CN109929843B - Use of MAGI-1 missense mutation (P.W845R) in renal podocyte function - Google Patents
Use of MAGI-1 missense mutation (P.W845R) in renal podocyte function Download PDFInfo
- Publication number
- CN109929843B CN109929843B CN201910164389.6A CN201910164389A CN109929843B CN 109929843 B CN109929843 B CN 109929843B CN 201910164389 A CN201910164389 A CN 201910164389A CN 109929843 B CN109929843 B CN 109929843B
- Authority
- CN
- China
- Prior art keywords
- cell
- renal
- sirna
- magi1
- group
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The present application relates to the use of MAGI-1 missense mutations (P.W845R) in renal podocyte function. The application relates to the influence of MAGI1 siRNA intervention on MAGI1 expression and renal podocyte function, including cell viability, apoptosis rate, cell adhesion capacity, cell expansion capacity and other aspects. The apoptosis model of the kidney podocyte induced by the intervention of the MAGI1 siRNA has good cell model conditions, and lays an experimental foundation for the deep research of kidney-related diseases and medicines for resisting the apoptosis of the kidney podocyte.
Description
Technical Field
The invention relates to the field of biomedicine, in particular to application of MAGI-1 missense mutation (P.W845R) and related siRNA in renal podocyte function and construction of an MAGI-1 mutant renal podocyte apoptosis model.
Background
The kidney is one of the most important organs of the human body, and the main physiological function is to eliminate in-vivo metabolites, excessive substances and toxicants entering the body and the like by generating urine, and simultaneously retain water and other useful substances through a reabsorption function so as to realize the regulation of body fluid, electrolytes and acid-base balance and maintain the stability of the internal environment of the body.
The kidney podocyte, namely the epithelial cell of the renal capsule visceral layer, is an important component for maintaining the normal structure and function of the glomerular filtration barrier, and plays an important role in maintaining the permeability of the glomerulus and resisting the hydrostatic pressure of fluid in a capillary cavity. Hypertension, diabetes, nephrotoxic drugs, primary glomerulonephritis, tumors and other factors can cause damage to renal podocytes. Since podocytes are highly differentiated terminal cells, they are hardly reproducible once deleted. Progressive damage to podocytes is lost, resulting in the integrity of the glomerular filtration membrane being compromised, resulting in proteinuria, which in turn further exacerbates podocyte damage. The resulting vicious circle can eventually lead to development of glomerulosclerosis, affecting kidney function, and causing Chronic Kidney Disease (CKD).
As CKD progresses, the renal function of the patient will further decline and progress to chronic renal failure, eventually leading to End Stage Renal Disease (ESRD), placing a heavy burden on the family and society. Through a cross-sectional study of 47204 adults in China, the number of CKD patients is about 10.8%, which is equivalent to about 1.2 million adults in China with varying degrees of CKD. Clinically, various possible treatment methods are adopted aiming at the pathogenesis, including controlling blood pressure, blood sugar and blood fat, inhibiting inflammation, regulating immunity, strictly controlling protein intake, reducing proteinuria and the like through medicine intervention, and the progress of kidney diseases is delayed as far as possible. However, due to the inconsistent response of the treatment, some patients continue to progress, and the renal function is progressively reduced, which finally leads to end-stage renal disease.
In recent years, animal models of kidney disease have been reported in domestic and foreign literature. With the continuous improvement of the technical method, the induced kidney disease model is mature day by day, and the human chronic kidney disease model can be better simulated no matter at the animal or cell level. However, no more systematic and exhaustive reports on the model of inducing apoptosis of renal podocytes by MAGI-1 mutation have yet been made. Therefore, the application of the MAGI-1 missense mutation (P.W845R) in the function of the renal podocyte is discussed mainly through the influence of the MAGI-1 missense mutation (P.W845R) on the aspects of the renal podocyte activity, the protein expression, the apoptosis rate, the cell morphology and the like, and the experimental basis is laid for the deep research of renal related diseases and the medicine for resisting the renal podocyte apoptosis.
Disclosure of Invention
The invention provides siRNA, wherein the nucleotide sequence of a sense strand of the siRNA is selected from SEQ ID NO: 1. 3, 5, 7, the nucleotide sequence of the antisense strand thereof is selected from SEQ ID NO: 2. 4, 6 and 8.
The invention provides a siRNA, wherein the nucleotide sequences of a sense strand and an antisense strand of the siRNA are selected from the following groups: SEQ ID NO: 1 and 2, SEQ ID NO: 3 and 4, SEQ ID NO: 5 and 6, SEQ ID NO: 7 and 8.
In one aspect, the nucleotide sequences of the sense and antisense strands of the siRNA are selected from the group consisting of SEQ ID NOs: 5 and 6.
The invention provides a carrier, which comprises the siRNA.
In one aspect, the vector is selected from a plasmid, liposome, virus, or other suitable type of vector; preferably, the plasmid is selected from the group consisting of eukaryotic plasmids; the liposome is selected from lipofectamin; the virus is selected from lentivirus or retrovirus.
The invention provides a cell model which comprises the siRNA or the carrier.
In one aspect, the cell is selected from a renal podocyte; preferably, the cell is selected from a human kidney podocyte or a murine kidney podocyte; more preferably, the cells are selected from MPC5 cells.
The invention provides a preparation method of a cell model, which comprises the following steps: introducing said siRNA, or said vector, into a host cell.
In one aspect, the cell is selected from a renal podocyte; preferably, the cell is selected from a human kidney podocyte or a murine kidney podocyte; more preferably, the cells are selected from MPC5 cells.
The invention provides a pharmaceutical composition, which comprises the siRNA, the carrier or the cell model and pharmaceutically acceptable auxiliary materials.
The invention provides application of the siRNA, the vector or the cell model in preparing a system for screening a medicament for treating a kidney-related disease.
In one aspect, the kidney-related disorder is selected from a kidney podocyte apoptosis-related disease.
The invention provides a system for screening a medicament for treating kidney-related diseases, which comprises the siRNA, the carrier or the cell model.
In one aspect, the kidney-related disorder is selected from a kidney podocyte apoptosis-related disease.
The present invention provides a method of screening for a drug for treating a kidney-related disorder, comprising: contacting the medicine for resisting the apoptosis of the renal podocyte with the cell model, and screening the medicine capable of inhibiting the apoptosis of the cell model or promoting the growth of the cell model.
The positive effects of the invention include: the siRNA of the invention has a targeting relation with the MAGI-1 gene and can participate in missense mutation (knocking-down) of the MAGI-1 gene, wherein the siRNA has the sequence shown in SEQ ID NO: the siRNA of 5 and 6 has the best interference effect on MAGI-1. However, the expression of Nephrin, JAM4, Rap1, P-Cadherin, actin 4 and podocin in renal podocytes had no or slight effect. Under the influence of MAGI1 siRNA, the activity of kidney podocyte is reduced, the apoptosis rate is obviously increased, the cell adhesion capability is obviously reduced, and the cell expansion capability is obviously reduced. The present invention discusses the effect of MAGI-1 missense mutation (P.W845R) on renal podocyte function. And the apoptosis model of the kidney podocyte induced by the intervention of the MAGI1 siRNA has good cell model conditions, and lays an experimental foundation for the deep research of kidney-related diseases and medicines for resisting the apoptosis of the kidney podocyte.
Drawings
FIG. 1: results of screening for MAGI1 siRNA.
FIG. 2: results of mRNA expression measurements for each group of cells. Note: denotes p < 0.05.
FIG. 3: expression of each group of cellular proteins.
FIG. 4: and (5) detecting the activity of each group of cells. Note: denotes p < 0.01.
FIG. 5: and (3) detecting the apoptosis of each group of cells. Note: denotes p < 0.01.
FIG. 6: results of immunofluorescence staining of each group of cells MAGI1 and Nephrin.
FIG. 7: results of immunofluorescent staining of cells of each group MAGI1 and JAM 4.
FIG. 8: immunofluorescence staining results for each group of cells.
FIG. 9: results of cell adhesion measurements for each group. Note: denotes p < 0.01.
FIG. 10: results of cell spreading measurements for each group. Note: denotes p < 0.01.
Detailed Description
The test materials used in the following test methods are readily available from commercial companies unless otherwise specified. Many modifications may be made to the present invention by those skilled in the art in conjunction with the well-known techniques without departing from the spirit of the invention, and such modifications are intended to be within the scope of the present invention.
Example 1 Experimental model of Effect of MAGI-1 on renal podocyte function following knockdown
Design of MAGI1 siRNA
Second, grouping experiments
A. Normal group: MPC5 cells.
B. Blank interference group: MPC5 cells + Scambred siRNA group.
C. MAGI1 interference group: MPC5 cells + MAGI1 siRNA1 group.
D. MAGI1 interference group: MPC5 cells + MAGI1 siRNA2 group.
E. MAGI1 interference group: MPC5 cells + MAGI1 siRNA3 group.
F. MAGI1 interference group: MPC5 cells + MAGI1 siRNA4 group.
III, cell culture
MPC5 cells were first plated at 33 ℃ with 5% CO2Carrying out enrichment culture in an incubator; when the fusion state of MPC5 cells reaches 50% -70%, the cells are replaced by a 37 ℃ culture medium and placed at 37 ℃ with 5% CO2And carrying out differentiation culture for 7-10d in an incubator, and carrying out subsequent experiments after cell synchronization.
Fourth, cell transfection
1. MPC5 cells in good growth state were collected at 5X 105Inoculating to six-well plate at 37 deg.C and 5% CO2Cell culture box 24 h.
2. After the cells adhere to the wall, preparing a transfection reagent according to the transfection procedure of the Lipofectamine 2000 kit: one EP tube (tube A) was diluted with 250. mu.L of Opti-MEM to 5. mu.L of Lipofectamine 2000 and allowed to stand at room temperature for 5 min; one EP tube (B tube) was diluted with 10. mu.L of siRNA (stock concentration 10. mu.M) with 250. mu.L of Opti-MEM.
3. Evenly mixing A, B two tubes of solution, and standing for 20min at room temperature; the siRNA-Lipofectmine 2000 mixture was added to a 6-well plate containing 1.5mL of complete medium.
4. The medium was changed 4-6h after transfection.
Fifth, experimental results
FIG. 1 shows the results of the screening for MAGI1 siRNA. The results show that all 4 pieces of MAGI1 siRNA have certain interference effect, wherein the interference effect of MAGI1 siRNA3 and MAGI1 siRNA1 is the best, so MAGI1 siRNA3 and MAGI1 siRNA1 are selected for subsequent experiments. Sixth, MAGI1 siRNA experiment regrouping
The number and experimental grouping of the MAGI1 sirnas were redetermined from the above experimental results. The method comprises the following specific steps:
A. normal group: MPC5 cells.
B. Blank interference group: MPC5 cells + Scambred siRNA group.
C. MAGI1 interference group: MPC5 cells + MAGI1 siRNA1 group.
D. MAGI1 interference group: MPC5 cells + MAGI1 siRNA2 group.
Example 2 qRT-PCR detection of renal podocyte function Effect experiments
Sample processing
1. MPC5 cells were collected, added to 1mL Trizol, transferred to an EP tube and shaken for 5 min.
2. Adding chloroform (200 μ L), shaking until emulsification, and standing at room temperature for 5 min; centrifuging at 12000g and 4 ℃ for 15 min; the lysate was divided into three layers and the colorless supernatant was pipetted into a new EP tube.
3. And (3) isopropanol precipitation: adding isopropanol with the same volume into the supernatant, mixing well, and standing at room temperature for 10 min; centrifugation at 12000g for 10min at 4 ℃ resulted in precipitation at the bottom of the tube.
4. Ethanol cleaning: discarding the supernatant, adding 1mL of 70% ethanol, shaking until the precipitate floats, centrifuging at 12000g and 4 ℃ for 5min, and discarding the ethanol.
5. Dissolving the precipitate: air drying the precipitate at room temperature for 2-5min, adding appropriate amount of RNA dissolving solution (such as 20 μ L) to dissolve the precipitate, blowing the precipitate with a pipette, and dissolving on ice for 30 min.
Second, total RNA reverse transcription and RT-PCR
1. RNA reverse transcription.
2. Real-time PCR: a two-step process is used.
The method comprises the following steps: 0.4. mu.L of primer P1, 0.4. mu.L of primer P2, 10. mu.L of 2 XPubix, 0.4. mu. L PASSIVE DYE, 2. mu.L of template, 6.8. mu.L of water.
The procedure is as follows: 95 ℃ for 3min, 95 ℃ for 30s, 55 ℃ for 20s, 72 ℃ for 20s, 40 cycles.
Dissolution curve step: heating at 95 deg.C for 15s, 60 deg.C for 15s, 20min, and 95 deg.C for 15 s.
3. Primer sequences
| Primer and method for producing the same | Sequence of | Numbering | |
| Mus MAGI-1-F | CCACATCAACAGGAAGACGC | 11 | |
| Mus MAGI-1-R | TGCATGATCCTCTGTCCACT | 12 | |
| Mus Nephrin-F | CTGGGACTGAAGGTTGTGAG | 13 | |
| Mus Nephrin-R | CTTCAGCCCAGTCAGTGTGA | 14 | |
| Mus JAM4-F | ATGTGACTTGCTATGCCGTG | 15 | |
| Mus JAM4-R | GCCTTCCTCTCCAATACTGT | 16 | |
| Mus RAP1-F | GTGGGGAAGTCTGCTCTGA | 17 | |
| Mus RAP1-R | CTGTTGGCAATCTACCTCGA | 18 | |
| Mus P-cadherin-F | AGACGAAAGAGAGAGTGGGT | 19 | |
| Mus P-cadherin- | TTGGTGCCTCTGTCCTTATT | 20 | |
| Mus podocin-F | CTAGCCCATGTGTCCAAAGC | 21 | |
| Mus podocin-R | TGGGCAATGCTCTTCCTTTC | 22 | |
| Mus Actinin4-F | GGCCTTTGAAAGTGACCTGG | 23 | |
| Mus Actinin4-R | GTGTGTTGACGTTGTGGGAG | 24 | |
| Mus-β-actin-F | TTCCTTCTTGGGTATGGAAT | 25 | |
| Mus-β-actin-R | GAGCAATGATCTTGATCTTC | 26 |
Third, experimental results
FIG. 2 shows the results of the measurement of mRNA expression in each group of cells. The results show that compared with the blank transfection group, the expression of the mRNA of the MAGI1 of the cells is obviously reduced after the transfection of the MAGI1 siRNA, and the expression of the mRNA of the Nephrin, JAM4, Rap1, P-Cadherin, actin 4 and podocin has no obvious difference.
Example 3 Western Blot assay for renal podocyte function Effect experiment
Preparation of protein lysate
PMSF, cocktail, Triton-100 and NaVO are added into basic lysate3。
Second, sample preparation
1. The culture medium was discarded, 1mL of 4 ℃ precooled PBS (0.01M pH7.2-7.3) was added to each well of cells, the cells were washed, the wash solution was discarded, the above operation was repeated twice, and then the cell well plate was placed on ice.
2. Add 150. mu.L of the prepared lysate to each well of cells, and lyse them on ice for 30 min.
3. After lysis, cell debris was collected and centrifuged at 12000rpm at 4 ℃ for 15 min.
4. Determination of protein concentration: a Byunnan BCA protein concentration determination kit is adopted.
5. Adjusting the protein concentration according to the concentration measurement result to ensure that the protein concentration is consistent among different groups, and storing at-80 ℃.
Third, Western Blot detection
1. Preparing an electrophoresis gel: preparing separation gel and concentrated gel.
2. Loading and electrophoresis: the protein samples were mixed with 5 × loading buffer and treated at 100 ℃ for 5min, 100 μ g of total cellular protein was loaded per well. Electrophoresis was performed at a constant current of 15 mA.
3. Film transfer: preparing a PVDF membrane, a PAGE gel and filter paper, sequentially putting the PVDF membrane, the filter paper, the gel, the PVDF membrane, the filter paper, the fiber pad and a white plate into a membrane rotating instrument, and rotating the membrane at the temperature of 4 ℃ and the voltage of 100V/100 mA.
4. Immunoblot color development: ECL color development system
(1) And (3) sealing: soaking PVDF membrane in TBST containing 5% skimmed milk powder, and sealing with shaker at room temperature for 2 hr.
(2) A first antibody: diluting the corresponding primary antibody with a confining liquid, soaking the PVDF membrane in a primary antibody incubation liquid, and incubating overnight at 4 ℃; the excess primary antibody is then washed away.
(3) Secondary antibody: diluting an HRP (horse radish) labeled secondary antibody with a confining liquid at a ratio of 1:5000, soaking the PVDF membrane in a secondary antibody incubation liquid, and incubating for 2 hours at 37 ℃ by a shaking table; excess secondary antibody was then washed away.
(4) Developing and exposing: uniformly mixing the enhancement solution in the ECL reagent with the stable peroxidase solution according to the ratio of 1:1, dropwise adding the mixture on a PVDF membrane, reacting for several minutes until a fluorescent band is obvious, developing with a developing solution, and fixing with a fixing solution.
5. And (3) analysis results: the film was scanned and the grey values were analyzed.
Fourth, experimental results
FIG. 3 shows the expression of each group of cell proteins. From the results, there was no significant difference in the expression of each protein in the MPC5+ Scrambled siRNA group cells compared with the MPC5 group. Compared with the MPC5+ Scambred siRNA group, the cell MAGI1 protein expression of MPC5+ MAGI1 siRNA1 and MPC5+ MAGI1 siRNA2 groups is obviously reduced, the JAM4 protein expression is slightly reduced, and the expression of other proteins is not obviously changed.
Example 4 CCK8 assay for renal podocyte function Effect assay
First, experiment method
1. After 48h transfection of MPC5 cells, 10. mu.L of CCK8 reaction was added to each well.
2. The plates were incubated in an incubator for 2 h.
3. Absorbance at 450nm was measured with a microplate reader.
Second, experimental results
FIG. 4 shows the results of the measurement of cell viability in each group. From the results, there was no significant difference in cell viability in the MPC5+ Scrambled siRNA group compared to the MPC5 group. Compared with the MPC5+ Scambred siRNA group, the MPC5+ MAGI1 siRNA1 and MPC5+ MAGI1 siRNA2 groups have slightly reduced cell viability and have significant difference.
Example 5 TUNEL assay for renal podocyte function Effect assay
First, experiment method
1. After 48h of MPC5 cell transfection, washing with PBS 3 times; 4% paraformaldehyde was fixed at room temperature for 30 min.
2. Adding 50 μ g/mL proteinase K dropwise, and reacting at 20-37 deg.C for 15-30 min; followed by washing with PBS.
3. 0.3% Triton-100 permeabilized for 15min (PBS dilution); blocking with 5% BSA for 30 min.
4. Discarding BSA, adding 50. mu.L TUNEL detection solution to the sample, and incubating at 37 deg.C in dark for 60 min; TUNEL assay working solution 50 μ L to 5 μ L TDT enzyme +45 μ L of fluorescent labeling solution was used for 1 sample.
5. Washing with PBS for 3 times; DAPI stained nuclei (1:200 dilution), 10 min.
6. Washing with PBS for 3 times; and (6) sealing the sheet.
Second, experimental results
FIG. 5 shows the results of the detection of apoptosis in each group. From the results, there was no significant difference in the apoptosis rate in the MPC5+ scrimbled siRNA group compared with the MPC5 group. Compared with the MPC5+ Scrambled siRNA group, the apoptosis rate of the MPC5+ MAGI1 siRNA1 group is not obviously different, and the apoptosis rate of the MPC5+ MAGI1 siRNA2 group is obviously increased.
Example 6 immunofluorescence assay for renal podocyte functional Effect assays
First, experiment method
1. Cell slide: coverslips were placed in 12-well plates and a monolayer cell slide was performed at the appropriate cell concentration.
2. Fixing the cells: the medium was discarded, washed with PBS, fixed with 3% formaldehyde solution, fixed at room temperature for 10-15min, and washed with PBS 3 times.
3. Penetration: the specimens were placed in 12-well plates, perforated with 1% Triton-X100, incubated at room temperature for 5-10min, and washed 3 times with PBS.
4. And (3) sealing: and dividing an operation area by using a sealing film, adding a proper amount of 3% BSA blocking solution into each sample site, and blocking for 30min at room temperature.
5. Removing blocking solution, adding MAGI1 (1: 500) antibody into the slice, incubating overnight at 4 deg.C, and washing with PBS 3 times; biotinylated secondary antibody was added, the sections incubated at room temperature for 10min and washed 3 times with PBS.
6. Adding streptavidin-alkaline phosphatase, incubating at room temperature for 10min, and washing with PBS 3 times; the color was developed (bluish) with an alkaline phosphatase developing solution (BCIP/NBT), and washed 3 times with PBS.
7. Adding 0.05% hydrochloric acid, and incubating at room temperature for 10 min; adding non-immune serum, and incubating at 37 deg.C for 10 min; adding JAM4 or Nephrin antibody (1: 200), incubating overnight at 4 deg.C, and washing with PBS 3 times; biotinylated secondary antibody was added, the sections incubated at room temperature for 10min and washed 3 times with PBS.
8. Adding streptavidin-peroxidase, incubating at room temperature for 10min, and washing with PBS for 3 times; the color of the solution was developed (bright red) with peroxidase developing solution (AEC), and washed with PBS 3 times.
9. PI counterstain nuclei.
10. And (5) sealing by using a water-soluble sealing agent.
Second, experimental results
FIG. 6 shows the results of immunofluorescent staining of the cells of each group MAGI1 and Nephrin. From the results, it was found that under normal conditions, MAGI1 and Nephrin were localized in the cell membrane and cytoplasm. Compared with a blank interference group, after the treatment of MAGI1 siRNA, the fluorescent expression of MAGI1 is obviously weakened, and part of cell Nephrin proteins are distributed in a dispersion way, and some of the cell Nephrin proteins enter the cell nucleus.
FIG. 7 shows the results of immunofluorescent staining of each group of cells MAGI1 and JAM 4. From the results, it was found that under normal conditions, MAGI1 and JAM4 were localized in the cell membrane and cytoplasm. Compared with a blank interference group, after the MAGI1 siRNA treatment, the MAGI1 fluorescence expression is obviously weakened, and part of JAM4 protein of the cells is in a dispersed distribution, and some protein enters the cell nucleus.
Example 7 cytoskeleton detection of renal podocyte function Effect experiment
Phantom-cyclopeptide immunofluorescence detection method
1. MPC5 cells were discarded from the culture medium and washed 2 times with 1M PBS (pH 7.4); the cells were fixed with 4% formaldehyde in PBS for 10min at room temperature and washed 2-3 times with PBS.
2. Permeabilize with 0.5% Triton X-100 solution for 5min at room temperature, and wash with PBS 2-3 times.
3. And (3) covering the cells with 200 mu L of FITC-labeled phalloidin working solution, incubating for 30min at room temperature in a dark place, and washing for 3 times by using PBS.
4. Nuclei were counterstained with 200. mu.L of DAPI solution for about 30s, washed with PBS and observed under a fluorescence microscope.
Two, alpha-actin 4 immunofluorescence detecting method
1. Cell slide: coverslips were placed in 12-well plates and a monolayer cell slide was performed at the appropriate cell concentration.
2. Fixing the cells: the medium was discarded, washed 1 time with PBS, fixed with 3% formaldehyde solution, fixed at room temperature for 10-15min, and then washed 3 times with PBS.
3. Penetration: the specimens were placed in 12-well plates, perforated with 1% Triton-X100, incubated at room temperature for 5-10min, and washed 3 times with PBS.
4. And (3) sealing: and dividing an operation area by using a sealing film, adding a proper amount of 3% BSA blocking solution into each sample site, and blocking for 30min at room temperature.
5. Primary antibody incubation: the primary antibody was diluted at a concentration of alpha-actin-41: 200, placed in a wet box and sealed overnight at 4 ℃ and washed 3 times with PBS.
6. Secondary antibody and PI nuclear staining: diluting the fluorescent secondary antibody and the PI mixed solution according to the concentration of 1:500, incubating for 30-60min at room temperature in a dark place, and washing for 3 times by PBS.
7. Sealing and fixing: coverslips were mounted on slides using fluorescence quenching coverslips.
8. The photographs were taken using a fluorescence microscope.
Third, experimental results
FIG. 8 shows the results of immunofluorescent staining of the cells of each group. The labeled phalloidin competitively binds to F-actin, and F-actin is actually detected. From the results, it was found that the cells F-acitin of MPC5 group and MPC5+ Scambred siRNA group were aggregated into bundles, and showed microfilament-like results, which were distributed along the long axis of the cells, to form stress fibers. MPC5+ MAGI1 siRNA1 and MPC5+ MAGI1 siRNA2 group cell part F-actin are recombined, arranged disorderly, have a microfilament structure disappeared and are distributed in the periphery of a cell body. Alpha-actin 4 is a binding and cross-linking protein of cytoskeletal protein F-actin, and is consistent with the positioning distribution of F-acin, but the filamentous form is not obvious, and the distribution is disordered after the MAGI1 is knocked down.
Example 8 cell adhesion test for renal podocyte function Effect test
First, experiment method
Cells were digested with trypsin + EDTA, plated in serum-free RMPI 1640 medium containing 0.5% BSA, the same number of MPC5 cells were plated in FN-coated (10. mu.g/mL) plates, incubated for 5h, PBS washed to remove nonadherent cells, fixed with 3.7% paraformaldehyde, stained with 0.1% crystal violet, lysed with 10% glacial acetic acid, and observed at 595nm OD using a spectrophotometer.
Second, experimental results
FIG. 9 shows the results of the detection of cell adhesion for each group. From the results, there was no significant difference in cell adhesion ability between the MPC5+ Scrambled siRNA group and the MPC5 group. Compared with the MPC5+ Scambred siRNA group, the MPC5+ MAGI1 siRNA1 and MPC5+ MAGI1 siRNA2 groups have obviously reduced cell adhesion capability.
Example 9 cell expansion test for renal podocyte function Effect test
First, experiment method
After cell digestion, washed 1 time with 10% BSA in serum-free medium and 2 times with serum-free medium, the same number of MPC5 cells were seeded in FN-coated (10. mu.g/mL) plates, cultured for 1h, observed for morphology, and analyzed for photography. The unstretched cells were circular, the stretched cells stretched out the processes, and the cells of the last year were counted in 3 random fields. Cell expansion rate is the number of expanded cells/total number of cells.
Second, experimental results
FIG. 10 shows the results of measurements of cell spreading for each group. From the results, there was no significant difference in cell spreading ability between the MPC5+ Scrambled siRNA group and the MPC5 group. Compared with the MPC5+ Scambred siRNA group, the MPC5+ MAGI1 siRNA1 and MPC5+ MAGI1 siRNA2 groups have obviously reduced cell spreading capability.
Sequence listing
<110> institute of first-capital science
Application of <120> MAGI-1 missense mutation (P.W845R) in renal podocyte function
<130> 2019
<160> 26
<170> PatentIn version 3.5
<210> 1
<211> 21
<212> RNA
<213> homo sapiens
<400> 1
gggugaaaga gacagagaaa u 21
<210> 2
<211> 21
<212> RNA
<213> homo sapiens
<400> 2
uucucugucu cuuucacccu u 21
<210> 3
<211> 21
<212> RNA
<213> homo sapiens
<400> 3
ggacaagaga ccuacgauuc a 21
<210> 4
<211> 21
<212> RNA
<213> homo sapiens
<400> 4
aaucguaggu cucuugucca u 21
<210> 5
<211> 21
<212> RNA
<213> homo sapiens
<400> 5
gcaaguucau ucacacgaag c 21
<210> 6
<211> 21
<212> RNA
<213> homo sapiens
<400> 6
uucgugugaa ugaacuugcc u 21
<210> 7
<211> 21
<212> RNA
<213> homo sapiens
<400> 7
ggacgagcac acucuccaag a 21
<210> 8
<211> 21
<212> RNA
<213> homo sapiens
<400> 8
uuggagagug ugcucguccu g 21
<210> 9
<211> 21
<212> RNA
<213> homo sapiens
<400> 9
uucuccgaac gugucacgut t 21
<210> 10
<211> 21
<212> RNA
<213> homo sapiens
<400> 10
acgugacacg uucggagaat t 21
<210> 11
<211> 20
<212> RNA
<213> homo sapiens
<400> 11
<210> 12
<211> 20
<212> RNA
<213> homo sapiens
<400> 12
<210> 13
<211> 20
<212> RNA
<213> homo sapiens
<400> 13
<210> 14
<211> 20
<212> RNA
<213> homo sapiens
<400> 14
<210> 15
<211> 20
<212> RNA
<213> homo sapiens
<400> 15
<210> 16
<211> 20
<212> RNA
<213> homo sapiens
<400> 16
<210> 17
<211> 19
<212> RNA
<213> homo sapiens
<400> 10
gtggggaagt ctgctctga 19
<210> 18
<211> 20
<212> RNA
<213> homo sapiens
<400> 11
<210> 19
<211> 20
<212> RNA
<213> homo sapiens
<400> 12
<210> 20
<211> 20
<212> RNA
<213> homo sapiens
<400> 13
ttggtgcctc tgtccttatt 20
<210> 21
<211> 20
<212> RNA
<213> homo sapiens
<400> 14
<210> 22
<211> 20
<212> RNA
<213> homo sapiens
<400> 15
tgggcaatgc tcttcctttc 20
<210> 23
<211> 20
<212> RNA
<213> homo sapiens
<400> 16
<210> 24
<211> 20
<212> RNA
<213> homo sapiens
<400> 14
<210> 25
<211> 20
<212> RNA
<213> homo sapiens
<400> 15
<210> 26
<211> 20
<212> RNA
<213> homo sapiens
<400> 16
gagcaatgat cttgatcttc 20
Claims (11)
1. The nucleotide sequences of a sense strand and an antisense strand of the siRNA are respectively shown in SEQ ID NO: 1 and 2 or the nucleotide sequences of the sense strand and the antisense strand thereof are shown as SEQ ID NO: 5 and 6.
2. A vector comprising the siRNA of claim 1.
3. The vector of claim 2, which is selected from the group consisting of a plasmid, a liposome, or a virus.
4. The vector of claim 3, wherein said plasmid is selected from the group consisting of eukaryotic plasmids; the liposome is selected from lipofectamin; the virus is selected from lentivirus or retrovirus.
5. A cell model comprising the siRNA of claim 1, or the vector of any one of claims 2-4; the cell is selected from renal podocytes.
6. The cell model of claim 5, wherein the renal podocytes are selected from human renal podocytes and murine renal podocytes.
7. A method of preparing a cell model, comprising: introducing the siRNA of claim 1, or the vector of any one of claims 2-4, into a host cell; the cell is selected from renal podocytes.
8. The method according to claim 7, wherein the renal podocyte is selected from the group consisting of human renal podocytes and murine renal podocytes.
9. Use of an siRNA according to claim 1, a vector according to any one of claims 2-4 or a cell model according to claim 5 or 6 for the manufacture of a system for screening a medicament for the treatment of a kidney-related disorder; the kidney-related disorder is selected from a renal podocyte apoptosis-related disease.
10. A system for screening a drug for treating a kidney-related disorder, comprising the siRNA of claim 1, the vector of any one of claims 2-4, or the cell model of claim 5 or 6; the kidney-related disorder is selected from a renal podocyte apoptosis-related disease.
11. A method of screening for a drug for treating a kidney-related disorder, comprising: contacting an anti-apoptotic renal podocyte drug with the cell model of claim 5 or 6, and screening for a drug capable of inhibiting apoptosis in said cell model or promoting growth in said cell model.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910164389.6A CN109929843B (en) | 2019-03-05 | 2019-03-05 | Use of MAGI-1 missense mutation (P.W845R) in renal podocyte function |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910164389.6A CN109929843B (en) | 2019-03-05 | 2019-03-05 | Use of MAGI-1 missense mutation (P.W845R) in renal podocyte function |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109929843A CN109929843A (en) | 2019-06-25 |
| CN109929843B true CN109929843B (en) | 2021-03-30 |
Family
ID=66986271
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910164389.6A Expired - Fee Related CN109929843B (en) | 2019-03-05 | 2019-03-05 | Use of MAGI-1 missense mutation (P.W845R) in renal podocyte function |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109929843B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110522902B (en) * | 2019-09-25 | 2022-10-11 | 南京农业大学 | Composition for establishing chronic kidney disease model and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102227237A (en) * | 2008-09-26 | 2011-10-26 | 国家健康与医学研究院 | Host cell kinases as targets for antiviral therapies against hcv infection |
-
2019
- 2019-03-05 CN CN201910164389.6A patent/CN109929843B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102227237A (en) * | 2008-09-26 | 2011-10-26 | 国家健康与医学研究院 | Host cell kinases as targets for antiviral therapies against hcv infection |
Non-Patent Citations (3)
| Title |
|---|
| MAGI proteins can differentially regulate the signaling pathways of 5-HT2AR by enhancing receptor trafficking and PLC recruitment;Maha M. Hammad et al.;《Cellular Signalling》;20180403;109-121 * |
| MAGI-1 interacts with Slo1 channel proteins and suppresses Slo1 expression on the cell surface;Lon D. Ridgway et al.;《Am J Physiol Cell Physiol》;20090429;C55-C65 * |
| 加权重基因共表达网络分析识别慢性肾脏病足细胞损伤关键节点基因MAGI2;王万鹏 等;《中国现代医学杂志》;20180831;第28卷(第24期);6-12 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109929843A (en) | 2019-06-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhu et al. | HULC long noncoding RNA silencing suppresses angiogenesis by regulating ESM-1 via the PI3K/Akt/mTOR signaling pathway in human gliomas | |
| Cui et al. | miR-194 suppresses epithelial-mesenchymal transition of retinal pigment epithelial cells by directly targeting ZEB1 | |
| Joyce et al. | Decreasing expression of the G1-phase inhibitors, p21Cip1 and p16INK4a, promotes division of corneal endothelial cells from older donors | |
| Zheng et al. | FAK regulates epithelial‑mesenchymal transition in adenomyosis | |
| Joseph et al. | Downregulation of β-actin gene and human antigen R in human keratoconus | |
| AU2021204942A1 (en) | Application of a reagent down-regulating circular gene expression in preparation of a drug to prevent and/or treat pulmonary fibrosis, and drug | |
| Fu et al. | CircADAMTS6/miR‐431‐5p axis regulate interleukin‐1β induced chondrocyte apoptosis | |
| CN109929843B (en) | Use of MAGI-1 missense mutation (P.W845R) in renal podocyte function | |
| Chen et al. | High-metastatic melanoma cells promote the metastatic capability of low-metastatic melanoma cells via exosomal transfer of miR-411-5p | |
| WO2021155825A1 (en) | Use of pax6 gene or expression product thereof in preparation of drug for inhibiting fibrosis | |
| CN113652429A (en) | shRNA for targeted knockdown of long-chain non-coding RNAMIR205HG and application thereof | |
| CN110433171B (en) | Application of miRNA-1293 in preparation of anti-colorectal tumor medicine | |
| CN113908283A (en) | PRMT5 inhibitor and application thereof in combination with PD-L1 antibody blocking agent in treatment of lung cancer | |
| CN111926015A (en) | Oligonucleotide, viral vector and application thereof and RNAi pharmaceutical preparation | |
| CN114736962B (en) | Application of inhibitor of circDHTKD1 in preparation of medicine for regulating and controlling airway epithelial inflammation | |
| Huang et al. | Microarray expression profile and functional analysis of circular RNAs in choroidal neovascularization | |
| CN104906125B (en) | Application of microRNA 326 inhibitor in the medicine for preparing treatment cataract | |
| CN115058517B (en) | Application of PRKD1 gene as non-small cell lung cancer diagnosis or prognosis marker | |
| Singh et al. | Alpha 6 integrins promote cytokinesis by regulating the expression of RSK2 and MKLP1 | |
| CN109666727B (en) | Application of micro RNA for high-activity inhibition of PCSK9 expression | |
| CN109706151B (en) | shRNA for targeted silencing of STAT3 of human non-small cell lung cancer cell | |
| CN112725449B (en) | Application of siRNA inhibitor of circ0058792 in preparation of medicine for treating renal clear cell carcinoma | |
| He et al. | Bradykinin potentially stimulates cell proliferation in rabbit corneal endothelial cells through the ZO‑1/ZONAB pathway | |
| Shadab et al. | Role of Autophagy Protein ATG7 in Endothelial Cell Inflammation and Permeability | |
| CN108060134B (en) | HPMC cell strain for stably over-expressing miR-497 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20210330 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |