CN110042123B

CN110042123B - Method for improving bovine somatic cell cloning efficiency through induction expression of zfp57

Info

Publication number: CN110042123B
Application number: CN201910307633.XA
Authority: CN
Inventors: 苏建民; 张涌; 张成图; 孙洪政; 陈永忠; 孟茹; 安全利; 程宇尧; 王勇胜; 权富生
Original assignee: Animal Husbandry And Veterinary Station In Xining City; Northwest A&F University
Current assignee: Animal Husbandry And Veterinary Station In Xining City; Northwest A&F University
Priority date: 2019-01-07
Filing date: 2019-04-17
Publication date: 2023-01-17
Anticipated expiration: 2039-04-17
Also published as: CN110042123A

Abstract

The invention discloses a method for improving bovine somatic cell cloning efficiency, which enables imprinted gene methylation in a bovine cloned embryo development process to restore normal level by inducing and expressing a zfp57 gene, thereby improving the bovine somatic cell cloning efficiency. The method for improving the cloning efficiency of the bovine somatic cells provided by the invention utilizes zfp57 to correct the hypomethylation of abnormal imprinted genes on the bovine cloned embryos, so that the methylation level of the abnormal imprinted genes reaches the level close to that of in vitro fertilized embryos, thereby improving the embryo quality of the bovine cloned embryos and promoting the development of the bovine cloned embryos; provides theoretical basis for clarifying the mechanism of methylation imprinting abnormality in the reprogramming process of somatic cell clone embryos and the reason of low somatic cell clone efficiency.

Description

Method for improving bovine somatic cell cloning efficiency through induced expression of zfp57

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a method for improving bovine somatic cell cloning efficiency by inducing expression of zfp57.

Background

Mammalian genes have two copies from the parents, and typically both copies are expressed. However, some genes of the genome are expressed as single alleles (monoallelic expression), and depending on the relative origins these genes only express alleles from one parent and not from the other. This type of gene is called the imprinted gene, and this non-mendelian inheritance phenomenon is called genomic imprinting.

There are three main methods for reprogramming somatic cells: nuclear transfer, pluripotency factor induction, and cell fusion, but the most mature method currently having the highest efficiency of reprogramming somatic cells is nuclear transfer. Somatic cell nuclear transplantation has important theoretical research value and production practice value, and can be applied to research such as therapeutic cloning, production of disease-resistant transgenic livestock, production of high-value medicinal protein, human organ transplantation, construction of disease models and the like. However, the efficiency of somatic cell cloning is still low, a large number of somatic cell cloned fetuses die in the stage of implantation or perinatal period, and cloned animals which survive birth also show various dysplasias, such as giant embryo disease and the like. Abnormal demethylation of imprinted genes commonly existing in the process of reprogramming somatic cell cloned embryos is an important reason for abnormal development of cloned animals and low efficiency of somatic cell cloning.

Therefore, how to protect the methylation of the imprinted gene in the development process of bovine cloned embryos so as to improve the cloning efficiency of bovine somatic cells is a problem to be solved urgently by the technical personnel in the field.

Disclosure of Invention

In view of the above, the present invention provides a method for improving bovine somatic cell cloning efficiency by inducing expression of zfp57.

In order to achieve the purpose, the invention adopts the following technical scheme:

a method for improving the cloning efficiency of bovine somatic cells is characterized in that the methylation of imprinted genes in the process of bovine cloned embryo development is restored to a normal level by inducing and expressing a zfp57 gene, so that the cloning efficiency of bovine somatic cells is improved.

Further, the method for improving the bovine somatic cell cloning efficiency is realized by the following steps:

(1) Construction of zfp57 expression vector

(1) Cloning of zfp57 gene:

designing an amplification primer Zfp57-KZ according to the CDS sequence of the Zfp57 gene; performing PCR amplification by using fetal bovine fibroblast cDNA as a template and Zfp57-KZ as a primer to obtain a Zfp57 gene;

(2) constructing a zfp57 expression vector:

the zfp57 gene is connected with a pMD-18T vector to obtain a plasmid pMD-18T-zfp57; carrying out double enzyme digestion, connection and transformation on the plasmids pMD-18T-zfp57 and pTRE3G-BI respectively to obtain an expression vector pTRE3G-BI-zfp57;

(2) Establishment of transgenic cell lines

(1) Co-transfecting fetal bovine fibroblasts with the expression vector pTRE3G-BI-zfp57 and an auxiliary vector, and screening monoclonal cells;

(2) carrying out PCR, real-time fluorescent quantitative PCR and immunoblotting detection on the obtained monoclonal cells;

(3) Detecting the influence of the expression zfp57 gene on the development of a bovine embryo;

(4) Detecting the influence of the expression zfp57 gene on the quality of bovine embryo blastula

(5) Detecting the influence of the expression of the zfp57 gene on the methylation level of the early-stage embryo imprinted gene of the cattle.

Further, the primer sequence of the amplification primer Zfp57-KZ is as follows:

Zfp57-KZ-F：GCCACCATGGAGCCTAGTCACCCTTGGTGGC；SEQ ID NO.2；

Zfp57-KZ-R：TCACTTATCGTCGTCATCCTTGTAATCTTTCCCTTCTAAGACCTTCATTGCC；SEQ ID NO.3；

wherein, the upstream primer is added with a Kozak sequence (GCCACC), and the downstream primer is added with a Flag sequence (CTTATCGTCGTCATCCTTGTATCATC).

Further, the auxiliary vector is pEF1alpha-Tet 3G.

Further, the zfp57 gene is applied to improving the cloning efficiency of bovine somatic cells.

According to the technical scheme, compared with the prior art, the invention discloses the method for improving the bovine somatic cell cloning efficiency, severe imprinting methylation loss exists on the bovine somatic cell cloned embryo, and zfp57 can correct abnormal imprinting gene hypomethylation on the bovine cloned embryo, so that the methylation level reaches the level close to that of the in vitro fertilized embryo, the embryo quality of the bovine cloned embryo is improved, and the development of the bovine cloned embryo is promoted; provides theoretical basis for clarifying the mechanism of methylation imprinting abnormality in the reprogramming process of somatic cell clone embryos and the reason of low somatic cell clone efficiency.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.

FIG. 1 is a schematic diagram of a Zfp57 gene PCR amplification band of the present invention;

FIG. 2 is a drawing showing the result of identifying expression vector pTRE3G-BI-zfp57 of the present invention;

wherein, M is 5000bp marker;1, empty vector pTRE3G-BI;2, plasmid pTRE3G-BI-zfp57;

FIG. 3 is the attached drawing showing the transgenic cells of the expression vector pTRE3G-BI-zfp57 of the present invention after transfection of 293T cells;

FIG. 4 is the attached drawing showing the transgenic cells of the expression vector pTRE3G-BI-zfp57 of the present invention after transfection of fetal bovine fibroblasts;

FIG. 5 is a graph showing the detection of the expression efficiency of the over-expressed cell line of the present invention;

KB, among these, blank control without plasmid transfection; NC, transfecting an empty vector without the target gene;

O1-O6, detecting over-expression efficiency of partial over-expression cell strains (O: overexpression);

FIG. 6 accompanying drawing is a qPCR identification of zfp57 expression levels in accordance with the present invention;

FIG. 7 is a drawing showing the immunoblot detection of monoclonal cells of the invention;

wherein, A, flag; b, internal reference beta-Actin; 1, transfecting an overexpression vector of a target gene; 2, transfecting the empty overexpression vector;

FIG. 8 is a drawing showing cloned bovine embryos of the present invention;

wherein, A, control IVF group; b, interference ZFP57-IVF group; c, a control clone group; d, ZFP57 clone panel;

FIG. 9 is a graph showing the rate of blastocyst apoptosis in accordance with the present invention;

wherein blastocyst apoptotic staining (TUNEL, green) and nuclear DNA (DAPI) were co-stained; the magnification is 40; a, control IVF group; b, interference ZFP57-IVF group; c, a control clone group; d, ZFP57 clone group;

FIG. 10 is a graphical representation of the CpG island prediction for bovine H19/IGF2ICR according to the invention;

FIG. 11 is a sequence information study of bovine H19/IGF2ICR of the present invention;

wherein, the bovine H19/IGF2ICR fragment (426 bp) is the sequence to be studied (upper strand) and the predicted DNA sequence after bisulfite conversion of the region (lower strand); yellow and underlined sequences are the primer sequence positions; cpG sites are marked with "+";

FIG. 12 is a graph showing the analysis of the methylation level of H19/IGF2ICR by the BSP method of the present invention

FIG. 13 is a graph showing the BSP method of the present invention for analyzing the methylation level of XISTICR;

FIG. 14 is a graph showing the analysis of the methylation level of IGF2R ICR by the BSP method of the present invention;

in FIGS. 12-14, circles on each horizontal strand indicate CpG sites within the study sequence, white and black circles representing unmethylated and methylated CpG, respectively; each horizontal cross-strand represents one sequenced clone; the circle string graph representing the BSP sequencing results of DNA methylation levels was automatically generated using BIQ Analyzer software; in each sample, methylation sites divided by all sites represent the level of DNA methylation of the gene on the sample; BS-PCR was repeated three times per sample.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be obtained by a person skilled in the art without making any creative effort based on the embodiments in the present invention, belong to the protection scope of the present invention.

pEF1alpha-Tet3G plasmid vector, pTRE3G-BI plasmid vector, 293T cell line and fetal bovine fibroblasts, were stored by the laboratory.

The SanPrep column type plasmid DNA small extraction kit, the DNA purification recovery reagent (Axygen) and the endotoxin-free plasmid extraction kit are purchased from Promega corporation; real-Time quantitative PCR (RT-qPCR) kit SYBR Premix Ex TaqTM (Perfect Real Time), reverse transcription kit PrimeScript RT reagentKit, purchased from TaKaRa company; BCA protein quantification kits were purchased from health as a century corporation; optiMEM, DMEM high-sugar medium, fetal bovine serum purchased from Invitrogen; fugeneHD transfection reagent was purchased from Roche; transZol Up, available from Transgene; flag antibody, beta-actin antibody, horseradish peroxidase-labeled goat anti-rabbit IgG (H + L) were purchased from petunia corporation.

Example 1 cloning of zfp57 Gene

The predicted sequence of the bovine zfp57 gene was searched using NCBI, the transcript sequence was copied, and the CDS sequence (SEQ ID NO. 1) was noted. The amplification primers (Zfp 57-KZ) were designed from the CDS sequence of Zfp57 using Primer5 Primer design software and a Kozak sequence (GCCACC) was added to the upstream Primer, followed by a Flag sequence (CTTATCGTCGTCATCCTTGTAAC) before the stop codon due to the lack of bovine ZFP57 protein antibody.

Wherein the sequence of the amplification primer Zfp57-KZ is as follows;

Zfp57-KZ-F：GCCACCATGGAGCCTAGTCACCCTTGGTGGC；SEQ ID NO.2；

Zfp57-KZ-R：TCACTTATCGTCGTCATCCTTGTAATCTTTCCCTTCTA

AGACCTTCATTGCC；SEQ ID NO.3。

the fetal bovine fibroblast cDNA was used as a template, zfp57-KZ was used as a primer, and the Zfp57 gene was amplified by PCR to obtain a 1713bp band, the result of which is shown in FIG. 1.

The PCR reaction system is as follows: template 2.5. Mu.L, upstream and downstream primers 0.5. Mu.L each, 2 XPrimeSTAR GC Buffer 25. Mu.L, dNTP Mixture 4. Mu.L, primeSTAR HS DNA Polymerase 0.5. Mu.L, ddH ₂ O17. Mu.L. PCR reaction parameters: 5min at 94 ℃; 30s at 94 ℃, 30s at 60 ℃ and 2min at 72 ℃; circulating for 40 times at 72 deg.C for 10min; the reaction was terminated at 4 ℃.

And carrying out gel recovery on the obtained PCR product to obtain a zfp57 gene fragment.

Example 2 construction of zfp57 Gene-inducible expression vector

1) The zfp57 gene fragment obtained in example 1 was ligated with pMD-18T vector

The connection reaction system is as follows: 5 mu L of zfp57 gene fragment, 4 mu L of Solution I and 1 mu L of pMD-18T vector; the sample was placed in a refrigerator at 4 ℃ overnight for ligation to obtain a ligated product.

2) Transformation of Escherichia coli Trans5 alpha competent cell by ligation product

(1) Taking 50 mu L of the competent cells melted on the ice bath, adding 5 mu L of the ligation product, gently mixing uniformly, and placing in the ice bath for 20min;

(2) Heat shock is carried out in 42 ℃ water bath for 60s, and the tube is rapidly transferred to an ice bath for 2min;

(3) Adding 500 μ L sterile LB culture solution into each 1.5ml EP tube on a clean bench, mixing, culturing at 37 deg.C and 200r/min for 1h, and recovering;

(4) Centrifuging for 4min at 4000r/min after recovery, discarding part of supernatant, reserving 100-200 mu L of bacterial liquid, uniformly mixing precipitates, uniformly coating the precipitates on an LB culture dish containing Amp +, inverting the dish after the bacterial liquid is dried, and culturing overnight in an electric heating constant temperature culture box at 42 ℃.

3) Screening of monoclonal colonies

Ampicillin-resistant monoclonals were picked on a clean bench and added to a culture medium containing 7mL of LB medium and 7. Mu.L of Amp ⁺ In a centrifuge tube, each dish was repeated 3 times, and the resulting mixture was placed on a constant temperature shaker for about 10-12h of scale-up (37 ℃ C., 200 r/min).

4) Extraction of plasmid pMD-18T-zfp57

6ml of the shaken bacterial solution is extracted into plasmids by a SanPrep column type plasmid DNA small extraction kit according to the following steps, and the plasmids are sequentially marked and numbered. Sucking 700. Mu.L of the shaken bacterial solution, and adding into 300. Mu.L of glycerol to preserve bacteria (-80 ℃ for storage). And sending the plasmid with the marked sequence number to Nanjing Kingsry company for sequencing, comparing sequences after obtaining sequencing feedback information, and selecting the plasmid pMD-18T-zfp57 without base mutation and base dislocation for subsequent experiments with a corresponding gene sequence Blast in NCBI.

5) Construction of expression vector pTRE3G-BI-zfp57

Carrying out double enzyme digestion on an expression vector pTRE3G-BI and a plasmid pMD-18T-zfp57 by using PstI and EcoRI respectively, carrying out electrophoresis and gel recovery on an enzyme digestion product, and connecting a target fragment of a zfp57 gene recovered by gel with the expression vector pTRE3G-BI subjected to double enzyme digestion. The ligation product was transformed into E.coli Trans 5. Alpha. Competent cells, a single clone having ampicillin resistance was selected to obtain a transformant, and the plasmid pTRE3G-BI-zfp57 was extracted.

The plasmid pTRE3G-BI-zfp57 is subjected to agarose gel electrophoresis, and an empty vector pTRE3G-BI is used as a control, so that the result shows that the empty vector pTRE3G-BI is smaller than the plasmid pTRE3G-BI-zfp57 by 1700bp, and the result is shown in figure 2, which indicates that the expression vector pTRE3G-BI-zfp57 is successfully constructed.

Example 3 transfection of 293T cells with the expression vector pTRE3G-BI-zfp57

1) Preparation of 293T cells, fetal Bovine Fibroblasts (FBFs)

(1) 293T cell resuscitation

The 293T cells were thawed immediately after being taken out from the liquid nitrogen tank in a 37 ℃ water bath, and 1mL of DMEM cell culture solution (preparation: 10.4g of DMEM dry powder, 3.7g of NaHCO) preheated at 37 ℃ was aspirated ₃ 100mL of fetal bovine serum, 1L of purified water is supplemented, filtered and subpackaged) into a 1.5mL centrifuge tube, 293T cells are added, centrifugation is carried out at 1000r/min for 5min, a supernatant is discarded, and 1mL of DMEM cell culture solution is added to blow up the cells. The suspended 293T cells were added to a 6cm cell culture dish (containing 3mL of cell culture solution and 3. Mu.L of penicillin and streptomycin double antibody), mixed well, and placed in CO ₂ And (5) culturing in a cell culture box. The addition of the double antibody can prevent bacterial contamination of the 293T cells which are just thawed.

(2) Passage of 293T cells

And (4) carrying out passage when 293T cells grow to 80-90% of the plate. Completely absorbing the culture solution in the culture dish, digesting with 300 μ L of 0.25% pancreatin cell digestive juice (0.25 g of trypsin powder, 0.02g of EDTA, adding 100mL of PBS without calcium and magnesium, stirring continuously until fully dissolved, filtering with 0.22 μm pore size filter membrane, subpackaging with small tubes, freezing at-20 deg.C for use) for 3min (the digestion time depends on different cells), adding 1mL of culture solution to stop digestion, absorbing the culture solution in the dish to 1.5mL of centrifuge tube, centrifuging at 1000r/min for 5min, discarding supernatant, adding 1mL of culture solution to suspend the cells, adding half of cell suspension to another 6cm cell culture dish (containing 3mL of cell culture solution and 3 μ L of double antibody), adding the rest cell suspension to 2 pores of 24 pore plate (containing 500 μ L of culture solution), mixing uniformly, placing in CO, and placing in ₂ And (5) culturing in a cell culture box.

The recovery and passage of fetal bovine fibroblasts refer to the recovery and passage step of 293T cells.

2) Expression vector pTRE3G-BI-zfp57 and helper vector co-transfect 293T cells

The inducible expression system consists of two vectors: the main vector and the auxiliary vector are selected to verify whether the zfp57 induction expression system is normally expressed in the 293T cell due to the fact that the 293T cell has high transfection efficiency. The auxiliary vector is an expression regulation vector and can express a transcription activation factor, and the transcription factor can change the conformation under the induction of Dox, so that the transcription factor is combined to a TRE sequence region of a reaction expression vector, and the expression of a downstream target gene zfp57 is further started.

The cell culture medium in the 24-well plate was changed 30min before transfection, and 500. Mu.L of complete culture medium per well; diluting 1 μ G main vector (expression vector pTRE3G-BI-zfp 57) and 1 μ G auxiliary vector (pEF 1 α -Tet 3G) with 50 μ L serum-free high-glucose DMEM, respectively, and gently blowing up and down to mix well; diluting 6 μ L Long Trans with 100 μ L serum-free high-glucose DMEM, and gently blowing and beating 3-4 times up and down; respectively adding 50 mu L of diluted Long Trans into the diluted main carrier and the diluted auxiliary carrier, and blowing and beating for 3-4 times up and down to fully mix; standing at room temperature for 10min.

Respectively adding 50 mu L of the main carrier and reagent mixed solution and the auxiliary carrier and reagent mixed solution into a 24-pore plate, and gently mixing uniformly; is placed in CO ₂ Culturing in an incubator. After 8h, DOX inducer (tetracycline analogue to make the target gene and resistance gene continuously express) is added to induce the target gene expression, and after 24h, GFP expression is observed. The results are shown in fig. 3, the transgenic cells express green fluorescence, which indicates that the zfp57 induced expression system can be normally expressed in eukaryotic cells.

EXAMPLE 4 selection of monoclonal cells after transfection

1) Cell prescreening

The well-conditioned FBFs were inoculated in 12-well plates at 7X 10/well ⁴ The cells are evenly tiled. The following day, medium was aspirated from the wells, washed once with PBS, and different G418 concentrations of selection medium, 100ug/ml, 400ug/ml, 500ug/ml, 700ug/ml, 800ug/ml, 900ug/ml, 1000 ug/ml, were added to each wellug/ml 12 well plates with different concentrations of G418 added were placed in CO ₂ Culturing in an incubator. The culture medium was changed every 3-5 days and G418 was added at different concentrations. The minimum G418 concentration capable of killing all cells within 10-14 days of screening is the optimal screening concentration. The optimal G418 selection concentration for the cells used in the present invention was finally determined to be 800ug/ml.

2) Plasmid transfection and screening of monoclonals

Well conditioned FBF cells were plated onto 4 6cm dishes one day before plasmid transfection, and each dish was seeded with 3X10 ⁶ And (4) cells. Cell electroporation was performed when the cells were confluent to 85% -95%.

The electrotransformation steps are as follows: when the cells grow to be full of 90 percent, the cells can be turned, culture solution is discarded, PBS is washed for 2 times, 300ul pancreatin is added, 3min in an incubator is added, 1ml of culture solution is added to stop digestion, centrifugation is carried out, discarding the supernatant, washing with Opti-MEM twice, adding 700ul electrotransfer solution and 6ug plasmid, standing for 10min, electric shocking (510V 2ms 1 times), standing for 15min, spreading to a new 6cm dish, adding 3ml fresh culture solution, and adding CO ₂ Culturing in an incubator.

When the overexpression vector is transfected, adding 10ug of each constructed main vector and auxiliary vector containing the target gene into the electrotransformation solution for incubation for 10min; meanwhile, the empty main carrier and the auxiliary carrier are added into the other electric rotating cup, and the incubation time is 10ug each for 10min as a control.

After incubation for 10min, each group was electroporated. After the electric transfer, the mixture was allowed to stand for 15min, and then the cell and plasmid mixture in the electric transfer cup was transferred to a 6cm dish, 3ml of DMEM culture solution was added, and the dish was gently shaken to uniformly spread the cells on the bottom of the dish. Is discharged to CO ₂ Culturing in an incubator. The next day, cells from 6cm dishes were transferred to 510 cm dishes, 8ml of culture medium was added to each dish, 64ul of G418 (concentration of 100 ug/ml) was added simultaneously to make the concentration of G418 800ug/ml in the culture medium, and the dishes were gently shaken up and down and left and right to distribute the cells evenly in the dishes. Each dish was labeled correspondingly. Is discharged to CO ₂ Culturing in an incubator.

The culture medium was changed every 3 days, and the growth and death of the cells were observed. Cell clones will appear on days 10-14. The transgenic cells express green fluorescence, and the cell clones show green fluorescence and are selected as a single clone of the cell shown in figure 4. Picking up the monoclonal cells according to the growth condition of the cell clone and the size of the clone.

3) Picking of monoclonal cells

After the cells are grown in a 10cm dish for 14 days after the electrotransfer, the size of the clone can meet the picking condition. The appropriate cell state and size of the monoclonal antibody was found under the microscope and circled with a marker to facilitate the subsequent picking process.

The culture medium was discarded, washed once with PBS and discarded, a drop of pancreatin was added to the circled monoclonal, the digestion of the cells was observed under a bench-top inverted microscope, and when most of the cells were trypsinized to a solid state, digestion was stopped by carefully adding 4ml of culture medium.

Taking a 48-well plate, and adding 400ul of DMEM culture solution into each well; placing the digested monoclonal cells under an inverted microscope to pick cell monoclonals; the picked cells were transferred to 48-well plates and labeled accordingly. When the cells grow over the 48-well plate, the cells are transferred to a 24-well plate, and when the cells grow over the 24-well plate, the positive cells are transferred to a 12-well plate, and then transferred to a 6-well plate.

4) PCR detection of monoclonal cells

When the selected monoclonal cells are subcultured to a 6-well plate, a small amount of the monoclonal cells in a good growth state are transferred to a sterile PCR tube, and the culture solution is discarded after centrifugation. Using a lysate (2X RIPA cell lysate: weighing 0.2416g of Tris base, 0.3505g of NaCl, 0.04g of SDS, 0.4g of sodium deoxycholate, and 18mL of ddH ₂ Stirring O fully until the O is dissolved completely, adding TritonX-1000.2mL, adding ddH ₂ O to 20mL, subpackaging by small tubes, and storing at-20 ℃ for later use), adding 10-20ul of lysate into each PCR tube, and lysing the cells at 15min at 65 ℃ and 5min at 95 ℃.

After lysis, cell lysate containing lysed cells is used as a template for PCR, and the insertion condition of the target fragment is detected. The PCR system was as follows: 1ul template, 0.6ul each of upstream and downstream primers (Zfp 57-KZ), 0.2ul HiFi DNA Polymerase, dNTP mix 2ul, hiFi buffer II 2ul, ddH ₂ O13.6 ul. PCR reaction parameters: 93min at 4 ℃; circulation is carried out for 35 times at 94 ℃ 30s,60 ℃ 30s and 72 ℃ 12 s; 2min at 72 ℃; the reaction was terminated at 4 ℃.

After the PCR is finished, the gel electrophoresis detects that 6 monoclonal cells have target bands. Marking 6 strains of positive cells which are stably integrated into a genome by a target fragment identified by PCR, and transferring the positive cells to a 12-hole plate for continuous culture; and (3) transferring the positive cells to a 6-well plate after the positive cells grow to fill the 12-well plate, then transferring the positive cells to a 6cm dish, transferring part of the positive cells to the 12-well plate after the positive cells grow to be full, and transferring the rest positive cells to the 6cm dish for continuous culture. Positive cloned cells in a 12-well plate are used for quantitative PCR detection, and cells in a 6cm dish are used for WesternBlot protein detection.

5) Quantitative PCR detection of monoclonal cells

Total RNA extraction is carried out on the positive clone cells in the 12-pore plate, and the serial numbers are respectively marked.

(1) The Trizol method is used for extracting cell total RNA and comprises the following steps:

(1) when the cells are 95% of the full pore area, adding about 500 mu L of Trizol, standing and cracking for 10min, and collecting the cells into a 1.5mL RNase-free centrifuge tube by using a pipette;

(2) adding 0.1mL of chloroform, tightly covering the cover, violently shaking for 15s, and standing for 2min at room temperature;

(3) centrifugation at 13000rpm for 15min (4 ℃ refrigerated centrifugation) with RNA in the uppermost aqueous phase; absorbing the water phase, putting into a new RNase-free EP tube, adding isopropanol with the same volume, turning upside down, mixing, and standing at 4 deg.C for 30min;

(4) centrifuging at 13000rpm for 10min (4 deg.C, freezing and centrifuging), completely removing supernatant, adding 1mL of RNase-free 75% ethanol into each 1mL of Trizol, and washing the precipitate by upside-down inversion;

(5) centrifuging at 7500rpm for 5min (refrigerated centrifugation at 4 deg.C), discarding the supernatant, naturally drying at room temperature for 5-10 min, adding 30 μ L of RNase-free ddH ₂ O dissolves the RNA and determines the concentration and 260/280, according to its concentration, reverse transcription.

(2) Reverse transcription of RNA

According to the instruction of the reverse transcription kit PrimeScript TM RT reagentKit of TaKaRa, the reverse transcription system is as follows: 5X PrimeScriptBuffer4. Mu.L, primeScript RT Enzyme Mix I1. Mu.L, random 6mers 1μL，RNA 1μL，RNase-free ddH ₂ O13. Mu.L. Reverse transcription program: 15min at 37 ℃; 5s at 85 ℃ and 5min at 4 ℃. The cDNA obtained was stored at-20 ℃.

(3) Real-time fluorescent quantitative PCR

Zfp57 quantitative detection primers (Zfp 57-DL) are designed according to Zfp57 whole gene sequences, and the primer sequences are as follows:

Zfp57-DL-F：GAAACAGTGGGAAGCGGATC；SEQ ID NO.4；

Zfp57-DL-R：ACAGTCCCCTCATCTCCCA；SEQ ID NO.5。

the Real-Time PCR was carried out using SYBR Premix Ex Taq (Perfect Real Time) kit (TaKaRa Co., ltd.), and the reaction system was prepared according to the kit instructions. Each sample was repeated 3 times. After the loading, real time PCR reaction was performed using Steponeplus real-time quantitative PCR instrument manufactured by applied biosystems.

The reaction procedure was as follows: 30s at 95 ℃;95 ℃ for 5s,60 ℃ for 30s; and circulating for 40 times. After the reaction was completed, the relative expression level of the target gene was calculated by the 2-. DELTA.DELTA.cT method, and the results are shown in FIG. 5.

And selecting the 4 th monoclonal cell strain with the highest expression quantity, and carrying out expanded culture. Control cells (con) and monoclonal cells overexpressing zfp57 were extracted with TRIZOL and the results are shown in fig. 6, with qPCR results showing a significant rise in zfp57 mRNA levels.

6) Immunoblot detection of monoclonal cells

(1) Extraction of proteins

(1) Absorbing DMEM cell culture solution completely, adding 300 mu L of pancreatin for digestion for 2min, adding the cell culture solution with the same volume to stop digestion, and subpackaging into 1.5mL centrifuge tubes;

(2) centrifuging at 1000r/min for 5min, discarding the supernatant, blowing and suspending with 500 μ L PBS, centrifuging at 300g for 5min, discarding the supernatant, adding 100-200 μ L cell lysate (containing protease inhibitor), and performing ice bath lysis for 15min;

(3) centrifuging at 12000r/min for 20min at 4 deg.C, collecting supernatant, adding 2 xSDS gel sample buffer solution with the same volume as cell lysate, and boiling in water bath at 95-100 deg.C for 10min;

(2) Protein quantification

(1) Taking 50 mu L of supernatant after the lysis in the previous step, and diluting the supernatant by 10 times by using cell lysate;

(2) taking 20 mu L of each of 4 samples (including a blank control) on a detachable enzyme label plate;

(3) BCA reagent a and BCA reagent B mixtures (1, 50, total 180 μ L) were added to each well and incubated at 37 ℃ for 30min;

(4) and measuring the OD value of each sample by a micro-liquid measuring instrument.

(3) SDS-polyacrylamide gel electrophoresis

(1) Assembling an SDS-PAGE electrophoresis device, and preparing two rubber plates, wherein one rubber plate is used for reference control, and the other rubber plate is used for detection;

(2) fixing the gel, putting the gel into an electrophoresis tank, pouring electrophoresis Buffer solution into the electrophoresis tank, adding sample by using a micro liquid inlet device, adding 5 mu L of Blue Plus II Protein Marker, adding 25-30 mu L of sample into a detection sample, adding 5 mu L of internal reference correspondingly, and filling up the shortage by using 1 × Loading Buffer;

(3) after the sample adding is finished, the electrophoresis is started, the voltage is adjusted to 85V when the gel is concentrated, when Marker starts to separate the gel, the sample enters the separation gel, and the voltage is increased to 120V for continuous electrophoresis; the electrophoresis was stopped when bromophenol blue was found to run out of the gel.

(4) Rotary film

(1) Soaking the PVDF membrane in methanol for 1-2 min before use, then soaking in pre-cooled membrane-transferring buffer solution, and sequentially placing the cut gel from the negative electrode to the positive electrode according to the sponge, the filter paper, the gel, the PVDF membrane, the filter paper and the sponge;

(2) electrophoresis was performed for 2.5h at 0.25A after assembly of the film transfer device, and the process was performed in an ice box.

(5) Sealing of

Putting the PVDF membrane into 100g/L skimmed milk powder TBST sealing solution, and sealing for 3h in a low-speed shaking table.

(6) Antibody incubation and development

(1) Primary antibodies were diluted with 50g/L skim milk powder (Flag antibody 1, β -actin antibody 1; incubating overnight at 4 deg.C, washing with TBST on a low speed shaker for 3 times for 10min each time;

(2) HRP-labeled goat anti-rabbit IgG was purified using 50g/L skim milk powder 1: diluting with 1000, uniformly dropwise adding onto PVDF membrane, incubating at room temperature for 2h, washing with TBST at low speed for 10min for 3 times;

(3) pouring out the TBST, uniformly mixing the luminescent liquid A and the luminescent liquid B by 1mL each, uniformly dripping the mixture on a film in a dark room, and exposing for 3 s-4 min;

(4) putting into developing solution for more than 30s, and then putting into washing solution for cleaning; putting the film in a fixing solution until the film is transparent, and then washing the film clean.

The results of the detection are shown in FIG. 7.

Example 5 Effect of expression/interference of zfp57 on embryonic development

Using normal cell strain (contrast clone group) and ZFP57 transgenic cell strain (ZFP 57 clone group) as karyon, making somatic cell nuclear transplantation to obtain early-stage developed bovine somatic cell clone embryo; in-vitro fertilization is carried out by using bovine sperms and oocytes in two batches, wherein one batch is a control IVF group (injected by using control siRNA which has no interference effect on ZFP57 gene), and the other batch of oocytes are injected by using ZFP57siRNA interference small-fragment ZFP57-1580 to obtain in-vitro fertilization embryos (interference ZFP57-IVF group); the results are shown in FIG. 8.

Wherein, the sequence of the ZFP57siRNA interference small fragment ZFP57-1580 is as follows:

ZFP57-1580:GCAGAAGAAAGAAAGCAAAGG；SEQ ID NO.6。

as in table 1, the cleavage rates of the interfering ZFP57-IVF group embryos were significantly lower than those of the other three groups (P < 0.05), with no significant difference in cleavage rates. The interfering ZFP57-IVF group blastocyst rate at day 7 is also significantly lower than the control IVF group blastocyst rate (P < 0.05), while the ZFP57 clone group has a significantly higher blastocyst development rate at day 7 than the control clone group (P < 0.05). The induction expression of ZFP57 can obviously improve the development rate of cloned blastocysts at 7 days (P < 0.05), and the difference with the control IVF group is not significant.

TABLE 1 Effect of expression/interference of zfp57 on embryonic development

Note: the embryo development rate (mean ± sem%) is in brackets, the other numbers are the total number of oocytes or embryos in ten replicates. Cleavage rate and blastocyst rate are the embryo development rates at the second and seventh days of statistical development, respectively. The superscripts within the same group showed significant differences (P < 0.05).

In order to research whether the induction expression of zfp57 can improve the in vivo development and the birth rate of the cloned bovine embryo,

and transplanting blastula of a recipient cow on the seventh day of the control clone group and the ZFP57 clone group into 62 and 78 recipient cows respectively. The results are shown in table 2, the pregnancy difference was not significant between the two groups at 40d after the cloned embryo transfer. But from 90d, the pregnancy rate of the ZFP57 clone group embryos was significantly higher than the control clone group (P < 0.05). The control group had 2 calves surviving, while the ZFP57 clone had 8 surviving (P < 0.05). The result shows that the induction expression of zfp57 obviously improves the cloning efficiency of bovine somatic cells.

TABLE 2 Induction expression of zfp57 to improve bovine somatic cloning efficiency

Note: and (4) transplanting recipient cattle in the same estrus to the 7 th blastocyst, wherein each recipient cattle is transplanted with one embryo.

^a,b (P<0.05 Data in the same column are labeled with different representations that differ significantly from one another.

Example 6 Effect of expression/interference of zfp57 on bovine embryo blastocyst quality

The present invention analyzes the total number of embryonic cells, the number of TE cells, the number of ICM cells, and the ratio of the number of ICM cells to the total number of blastocysts (ICM/TCN) for each group of blastocysts. The results (table 3) show that the total number of embryos, TE cells, ICM cells, and the ratio of the number of ICM cells to the total number of blastocysts (ICM/TCN) interfering with the blastocysts at day 7 in the ZFP57-IVF group are all significantly lower than the control IVF group embryos (P < 0.05), while the total number of embryos, TE cells, ICM cells, and the ratio of the number of ICM cells to the total number of blastocysts (ICM/TCN) interfering with the blastocysts at day 7 in the ZFP57 cloning group are all significantly higher than the control cloning group embryos (P < 0.05).

TABLE 3 different groups of day 7 blastocyst analysis

Note: total blastocyst cell number was analyzed by analyzing all nuclei on DAPI-stained embryos, TE cell number was analyzed by immunostaining CDX2, ICM cell number = total blastocyst cell number-TE cell number. Data are expressed as mean ± sem.

The difference in the a, b, c superscripts indicates significant differences between samples (P < 0.05).

The rate of apoptosis is another criterion for assessing embryo quality. The blastocysts of each group were subjected to apoptosis staining, and the results are shown in fig. 9, and the apoptosis rates of the blastocysts were counted. The apoptosis rate of blastocysts at day 7 in interfering ZFP57-IVF group and control clone group is significantly higher than that in vitro fertilization control group and ZFP57 clone group (P < 0.05).

Example 7 Effect of expression/interference of zfp57 on methylation levels of bovine early embryonic blot genes

The blot genes XIST, H19/IGF2 and IGF2R were analyzed for their ICR region methylation levels on each group of embryos. In the case of H19/IGF2ICR, the selected region of interest must be located in the ICR region of the methylation difference region and contain the specific recognition site "TGCCGC" for the KAP1/ZFP57 protein complex. CpG islands were predicted between H19 and IGF2 using MethPrimer online software, and 4 CpG islands were found in the range of about 2.5kb to 4kb upstream of H19 (FIG. 10), and the fourth CpG island had a CTCF recognition site on ICR (bold red in FIG. 11), which was the ICR region. This region contains the KAP1/ZFP57 protein complex specific recognition site "TGCCGC" (bold blue in FIG. 11). Specific primers for BS-PCR were designed using MethPrimer and methyl primer express software _ v1.0 (ABI, USA) software. 426bp of this ICR region was used as a study fragment of the H19/IGF2ICR of the present invention, which contained 23 CpG sites. The primer sequence is as follows:

F:5’-GGAGTTTGGGTGAGGTATAGTTTTAG-3’；SEQ ID NO.7；

R:5’-CCAAACATAAAAATCCCTCATTATC-3’；SEQ ID NO.8。

H19/IGF2ICR is a fully methylated modification on sperm, while there is little methylation modification on oocytes. The methylation level of the embryo (SCNT-C) of the control clone group at the 2-cell stage and the blastocyst stage is obviously lower than that of the embryo (IVF-C) of the control IVF group, which indicates that the H19/IGF2ICR has the problem of print loss. The level of interfering H19/IGF2ICR methylation of the embryos in ZFP57-IVF group (IVF-T) 2 cell stage is significantly lower than that of the control IVF group (IVF-C) (P < 0.05). The DNA methylation level of H19/IGF2ICR induced to express zfp57 clone group (SCNT-T) embryos was significantly higher at the blastocyst stage than that of control clone group embryos (SCNT-C) (P < 0.05), and the methylation level was not significantly different from that of control IVF group embryos, as shown in FIG. 12.

XIST has few methylation modifications on sperm, but very hypermethylation modifications on oocytes. The methylation level of XIST at 4-cell stage and blastocyst stage of embryo in control clone group (SCNT-C) is significantly lower than that of embryo in control IVF group (IVF-C), which indicates that XIST has the problem of blot loss. The level of methylation in interfering ZFP57-IVF group (IVF-T) embryos at XIST 4 cell stage was significantly lower than control IVF group embryos (IVF-C) (P < 0.05). XIST induced to express zfp57 clone group (SCNT-T) embryos showed significantly higher DNA methylation levels at the 4-cell and blastocyst stages than the control clone group embryos (SCNT-C) (P < 0.05), and did not significantly differ from the control IVF group embryos, as shown in FIG. 13. The results of the study indicate that induction of zfp57 corrects aberrant methylation loss in cloned embryos.

Like XIST, IGF2R ICR has little methylation modification on sperm, but is hypermethylated on oocytes; the methylation level of IGF2R ICR on 4-cell stage cloned embryos (SCNT-C) is significantly lower than that of in vitro fertilized embryos (IVF-C), which indicates that the IGF2R ICR also has demethylation phenomena on bovine cloned embryos to different degrees; interference with methylation level of IGF2R ICR of ZFP57-IVF group 4-cell stage embryos (IVF-T) was significantly lower than control IVF group embryos (P < 0.05), while induction of methylation level of DNA of IGF2R ICR expressing ZFP57 clone group embryos (SCNT-T) was significantly higher than control clone group embryos (SCNT-C) both at 4-cell stage and at blastocyst stage (P < 0.05), with no significant difference in methylation level from control in vitro fertilization group embryos, as shown in fig. 14.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Sequence listing

<110> animal husbandry and veterinary station of Xining City of northwest agriculture and forestry science and technology university

<120> a method for improving bovine somatic cell cloning efficiency by inducing expression of zfp57

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1683

<212> DNA

<213> Artificial Sequence

<400> 1

atggagccta gtcacccttg gtggccagac caggcatgga taaagcttaa aagagacagc 60

atggaagaga aggtgtctga ccagccaaag ccagtggaac ctgtacagaa gctgctccct 120

caggtggacg aggagggtct gccgaaagcc tggaagggag agtgctggtg gaaggagtgg 180

gtgaagaagc cagtcacctt tgaggatgtg gcagtaaact tcacccagga agagtggaaa 240

tgtctagatg tcagtcagag ggtcctctac caggatgtta tatcagagac tgtcagaaac 300

ctgatgtctg tggatctgat cgccaagctt gagcaagaag agaaacagtg ggaagcagat 360

ctctgttccc cgaatggaga aggctttcat tcaggaggca aggaggaaag ccaagaacag 420

agtcagagtt tgggagatga ggggactgtt gatgacaaga aggcctccct tgctcacaga 480

ggcttgggcc caacctctcc tccagctggg tccccggaca agacgccaac attgccagaa 540

tcctgggctc ggccagcctt tacctgtcac acctgtggca agtgcttcag caagcgctcc 600

agcctctaca accatcagct tgttcacaac agcgcccagt gtgggaagtc cttccagaac 660

cccaaggacc tcagctccgg ccggcgcaag caacccaggg aaaggccctt ccgctgctcg 720

ctctgtggca agacctactg cgatgcttct ggactgagcc gtcaccgccg tgtccatctg 780

ggctaccggc cccatgcgtg ccctttctgt gggaagtgct tcagggacca gtctgagctc 840

aaacgccacc agaagacgca ccaaggccag aagctggggg ctggaaacca gaagcatatt 900

gtgaggactc cggataccag agctggatta cagggcctgg caacagggaa ccatgcagca 960

gtggctgtga cccaaggacc cacacttaaa accaagggtc ccaagactca gccccagccg 1020

tcaatagaca ggaaccaggt acctgccacc aagaacatgg taatcactgt gagagctcag 1080

gccccagagc ctgtgaccag gaccccagcc ccagagcctg tgaccaggac cccagcccca 1140

gagcctgtga ccaggaccct ggcagccaac atgcgagcta ctcgcctgaa caccaagtcc 1200

aactctcacc cagagaagcc ttcaagactc aaggtcttct cttgccctca ttgtccctta 1260

acttttagca ggaaaacccg tctctccagt catcagaagg tccactacac agagcagtcc 1320

aaccgctgct tccactgtgg caagtccttc actttattct ccgggctgat ccggcaccag 1380

cagactcact ggaagcagag ggtctactgt tgccctatat gcgacgtctg ctttggggag 1440

aaagaggacc ttttgggtca ctgggggggc tacagaagca aggggctatt cctgggcagt 1500

ccccacaagt gctgggccat cctgggtcag tggcttggct tctttcccaa tgcctctgct 1560

gtggcaggga aggaaatgga tctttctcct ggatccagac cctcaggaaa ggggaggaag 1620

ggagaggaaa aggcacgcag aagaaagaaa gcaaaggcaa tgaaggtctt agaagggaaa 1680

tga 1683

<210> 2

<211> 31

<212> DNA

<213> Artificial Sequence

<400> 2

gccaccatgg agcctagtca cccttggtgg c 31

<210> 3

<211> 52

<212> DNA

<213> Artificial Sequence

<400> 3

tcacttatcg tcgtcatcct tgtaatcttt cccttctaag accttcattg cc 52

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 4

gaaacagtgg gaagcggatc 20

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 5

acagtcccct catctccca 19

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 6

gcagaagaaa gaaagcaaag g 21

<210> 7

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 7

ggagtttggg tgaggtatag ttttag 26

<210> 8

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 8

ccaaacataa aaatccctca ttatc 25

Claims

1. A method for improving the cloning efficiency of bovine somatic cells, which is used for non-treatment purposes, is characterized in that the method enables the methylation of imprinted genes in the development process of bovine cloned embryos to be restored to a normal level by inducing and expressing a zfp57 gene, so that the cloning efficiency of the bovine somatic cells is improved; the method comprises the following specific steps:

(1) Construction of zfp57 expression vector

(1) Cloning of zfp57 gene:

the primer sequence of the amplification primer Zfp57-KZ is as follows:

Zfp57-KZ-F：GCCACCATGGAGCCTAGTCACCCTTGGTGGC；SEQ ID NO.2；

wherein, the upstream primer is added with a Kozak sequence, and the downstream primer is added with a Flag sequence;

(2) constructing a zfp57 expression vector:

(2) Establishment of transgenic cell lines

(1) Co-transfecting fetal bovine fibroblasts with the expression vector pTRE3G-BI-zfp57 and an auxiliary vector, and screening monoclonal cells; the auxiliary vector is pEF1alpha-Tet 3G;

(2) carrying out PCR, real-time fluorescence quantitative PCR and immunoblot detection on the obtained monoclonal cells;

(3) Detecting the influence of the expression zfp57 gene on the development of the bovine embryo;

(4) Detecting the influence of the expression zfp57 gene on the quality of bovine embryo blastula;

(5) And detecting the influence of the expression of the zfp57 gene on the methylation level of the early-stage embryo imprinted gene of the cattle.

The application of zfp57 gene in improving the cloning efficiency of bovine somatic cells for non-therapeutic purposes.