en) | 2019-05-12 | 2019-05-12 | For the circulation miRNA marker of Diagnosis of Acute Myocardial Infarction and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110055322A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110982889A (en) * | 2019-09-16 | 2020-04-10 | 俞北伟 | Method for detecting early myocardial infarction by using miRNA-based nano fluorescence sensor |
| CN111411152A (en) * | 2020-05-13 | 2020-07-14 | 青岛大学 | Application of humanized circular RNA in preparation of heart disease related products |
| CN112852950A (en) * | 2021-02-23 | 2021-05-28 | 张步春 | Acute myocardial infarction biomarker and application thereof |
| CN113999901A (en) * | 2021-10-28 | 2022-02-01 | 中国医学科学院阜外医院 | Cardiac muscle specific methylation markers |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102481310A (en) * | 2009-05-20 | 2012-05-30 | 得克萨斯系统大学董事会 | Identification Of Micro-rnas Involved In Post-myocardial Infarction Remodeling And Heart Failure |
| CN103370424A (en) * | 2010-12-15 | 2013-10-23 | 米拉根医疗公司 | Blood-borne miRNA as surrogate markers of drug efficacy for cardiac conditions |
| CN103987858A (en) * | 2011-11-22 | 2014-08-13 | 英特芒尼公司 | Methods of diagnosing and treating idiopathic pulmonary fibrosis |
| CN107460241A (en) * | 2017-08-09 | 2017-12-12 | 深圳承启生物科技有限公司 | Application of the excretion body microRNA in acute myocardial infarction AMI risk assessment |
-
2019
- 2019-05-12 CN CN201910391352.7A patent/CN110055322A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102481310A (en) * | 2009-05-20 | 2012-05-30 | 得克萨斯系统大学董事会 | Identification Of Micro-rnas Involved In Post-myocardial Infarction Remodeling And Heart Failure |
| CN103370424A (en) * | 2010-12-15 | 2013-10-23 | 米拉根医疗公司 | Blood-borne miRNA as surrogate markers of drug efficacy for cardiac conditions |
| CN103987858A (en) * | 2011-11-22 | 2014-08-13 | 英特芒尼公司 | Methods of diagnosing and treating idiopathic pulmonary fibrosis |
| CN107460241A (en) * | 2017-08-09 | 2017-12-12 | 深圳承启生物科技有限公司 | Application of the excretion body microRNA in acute myocardial infarction AMI risk assessment |
Non-Patent Citations (2)
| Title |
|---|
| HAIFENG ZHANG，ET AL: "Qiliqiangxin Attenuates Phenylephrine-Induced Cardiac Hypertrophy through Downregulation of MiR-199a-5p", 《CELLULAR PHYSIOLOGY AND BIOCHEMISTRY》 * |
| 张瑞: "血液循环中与急性心肌梗死相关联miRNA的探索", 《中国博士学位论文全文数据库》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110982889A (en) * | 2019-09-16 | 2020-04-10 | 俞北伟 | Method for detecting early myocardial infarction by using miRNA-based nano fluorescence sensor |
| CN111411152A (en) * | 2020-05-13 | 2020-07-14 | 青岛大学 | Application of humanized circular RNA in preparation of heart disease related products |
| CN112852950A (en) * | 2021-02-23 | 2021-05-28 | 张步春 | Acute myocardial infarction biomarker and application thereof |
| CN112852950B (en) * | 2021-02-23 | 2024-04-12 | 安徽省立医院(中国科学技术大学附属第一医院) | Acute myocardial infarction biomarker and application thereof |
| CN113999901A (en) * | 2021-10-28 | 2022-02-01 | 中国医学科学院阜外医院 | Cardiac muscle specific methylation markers |
| CN113999901B (en) * | 2021-10-28 | 2023-07-21 | 中国医学科学院阜外医院 | Myocardial specific methylation markers |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110055322A (en) | For the circulation miRNA marker of Diagnosis of Acute Myocardial Infarction and its application | |
| CN107385035B (en) | Serum/plasma miRNA marker related to type 2 diabetes retinopathy and application thereof | |
| US8574838B2 (en) | Methods and kits for miRNA isolation and quantitation | |
| EP2718463B1 (en) | Complex sets of mirnas as non-invasive biomarkers for dilated cardiomyopathy | |
| CN108165623A (en) | The application of miRNA, product and detection method using it | |
| CN103160588B (en) | Atherosclerosis-related serum miRNA (microribonucleic acid) marker group, and specific primers and application thereof | |
| CN107130017B (en) | Kit and application of reagent in preparation of kit | |
| CN103805696A (en) | Micro RNA (Ribonucleic Acid) molecular marker for diagnosing rheumatoid arthritis and detection kit thereof | |
| US20180251837A1 (en) | Use of mirco-rnas circulating in the blood serum or blood plasma for identifying patients requiring a biopsy and as a marker for the differential diagnosis of individual non-ischemic cardiomyopathies or storage diseases | |
| CN107312852A (en) | Myocardial infarction diagnosis mark compositions | |
| CN107475363B (en) | Biomarker combination for non-small cell lung cancer, screening method of biomarker combination and application of biomarker combination | |
| CN106701962A (en) | Primer group, probe and kit for kawasaki disease detection | |
| CN111286536A (en) | Gene marker for diagnosing myocardial infarction and application thereof | |
| CN107460241B (en) | Application of exosome small-molecule RNA in acute myocardial infarction risk assessment | |
| CN105177147B (en) | Plasma marker, primer pair and kit for diagnosis of vascular calcification and application | |
| CN105177171B (en) | AKR1B10 is preparing the application in acute myocardial infarction AMI diagnosis and treatment preparation | |
| CN106191251A (en) | A kind of miRNAs heart failure mark and application thereof and heart failure primary dcreening operation detection kit | |
| CN107312851A (en) | Myocardial infarction biomarker miR 1283 | |
| CN115418397B (en) | Biomarker for auxiliary diagnosis of dilated cardiomyopathy and application thereof | |
| CN108410977B (en) | Ultra-early detection kit for serum miRNAs of alcoholic femoral head necrosis patient | |
| CN108220423A (en) | Acute myocardial infarction fast diagnosis reagent based on blood plasma miRNA and its application in diagnostic kit, appraisal procedure | |
| KR20220028416A (en) | MicroRNA biomarker for predicting drug response to diabetes treatment and use thereof | |
| WO2016133395A1 (en) | Circulating micrornas in patients with acute heart failure | |
| KR20220028418A (en) | MicroRNA biomarker for predicting drug response to diabetes treatment and use thereof | |
| CN107164546A (en) | MiRNA, composition and its application in diagnosing the illness |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190726 |
|
| WD01 | Invention patent application deemed withdrawn after publication |