CN109837336B - Radiation sensitive gene marker and application thereof in identification of high LET radiation - Google Patents
Radiation sensitive gene marker and application thereof in identification of high LET radiation Download PDFInfo
- Publication number
- CN109837336B CN109837336B CN201910019813.8A CN201910019813A CN109837336B CN 109837336 B CN109837336 B CN 109837336B CN 201910019813 A CN201910019813 A CN 201910019813A CN 109837336 B CN109837336 B CN 109837336B
- Authority
- CN
- China
- Prior art keywords
- radiation
- ray
- seq
- nucleotide sequence
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a radiation-sensitive gene marker and application thereof in identifying high LET (low-LET-rate) ray radiation. The radiation-sensitive gene markers include Loxl1, Zfp385a, Slc39a13, Smurf1, Katnb1, Col24a1, Smap2, Aebp1, Tcfe3 and Tlr 1. Based on detecting the gene expression level of a radiation-sensitive gene marker in a radiated organism, the method is used for identifying whether the radiated organism is exposed to high LET radiation (such as fast neutron rays, negative pi meson rays, heavy ion rays and the like) so as to provide a radiation dose reference for the evaluation of the nuclear radiation damage risk.
Description
Technical Field
The invention belongs to the field of radiation biological ray type detection, and particularly relates to a radiation sensitive gene marker and application thereof in identification of high LET ray radiation.
Background
Linear energy transfer (Linear energy transfer) describes the ionization density or energy transfer per unit length, which is defined as the average energy released by a charged particle traversing a spatial distance of 1 μm, i.e. keV/μm. LET is a parameter for evaluating radiation quality. The high LET per unit length, with a high ionization density, is called a high LET ray, and vice versa a low LET ray. The high linear energy transfer ray (hereinafter referred to as high LET ray) refers to fast neutron, negative pi meson and heavy particles of helium, carbon, nitrogen, oxygen, neon, etc. Except that the fast neutrons are uncharged, other particles are charged and can be accelerated to an energy level of hundreds of MeV/u by a synchrotron or a cyclotron. High LET rays have a range in the tissue and have a characteristic ionization absorption peak type dose profile (i.e., low dose plateau region and bragg peak). Unlike photon rays (e.g. X-rays, electron rays), this physical property offers the possibility of precise radiotherapy: better dose distribution can be obtained by a single irradiation field, the design of the radiation field is simplified, and the accuracy of the tumor treatment dose is improved. Cells have different radiosensitivities to high LET radiation than low LET radiation. There are two reasons for this: firstly, the oxygen enhancement of high LET rays is lower than that of lower LET rays, namely the radiation sensitivity of the high LET rays has smaller dependence on the oxygen content degree in cells; ② the influence of cell division cycle, mainly G0 phase cells have small resistance to high LET radiation. Therefore, high LET radiation is an important way to overcome the radiation insensitivity of hypoxic cells and G0 phase cells in radiotherapy.
In addition to medical applications, high LET radiation is also receiving much attention in many areas such as nuclear industry, nuclear weapons protection, anti-terrorism, aerospace, and the like. The action of various microscopic particles released by the nuclei during nuclear reactions such as fission, decay, and the like, and radiation generated by electromagnetic radiation or "energy" is referred to as nuclear radiation. The action of nuclear radiation on a substance can cause ionization and excitation of the substance, and is referred to as ionizing radiation. All nuclear radiation is ionizing radiation, and not vice versa. Such as X-rays, which, although ionizing radiation, are not nuclear radiation, since they do not originate from the nucleus. The explosion of nuclear weapons causes the most serious nuclear radiation events, and in the explosion field area of the nuclear weapons (atomic bombs), more than 20 kinds of main radionuclides are released, and the generated nuclear radiation types mainly comprise high-LET rays (such as alpha particles, neutrons and the like) and low-LET rays (such as beta particles, gamma rays and the like). Nuclear bombs, which are conventional explosive devices with radioactive materials that do not have a nuclear fission reaction, thus resulting in a relatively single type of nuclear contamination and radiation, depending on the radioactive material used to make the bombs, are another potential threat to nuclear radiation. The relative biological effects of different kinds of nuclear radiation on organisms vary significantly. Cosmic rays are also accompanied by a large number of high LET particle rays, such as protons, alpha particles, carbon, oxygen, nitrogen ions, and therefore will also have some effect on space station personnel and experimental animals and plants. The united states space administration (NASA) long island radiobiology laboratory has been working on the development of this field of research since the last century.
The risk and severity of a health hazard from nuclear radiation depends on the type of radiation, dose rate, body absorbed dose, and sensitivity of the individual. High LET, due to its higher Relative Biological Effect (RBE), results in greater radiation damage and in advanced or far-after-treatment effects, such as malignant adenocarcinoma, sarcoma, hematological tumors, cataracts, chronic radiodermatitis, radiation fibrosis, cardiovascular diseases, etc., which occur months or even years after exposure. Therefore, the method has practical application value on how to quickly and accurately identify and detect the high LET rays after the organisms are exposed to the high LET rays. At present, no biological detection method aiming at high LET ray specificity exists in China.
Disclosure of Invention
Based on the problems of the prior art, the first objective of the present invention is to provide a radiation-sensitive genetic marker, which is proved by the applicant to have high specific radiation sensitivity only for high-Linear Energy Transfer (LET) rays (such as heavy particle rays, etc.) and no radiation sensitivity for low-Linear Energy Transfer (LET) rays (such as X-rays, etc.).
The second purpose of the invention is to provide the application of the radiation-sensitive gene marker in the identification of high LET ray radiation. The method is based on detecting the gene expression level of a radiation-sensitive gene marker in a radiated organism, and is used for identifying whether the radiated organism is radiated by high LET rays (such as heavy ion rays and the like) so as to provide a radiation dose reference.
The third purpose of the invention is to provide a kit for identifying whether an organism is irradiated by high LET rays and application thereof, and the kit containing the radiation sensitive gene marker can be used for identifying the high LET rays more quickly, conveniently and accurately and providing a dose reference.
The fourth object of the present invention is to provide a method for obtaining the radiation-sensitive gene marker of the present invention.
The purpose of the invention is realized by the following technical means:
in a first aspect, the present invention provides a radiation-sensitive gene marker comprising 10 radiation-sensitive genes: loxl1(Lysyl oxidase homolog 1, human Lysyl oxidase-Like Protein), Zfp385A, (Zinc finger Protein 385A, Zinc finger 385A) Slc39a13 (solvent Carrier Family 39Member 13, Solute Carrier transporter Family 39Member A13), Smurf1(SMAD specificity E3 Bioquitin ligand 1, E3 Ubiquitin Ligase), Katnb1(Katanin P80 Subunit B1, swordin P80 Subunit B8), Cola 24a1(Collagen Type XXIV 1Chain, Collagen 24. alpha.1 Chain), Smap2 (molecular-Associated GTPase-vavage Protein 2, basal plasma Membrane Associated activator Protein 2), Acyt Protein Axis-27 (Adelyt 1-Like Protein), Protein Binding Tomconreceptor T3723, Protein T11 Binding Protein T3723, Protein T11-Binding Protein T3.
In the above-mentioned radiation-sensitive gene marker, preferably, the nucleotide sequence of Loxl1 is as follows:
CTGGATGCCAGACCCTGTCTTGTACCTACTTCTCCTCTACAACACCATGG (SEQ ID NO: 1) (5 '-3');
the Zfp385a nucleotide sequence is as follows:
AGTCGGGACAGGGTGTAACCAAGGGTGAAGGGGGAACTTCAGTCCCAGCT (SEQ ID NO: 2) (5 '-3');
the nucleotide sequence of the Slc39a13 is as follows:
GGCCCTTGTCCTTTGGGTTAAGAGTAAGATGGGGGTGGTGAGGGCTCCAC (SEQ ID NO: 3) (5 '-3');
the nucleotide sequence of Smurf1 is as follows:
AAGGCGCGGCAGGGCCCCGGCTGTTCACCATTCACCTGATAGACGCCAAT (shown in SEQ ID NO: 4) (5 '-3');
the nucleotide sequence of Katnb1 is as follows:
GTGGAGTCTGCATGGTCAGCCAGCAACGGGAGCAACAGGGTACACAATGC (shown in SEQ ID NO: 5) (5 '-3');
the nucleotide sequence of Col24a1 is as follows:
CAGGCCACCTAAATCCAGTGGTAGGTTTGGATTAGAAACTGGTGTTTGTG (shown in SEQ ID NO: 6) (5 '-3');
the nucleotide sequence of Smap2 is as follows:
GGATCTGGCCTGTGACTAGAAGACCAACCCCTACGAGGAAATGTGGAGCT (shown in SEQ ID NO: 7) (5 '-3');
the nucleotide sequence of the Aebp1 is as follows:
AAGCCCTGCCCAATTCAAACTAAGGCAGCACCTCCCAAGCCTGTGCCAGC (shown in SEQ ID NO: 8) (5 '-3');
the nucleotide sequence of the Tcfe3 is as follows:
GGCAGGGCCTGGGAGGAATGGTGGCAAAGGTATAATGTATCCGTGTTTTG (shown in SEQ ID NO: 9) (5 '-3');
the nucleotide sequence of the Tlr1 is as follows:
GGCCTGGGACCACTCATCTCCTGCTGTTGTTTCTGGAGCCCCTTGATAGG (shown in SEQ ID NO: 10) (5 '-3').
In a second aspect, the present invention also provides the use of the above-described radiation-sensitive gene marker for identifying high LET radiation.
In the above application, preferably, the application comprises the steps of:
detecting the gene expression levels of radiation-sensitive gene markers Loxl1, Zfp385a, Slc39a13, Smurf1, Katnb1, Col24a1, Smap2, Aebp1, Tcfe3 and Tlr1 in the irradiated organisms, and identifying the irradiated organisms as high LET ray radiation exposure when the expression levels of the genes are remarkably high.
In the above application, the organism may include a human, an animal, and the like.
In the above application, preferably, the high LET ray includes one or more of a fast neutron ray, a negative pi meson ray, a heavy ion ray, and the like.
In the above application, preferably, the heavy ion beam includes one or more of a helium ion beam, a carbon ion beam, a nitrogen ion beam, an oxygen ion beam, a neon ion beam, and the like.
In the above application, preferably, the gene expression level of the sensitive gene marker is an average value of the transcription level difference expression fold.
In a third aspect, the present invention also provides a kit for identifying whether an organism is irradiated with high LET radiation, the kit comprising the above-described radiation-sensitive gene marker.
In a fourth aspect, the invention also provides the use of a kit as described above for the identification of high LET radiation.
In a fifth aspect, the present invention also provides a method for obtaining the above-mentioned radiation-sensitive gene marker for non-therapeutic purposes, comprising the steps of:
after mice are irradiated by different ray types, different doses of single gradient doses and graded gradient doses, fresh lung tissues are extracted to carry out gene chip or real-time quantitative polymerase chain reaction, 24-week lung tissue whole genome expression level is analyzed based on a whole genome gene expression array, trend relation between different ray irradiation, radiation dose and gene expression is analyzed, and expression gene combination which is increased along with the increase of high LET ray radiation dose and is not changed along with the change of low LET ray radiation dose, namely the radiation sensitive gene marker, is obtained.
In the above method, the single gradient dose irradiation and the fractionated gradient dose irradiation with different radiation types and different doses may be performed in the following manners, for example: x-ray gradient dose fraction irradiation (0, 10.5, 12.5, 14.5, 17.5Gy), X-ray gradient dose fraction irradiation (0, 10, 20, 30, 40Gy divided by 5), Carbon ion (Carbon-ions) gradient dose fraction irradiation (0, 7.5, 10.5, 12.5, 14.5Gy), Carbon ion (Carbon-ions) gradient dose fraction irradiation (0, 5, 10, 15, 20Gy divided by 5 irradiation).
In the above method, preferably, the different ray types include a low LET ray and a high LET ray; the low LET rays include one or more of X-rays, beta rays, gamma rays, and the like.
The invention relates to a biological dose evaluation means established according to the excitability change of the transcription level of relevant radiation sensitive genes of mouse lung tissues after being irradiated by carbon ion rays or other high LET rays.
The invention screens out related sensitive gene combinations by utilizing whole genome transcriptomics analysis 24 weeks after mice receive different LET rays and are irradiated on the whole lung. The specific gene combination has no response to low LET rays, but can be driven to generate obvious high regulation after being irradiated by high LET rays, and the X-ray radiation identification is rapidly carried out according to a gene expression level-X-ray prediction model through the biological effect.
The mouse model adopted by the invention is a mouse radioactive lung injury model, is an important tool for researching the relationship between radiation pneumonitis, pulmonary fibrosis and radiation dose, normal tissue radiation reaction, respiratory system diseases and immune response reaction mechanism, and has irreplaceable effects in radiobiology, radiotherapy and research and development of lung injury resistant drugs. The early stages of radiation lung injury are primarily manifested as radiation pneumonitis (usually secondary to within 3 months after irradiation), a lymphocytic alveolitis, due to the immune response generated by the activation of a large number of T lymphocytes; advanced stage can develop into interstitial pulmonary fibrosis (about 6 months after irradiation). The pathophysiological process of the radioactive lung injury of the mouse is very similar to that of the human, so the radioactive lung injury of the mouse can be used as a reliable reference experiment model.
In the invention, if the organism receives mixed rays, namely, the mixed rays contain high LET rays and low LET rays, the method can accurately identify the high LET ray part.
The invention has the beneficial effects that:
(1) the radiation-sensitive gene marker has high specific radiation sensitivity only for high-Linear Energy Transfer (LET) rays (such as heavy particle rays and the like), has no radiation sensitivity for low-Linear Energy Transfer (LET) rays (such as X rays and the like), and is used for identifying whether a radiated organism is exposed to high LET rays (such as fast neutron rays, negative pi meson rays, heavy ion rays and the like) based on detecting the gene expression level of the radiation-sensitive gene marker in the radiated organism, thereby providing a radiation dose reference for nuclear radiation damage risk assessment.
(2) The kit containing the radiation sensitive gene marker can be used for identifying high LET rays more quickly, conveniently and accurately and providing a dose reference.
Drawings
FIG. 1 is a graph of Venn diagram of the subset of dose-dependent up-regulated genes (dose-dependent up-regulation genes) [ X-ray gradient dose single irradiation (0, 10.5, 12.5, 14.5, 17.5Gy), X-ray gradient dose fraction irradiation (0, 10, 20, 30, 40Gy divided by 5 irradiation), Carbon ion (Carbon-ions) gradient dose single irradiation (0, 7.5, 10.5, 12.5, 14.5Gy), Carbon ion (Carbon-ions) gradient dose fraction irradiation (0, 5, 10, 15, 20Gy divided by 5 irradiation) ], obtained after 24 weeks of analysis of the whole genome transcription level of lung tissue in example 1 of the present invention in C57BL/6 mice.
FIG. 2 is a 67-carbon-ion-specific gene heatmap obtained by analysis of a Venn diagram in example 1 of the present invention.
FIG. 3 is a gene heatmap of high LET radiograph biology identification gene combinations for the most significant (Top 10) carbon ion specific gene composition of the Venn diagram analysis in example 1 of the present invention.
FIG. 4 shows the expression levels (log2 fold-change) of 10 specific sensor genes obtained by screening in example 2 of the present invention at 24 weeks after irradiation with carbon ion radiation.
FIG. 5 is the gene expression values (P <0.0001) of 10 specific sensitive genes screened in example 2 of the present invention at 24 weeks after irradiation with gradient dose X-ray and carbon ion ray.
FIG. 6 is a diagram of the receiver operating characteristic curve (ROC).
Detailed Description
The technical solutions of the present invention will be described in detail below in order to clearly understand the technical features, objects, and advantages of the present invention, but the present invention is not limited to the practical scope of the present invention.
The chemical reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1 screening acquisition of radiation sensitive Gene markers
1. Animal experiment irradiation and grouping: c57BL6 female mice 8-10 weeks old are bred in SPF grade under the conditions of temperature (23 +/-1) DEG C, relative humidity 55 +/-5%, pressure difference less than or equal to 10Pa, light irradiation for 12h every day and free drinking water.
2. After isoflurane induced anesthesia before irradiation, the mice are transferred to a special mouse chest irradiation device and fixed properly. Whole lung fields were irradiated with heavy ions (carbon-ions) and X-rays. X-rays are representative of low LET rays and are irradiated after accelerated by a medical linear accelerator (energy 6-10 MV). As a main representative of high LET rays, heavy ion rays are carbon particle beams (energy is 280MeV) which are guided after being accelerated by a cyclotron (the diameter is up to 20-30 meters), and have extremely high energy and speed.
3. The irradiation and grouping included X-ray gradient dose fractions: 0. 10.5, 12.5, 14.5, 17.5Gy, X-ray gradient dose fractionated irradiation: 0. 10, 20, 30 and 40Gy are divided into 5 times of irradiation and single irradiation with heavy ion gradient dose: 0. 7.5, 10.5, 12.5, 14.5Gy, heavy ion gradient dose fractionated irradiation: 0.5, 10, 15 and 20Gy irradiation times were divided into 5.
4. The blank control group received no radiation (0 Gy). Control and dose groups were randomly assigned to 12 mice per group.
5. Fresh lung tissue was taken 24 weeks after irradiation, treated with total RNA extraction reagent (Trizol), and total RNA was isolated and extracted using RNeasy Mini kit. To avoid DNA contamination, RNA was treated with DNase I. Purified RNA was eluted in 45.0. mu.l nuclease-free water and stored at-20.0 ℃. RNA concentration and purity were assessed using a NanoDrop ND-1000 spectrophotometer. The integrity and purity of the RNA samples were determined using a 2100Bioanalyzer and the corresponding RNA Nano Chip. Samples were analyzed based on whole genome gene expression arrays. And generating an expression matrix, and annotating and processing data by using a self-contained software package. In subsequent statistical tests, the data were log2 transformed to account for increased or decreased expression of the gene. In order to analyze the relation between radiation and gene expression trend at different time points, R language software package is adopted for carrying out cluster analysis, including principal component analysis, hierarchical cluster, K mean cluster and self-organizing mapping to identify the gene expression related to the dosage.
Analyzing the whole genome expression level of 24-week lung tissues based on a whole genome gene expression array, analyzing the trend relation between different radiation doses and gene expression under the irradiation of rays, and obtaining an expression gene combination which is the radiation sensitive gene marker and the gene expression level of which is increased along with the increase of the radiation dose of high LET rays and is not changed along with the change of the radiation dose of low LET rays.
The specific screening process is as follows:
referring to fig. 1 and 2, a subset of dose-dependent up-regulated genes (dose-dependent up-regulation genes) was obtained after analysis of the whole genome transcript level of lung tissue 24 weeks after X-ray gradient dose bolus irradiation (0, 10.5, 12.5, 14.5, 17.5Gy), X-ray gradient dose fractionated irradiation (0, 10, 20, 30, 40Gy divided by 5 irradiations), Carbon ion (Carbon-ions) gradient dose bolus irradiation (0, 5, 10, 15, 20Gy divided by 5 irradiations). Analysis of the Venn diagram yielded 67 carbon ion specific genes.
Referring to fig. 3, the heat map analysis of the expression level of the mouse lung tissue gene after different radiation irradiation respectively shows that: the gene expression level is increased along with the increase of the carbon ion radiation dose, and is in dose correlation; the gene expression level does not change with the change of X-ray dosage. 10 radiation-sensitive gene combinations were obtained by screening: loxl1(Lysyl oxidase homolog 1, human Lysyl oxidase-Like Protein), Zfp385A, (Zinc finger Protein 385A, Zinc finger 385A) Slc39a13 (solvent Carrier Family 39Member 13, Solute Carrier transporter Family 39Member A13), Smurf1(SMAD Specific E3 Ubiquitin ligand 1, E3 Ubiquitin Ligase), Katnb1(Katanin P80 Subunit B1, swordn P80 Subunit B1), Cola 24a1(Collagen Type XXIV Alpha 1Chain, Collagen 24 Alpha 1 Chain), Smap2 (Protein-Associated GTPase-variant Protein 2, matrix Membrane Associated activator Protein albumin 2), Axis Protein 27 (enzyme promoter 27, Protein), Protein Enhancer Binding Protein T3723, Protein Binding Protein T11, Protein T23, Protein Binding Protein T11 Protein (Protein T1 Binding Protein).
In the above-mentioned radiation-sensitive gene marker, preferably, the nucleotide sequence of Loxl1 is as follows:
CTGGATGCCAGACCCTGTCTTGTACCTACTTCTCCTCTACAACACCATGG (shown in SEQ ID NO: 1) (5 '-3');
the Zfp385a nucleotide sequence is as follows:
AGTCGGGACAGGGTGTAACCAAGGGTGAAGGGGGAACTTCAGTCCCAGCT (shown in SEQ ID NO: 2) (5 '-3');
the nucleotide sequence of the Slc39a13 is as follows:
GGCCCTTGTCCTTTGGGTTAAGAGTAAGATGGGGGTGGTGAGGGCTCCAC (SEQ ID NO: 3) (5 '-3');
the nucleotide sequence of Smurf1 is as follows:
AAGGCGCGGCAGGGCCCCGGCTGTTCACCATTCACCTGATAGACGCCAAT (shown in SEQ ID NO: 4) (5 '-3');
the nucleotide sequence of Katnb1 is as follows:
GTGGAGTCTGCATGGTCAGCCAGCAACGGGAGCAACAGGGTACACAATGC (shown in SEQ ID NO: 5) (5 '-3');
the nucleotide sequence of Col24a1 is as follows:
CAGGCCACCTAAATCCAGTGGTAGGTTTGGATTAGAAACTGGTGTTTGTG (shown in SEQ ID NO: 6) (5 '-3');
the nucleotide sequence of Smap2 is as follows:
GGATCTGGCCTGTGACTAGAAGACCAACCCCTACGAGGAAATGTGGAGCT (shown in SEQ ID NO: 7) (5 '-3');
the nucleotide sequence of the Aebp1 is as follows:
AAGCCCTGCCCAATTCAAACTAAGGCAGCACCTCCCAAGCCTGTGCCAGC (shown in SEQ ID NO: 8) (5 '-3');
the nucleotide sequence of the Tcfe3 is as follows:
GGCAGGGCCTGGGAGGAATGGTGGCAAAGGTATAATGTATCCGTGTTTTG (shown in SEQ ID NO: 9) (5 '-3');
the nucleotide sequence of the Tlr1 is as follows:
GGCCTGGGACCACTCATCTCCTGCTGTTGTTTCTGGAGCCCCTTGATAGG (shown in SEQ ID NO: 10) (5 '-3').
Example 2
The present example provides the use of the radiation sensitive gene markers obtained by screening in example 1 for the identification of high LET radiation.
Referring to fig. 4, the expression fold difference of 10 genes after gradient carbon ion radiation and X-ray radiation, and the X-ray radiation group has almost no radiation response.
Referring to FIG. 5, the gene expression values of 10 genes were different at 24 weeks of gradient carbon ion irradiation and X-ray irradiation, and the difference was statistically significant (P < 0.0001).
Referring to fig. 6, a characteristic curve (ROC) of the operation of the subject shows the discrimination ability of the mean expression value of 10 genes after the irradiation of the gradient dose X-ray and the carbon ion ray to the X-ray. The Area under the Curve (Area under the Curve, AUC) is equal to 0.896, the 95% Confidence Interval (CI) is 0.806-0.986, and when the average value of the expression of the 10 genes is equal to 1.048, the sensitivity of the heavy ion rays is 79.17%, and the specificity is 83.33%, which shows that the average expression value of the 10 genes has good capacity of distinguishing the radiation of the heavy ion rays.
The radiation sensitive gene marker is made into a kit for identifying whether the high LET rays are radiated or not, so that the high LET rays can be identified more quickly, conveniently and accurately, a dose reference is provided, and the kit is favorable for marketing and using.
The above-mentioned embodiments are only for illustrating the technical idea and features of the present invention, and the purpose of the present invention is to enable those skilled in the art to understand the content of the present invention and implement the present invention accordingly, and the present invention is not limited by the embodiments, i.e. the spirit of the present invention, equivalent changes or modifications are still within the scope of the present invention.
Sequence listing
<110> military medical research institute of military science institute of people's liberation force of China
<120> radiation-sensitive gene marker and application thereof in identification of high LET radiation
<130> GAI18CN6325
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 50
<212> DNA
<213> Loxl1
<400> 1
ctggatgcca gaccctgtct tgtacctact tctcctctac aacaccatgg 50
<210> 2
<211> 50
<212> DNA
<213> Zfp385a
<400> 2
agtcgggaca gggtgtaacc aagggtgaag ggggaacttc agtcccagct 50
<210> 3
<211> 50
<212> DNA
<213> Slc39a13
<400> 3
ggcccttgtc ctttgggtta agagtaagat gggggtggtg agggctccac 50
<210> 4
<211> 50
<212> DNA
<213> Smurf1
<400> 4
aaggcgcggc agggccccgg ctgttcacca ttcacctgat agacgccaat 50
<210> 5
<211> 50
<212> DNA
<213> Katnb1
<400> 5
gtggagtctg catggtcagc cagcaacggg agcaacaggg tacacaatgc 50
<210> 6
<211> 50
<212> DNA
<213> Col24a1
<400> 6
caggccacct aaatccagtg gtaggtttgg attagaaact ggtgtttgtg 50
<210> 7
<211> 50
<212> DNA
<213> Smap2
<400> 7
ggatctggcc tgtgactaga agaccaaccc ctacgaggaa atgtggagct 50
<210> 8
<211> 50
<212> DNA
<213> Aebp1
<400> 8
aagccctgcc caattcaaac taaggcagca cctcccaagc ctgtgccagc 50
<210> 9
<211> 50
<212> DNA
<213> Tcfe3
<400> 9
ggcagggcct gggaggaatg gtggcaaagg tataatgtat ccgtgttttg 50
<210> 10
<211> 50
<212> DNA
<213> Tlr1
<400> 10
ggcctgggac cactcatctc ctgctgttgt ttctggagcc ccttgatagg 50
Claims (8)
1. A radiation-sensitive gene marker combination characterized by: the radiation-sensitive gene marker combination consists of Loxl1, Zfp385a, Slc39a13, Smurf1, Katnb1, Col24a1, Smap2, Aebp1, Tcfe3 and Tlr1, wherein the radiation is carbon ion ray radiation, and the radiation-sensitive gene marker is an expressed gene of which the gene expression quantity is increased along with the increase of the dosage of the carbon ion ray radiation and is not changed along with the change of the dosage of the X ray radiation.
2. The radiation-sensitive genetic marker combination of claim 1, wherein:
the nucleotide sequence of Loxl1 is shown in SEQ ID NO: 1 is shown in the specification;
the nucleotide sequence of Zfp385a is shown as SEQ ID NO: 2 is shown in the specification;
the nucleotide sequence of the Slc39a13 is shown in SEQ ID NO: 3 is shown in the specification;
the nucleotide sequence of Smurf1 is shown as SEQ ID NO: 4 is shown in the specification;
the nucleotide sequence of Katnb1 is shown in SEQ ID NO: 5 is shown in the specification;
the nucleotide sequence of the Col24a1 is shown in SEQ ID NO: 6 is shown in the specification;
the nucleotide sequence of Smap2 is shown in SEQ ID NO: 7 is shown in the specification;
the nucleotide sequence of the Aebp1 is shown as SEQ ID NO: 8 is shown in the specification;
the nucleotide sequence of Tcfe3 is shown as SEQ ID NO: 9 is shown in the figure;
the nucleotide sequence of Tlr1 is shown as SEQ ID NO: shown at 10.
3. Use of a reagent for detecting the gene expression level of the radiation-sensitive gene marker combination of claim 1 or 2 in the preparation of a kit for identifying carbon ion radiation exposure and X-ray radiation exposure.
4. Use according to claim 3, characterized in that it comprises the following steps:
detecting the gene expression levels of radiation-sensitive gene markers Loxl1, Zfp385a, Slc39a13, Smurf1, Katnb1, Col24a1, Smap2, Aebp1, Tcfe3 and Tlr1 in the radiated organisms, and determining the radiated organisms as carbon ion ray radiation exposure when the expression levels of the genes are obviously increased on average, wherein the organisms are mice.
5. Use according to claim 3, characterized in that: the gene expression level of the sensitive gene marker is the average value of the transcription level difference expression fold.
6. A kit for distinguishing between carbon ion radiation exposure and X-ray radiation exposure, comprising: the kit contains a reagent for detecting the gene expression level of the radiation-sensitive gene marker combination according to claim 1 or 2 in an organism irradiated, wherein the organism is a mouse.
7. Use of the kit of claim 6 for the manufacture of a kit for discriminating between carbon ionizing radiation exposure and X-ray radiation exposure.
8. A method for obtaining the radiation sensitive gene marker combination of claim 1 or 2 for non-therapeutic purposes comprising the steps of:
after mice are irradiated with different ray types, different doses of single gradient doses and graded gradient doses of whole lung fields, extracting fresh lung tissues to perform gene chip or real-time quantitative polymerase chain reaction, analyzing the whole genome expression level of 24-week lung tissues based on a whole genome gene expression array, analyzing the trend relation of different ray irradiation, radiation dose and gene expression, and obtaining an expression gene combination, namely a radiation sensitive gene marker combination, of which the gene expression quantity is increased along with the increase of the carbon ion ray radiation dose and is not changed along with the change of the X ray radiation dose;
wherein the different ray types, different doses of single gradient dose irradiation and fractionated gradient dose irradiation are: the X-ray gradient dose irradiation is 0, 10.5, 12.5, 14.5 and 17.5Gy, the X-ray gradient dose irradiation is 0, 10, 20, 30 and 40Gy for 5 times, the carbon ion ray gradient dose irradiation is 0, 7.5, 10.5, 12.5 and 14.5Gy, and the carbon ion ray gradient dose irradiation is 0, 5, 10, 15 and 20Gy for 5 times.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910019813.8A CN109837336B (en) | 2019-01-09 | 2019-01-09 | Radiation sensitive gene marker and application thereof in identification of high LET radiation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910019813.8A CN109837336B (en) | 2019-01-09 | 2019-01-09 | Radiation sensitive gene marker and application thereof in identification of high LET radiation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109837336A CN109837336A (en) | 2019-06-04 |
| CN109837336B true CN109837336B (en) | 2022-07-19 |
Family
ID=66883680
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910019813.8A Active CN109837336B (en) | 2019-01-09 | 2019-01-09 | Radiation sensitive gene marker and application thereof in identification of high LET radiation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109837336B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105803049A (en) * | 2014-12-29 | 2016-07-27 | 中国辐射防护研究院 | Method for screening biomarkers of ionizing radiation as well as application of SZT2 protein determined by method |
| CN107760776A (en) * | 2016-08-22 | 2018-03-06 | 中国辐射防护研究院 | Purposes of the LY6G5C genes as the molecular marked compound of heavy ion radiation exposure diagnosis |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012031008A2 (en) * | 2010-08-31 | 2012-03-08 | The General Hospital Corporation | Cancer-related biological materials in microvesicles |
| WO2016170348A2 (en) * | 2015-04-22 | 2016-10-27 | Mina Therapeutics Limited | Sarna compositions and methods of use |
-
2019
- 2019-01-09 CN CN201910019813.8A patent/CN109837336B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105803049A (en) * | 2014-12-29 | 2016-07-27 | 中国辐射防护研究院 | Method for screening biomarkers of ionizing radiation as well as application of SZT2 protein determined by method |
| CN107760776A (en) * | 2016-08-22 | 2018-03-06 | 中国辐射防护研究院 | Purposes of the LY6G5C genes as the molecular marked compound of heavy ion radiation exposure diagnosis |
Non-Patent Citations (3)
| Title |
|---|
| Genetic alterations after carbon ion irradiation in human lung adenocarcinoma cells;Emmanouil Fokas等;《Int J Oncol》;20110131;第38卷(第1期);第161-168页 * |
| Genetic changes in progeny of bystander human fibroblasts after microbeam irradiation with X-rays, protons or carbon ions: the relevance to cancer risk;Narongchai Autsavapromporn等;《Int J Radiat Biol》;20150131;第91卷(第1期);第62-70页 * |
| 循环血microRNA对辐射和辐射防护药物的敏感性研究;危文俊等;《载人航天》;20160405;第22卷(第2期);第246-253页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109837336A (en) | 2019-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Durakoviæ | On depleted uranium: gulf war and Balkan syndrome | |
| Rukhadze et al. | New limits on double beta decay of 106Cd | |
| De Lellis et al. | Measurement of the fragmentation of Carbon nuclei used in hadron-therapy | |
| Turtoi et al. | Gene expression profile of human lymphocytes exposed to 211at α particles | |
| CN109837336B (en) | Radiation sensitive gene marker and application thereof in identification of high LET radiation | |
| Polettini et al. | DESPEC Phase-0 campaign at GSI | |
| Durante et al. | Influence of the shielding on the induction of chromosomal aberrations in human lymphocytes exposed to high-energy iron ions | |
| Isaev et al. | Comparative Study of Spontaneous-Fission Characteristics of 252 No and 254 No Isotopes | |
| Bowen | The determination of chromium in biological material by radioactivation | |
| CN109825568B (en) | Radiation sensitive gene marker and application thereof in identifying low LET (low-LET-rate) ray radiation | |
| Ray et al. | Radiation and health effects | |
| Sun et al. | Space radiation systems biology research in SJ-10 Satellite | |
| CN109913542B (en) | Radiation sensitive gene marker and application thereof in monitoring of radiation doses of different types of rays | |
| Meinke et al. | High-energy excitation functions in the heavy region | |
| Glover et al. | Determination of isotopic thorium in biological samples by combined alpha-spectrometry and neutron activation analysis | |
| Micke et al. | Relative cytogenetic efficiency of muons and π-mesons in Zea mays (L.) | |
| Durante | Potential Applications of Biomarkers of Radiation Exposure in Nuclear Terrorism Event | |
| RU2743417C1 (en) | Method for determination of the absorbed dose of recoil nuclei | |
| Komatsu | Contemporary Radiobiology | |
| Polettini et al. | UWS Academic Portal | |
| Lyon | Practical applications of activation analysis and other nuclear techniques | |
| Tagliapietra et al. | RNA Identification and Detection of Nucleic Acids as Aerosols in Air Samples by Means of Photon and Electron Interactions | |
| Yagi | Analysis of Biological Samples with Charged-Particle Accelerators | |
| Pathak | Metabolic and Biological Effects of Deposited Radionuclides | |
| CN107015261A (en) | A kind of detection method of 6.5Gy ionising radiations |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |