CN109836481B - Gene for regulating fertility of female organ of rice, and coding protein and application thereof - Google Patents

Abstract

The invention discloses a gene for regulating and controlling fertility of a rice female organ, and a coding protein and application thereof, wherein the gene for regulating and controlling the fertility of the rice female organ is an OsMLH3 gene; the sequence of the OsMLH3 gene is the nucleotide sequence of SEQ ID NO. 3. The amino acid sequence of the protein coded by the OsMLH3 gene is the nucleotide sequence of SEQ ID NO. 4. The OsMLH3 gene can be applied to regulating and controlling fertility of female organs of rice and breeding a new rice female sterile restorer line.

Description

Gene for regulating fertility of female organ of rice, and coding protein and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a gene for regulating and controlling fertility of female organs of rice, and a coding protein and application thereof.

Background

Heterosis utilization is a main way for improving the yield of rice, and is subject to the continuous development process from a three-line method to a two-line method and super hybrid rice cultivation in recent years; breeders are also expected to be able to exploit apomixis in the future to exploit and fix distant hybrid vigor (Yuanlongping, 1987). Fertility of the female reproductive system is the basis of yield formation and heterosis utilization and is also the core of research related to apomixis. The discovery and research of the female sterile gene have important scientific significance. The current hybrid seed production technology is mainly a manual fine operation type technology which is built and developed in the last 70 th century, has complicated procedures, wastes time and labor, and is increasingly not suitable for the development requirement of modern agricultural production modes. The method uses female sterile male fertile material as male parent (only solving the problem of self breeding), uses three-line or two-line sterile line as female parent, and adopts mixed sowing and mixed harvesting so as to create conditions for realizing whole-course mechanization of hybrid rice seed production. Therefore, the discovery of female sterile gene resources and basic research have important practical significance.

The pistil of rice is composed of stigmas, style and ovary. The female reproductive organ of rice mainly refers to the development of an ovary. The ovary has a raw ovule inside which the blastocyst will be formed. The ovule comprises a nucellus, a peripearl, a stigma, a closed point and a pearl hole. Female gametocyte formation is the end result of a series of cellular differentiation developmental processes, including differentiation of archesporial cells, meiosis of megasporocytes, mitosis of functional megaspores, selection of gametocyte fate and differentiation of its function, etc. (yankee and stony george, 2007). Errors in either step can lead to female sterility in rice. Little is currently known about the genes regulating the occurrence of plant female sporophytes, gametophytes and their function. The genes involved in the development of female gametophytes have been cloned mainly from Arabidopsis thaliana and maize (Yang et al, 2010).

The gene OsMLH3 for regulating rice female organ fertility is obtained by constructing an F2 positioning population by using a rice female sterile material (fsv1), and the genetic locus abortion is a main reason for mutant female sterility.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides an OsMLH3 gene for regulating and controlling rice female organ fertility and a protein coded by the OsMLH3 gene, and the OsMLH3 gene provided by the invention can be applied to regulating and controlling rice female organ fertility.

In order to solve the technical problems, the invention provides a gene for regulating and controlling fertility of female organs of rice, wherein the gene is OsMLH3 gene; the sequence of the OsMLH3 gene is a nucleotide sequence of SEQ ID NO. 3.

As a general technical concept, the invention also provides a protein, the protein is obtained by encoding the OsMLH3 gene, and the amino acid sequence of the protein is the nucleotide sequence of SEQ ID NO. 4.

As a general technical concept, the invention also provides application of the OsMLH3 gene in regulation and control of fertility of female organs of rice.

In the above application, preferably, the application method is: OsMLH3 gene is knocked out by Cas9 technology, and a new rice female sterile restorer line is cultivated.

In the above application, preferably, the application method is: by the aid of molecular marker, the rice variety with dark glume is bred through selective hybridization, and a new rice female sterility restoring line can be cultivated.

Compared with the prior art, the invention has the advantages that:

(1) the invention provides an OsMLH3 gene, the protein coded by the gene has obvious effect on controlling fertility of female organs of rice, and the gene can be used for generating a rice female sterile restorer line by means of genetic engineering to produce hybrid seeds and carry out recurrent selection, thereby having very important application prospect in agricultural production.

(2) The invention provides an application of OsMLH3 gene in regulation of rice female organ fertility, wherein the protein gene for regulating rice female organ fertility is utilized to select a dark glume rice variety (or a small-grain variety) through molecular marker assisted hybrid transformation, or the OsMLH3 gene of the variety is knocked out by using a Cas9 technology, so that a new rice female sterile restorer line can be cultivated, on one hand, the restorer line has a maturing rate of about 20 percent and can be used for self-propagation, on the other hand, the restorer line can be mixed-sown and mixed-harvested with a male sterile line according to a certain proportion, a small amount of restorer line selfed seeds are removed through mechanical color selection (grain selection), large-scale mixed-sowing mixed-harvesting mechanical seed production is realized, and the application in agricultural production is very important.

Drawings

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention.

FIG. 1 is a schematic diagram of morphological observations of fsv1 mutant plants, wherein A is wild type (G99) and mutant (fsv1) plants; b is wild type (G99) and mutant (fsv1) spike; c is wild type (G99) pollen; d is mutant (fsv1) pollen.

FIG. 2 is a schematic diagram showing the gene mapping of OsMLH 3.

FIG. 3 is a comparison graph of the sequencing of wild type (G99) and mutant (fsv1) plants in example 2 of the present invention.

FIG. 4 is a confocal laser microscopy of the ovary squashes of wild type (G99) and mutant (fsv1) plants.

FIG. 5 is a diagram showing the result of quantitative RT-PCR analysis of the roots, stems, leaves and ears of wild type plants.

Detailed Description

The invention is further described below with reference to the drawings and specific preferred embodiments of the description, without thereby limiting the scope of protection of the invention.

The materials and equipment used in the following examples are commercially available.

Example 1:

a protein coding sequence OsMLH3 for regulating and controlling fertility of female organs of rice is mainly obtained by adopting the following method:

(1) obtaining a mutant: introducing genome DNA of apomictic millet (Panicum maximum) into a hybrid rice restorer line Gui 99 by a spike-stem injection method, obtaining 1 female sterile male fertile variant strain from the offspring, selfing the variant strain for multiple generations, and temporarily naming the variant strain as fsv 1.

The mutant fsv1 is found to have the following characteristics: the female sterility character can be stably inherited, and the maturing rate of mutant parents in Changsha and Hainan is kept between 15 and 20 percent for years; the pollen is fertile, and is hybridized with a male sterile line, and F1 fertility is normal; an F2 genetic group is constructed by fsv1 and japonica rice 02428, the F1 generation is all fertile, the inbred F2 generation is separated, wherein the proportion of a normal plant and a mutant plant is close to 3: 1 (X), the normal plant is 593, the mutant plant is 207, and the normal plant and the mutant plant are in a ratio of 3: 1²＝0.454<3.84), indicating that the female sterility trait is controlled by a pair of recessive genes. The mutant fsv1 has been selfed continuously for more than 30 generations so far and is genetically stable.

Morphological observations of fsv1 mutant plants. As shown in FIG. 1, the wild type (G99) and mutant (fsv1) plants are compared with the ears in the mature period, and the comparison is mainly characterized by the reduction of the seed setting rate of the mutant.

(2) Extracting DNA of rice: hybridizing a parent of a mutant plant (fsv1) with a japonica rice variety 02428 to obtain an F1 generation, selfing an F1 generation to obtain an F2 generation, planting an F2 population, and selecting plants with a fruiting rate of less than 20% as a positioning population at a filling maturity stage. And extracting the rice DNA of the positioned population by adopting an improved CTAB small quantity extraction method.

The method comprises the following steps: taking 3-4 cm leaves of the fresh rice of the positioned group, putting the leaves into a 2ml centrifugal tube, adding steel beads, quickly freezing by liquid nitrogen, and mashing. Add 600. mu.L of DNA extraction buffer (2 × CTAB) to the tube and incubate in a 65 ℃ water bath for 30min, reversing 2 times during the incubation. Adding 600 μ l of mixed solution of chloroform and isoamyl alcohol (the volume ratio of chloroform to isoamyl alcohol is 24: 1), and turning upside down for several times until the lower layer liquid phase is dark green; then centrifuged at 12000rpm for 10 min. Taking 400 μ l of centrifuged supernatant, placing in a new 1.5ml centrifuge tube (adding 400 μ l of isopropanol at-20 deg.C, pre-cooling), mixing, standing at room temperature for 10min (or centrifuging at 12000rpm at-20 deg.C for 10 min). Taking the precipitate after standing, washing with 75% ethanol, and naturally drying overnight; then dissolved in double distilled water (or TE) and kept at 4 ℃ for later use.

(3) Molecular marker analysis: and (3) performing PCR amplification by taking the rice DNA extracted in the step (2) as a template to obtain a PCR amplification product.

The 10. mu.l PCR amplification reaction system was: 10 × Buffer: 1 mul;

MgCl₂(25mM)：0.6μl；

dNTP(1mM)：0.2μl；

primer F (2 pmol/. mu.l): 1 mul;

primer R (2 pmol/. mu.l): 1 mul;

rTaq (5U/. mu.l) enzyme (TaKaRa, Dalian). 0.1 μ l;

rice DNA (20 ng/. mu.l): 1 mul;

ddH₂O：6.1μl。

the amplification reaction was performed on a PTC-200(MJ Research Inc.) PCR instrument by the following procedure: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 30s, and 35 cycles of denaturation, annealing and extension; and (3) extending for 5min at 72 ℃ to obtain a PCR product.

And (3) carrying out 8% polyacrylamide gel electrophoresis on the PCR product for 80min at a constant voltage of 200V. Dyeing by a silver dyeing method, which comprises the following steps: 200ml of distilled water was added to the staining box, and then the gel was discharged into the box and rinsed once. Weighing 0.3g AgNO by using a special silver nitrate cup₃Pouring the solution along the edge of the dyeing box after dissolution, and shaking for 5-8 min. Pouring out the fixing solution, adding distilled water, rinsing for 2 times, and pouring out the distilled water after cleaning. Weighing 3g of NaOH by using a special cup for developing solution, adding 200ml of distilled water for dissolving, adding 1.5ml of formaldehyde, uniformly mixing, pouring along the edge of a dyeing box, and shaking until a clear strip appears, wherein the time is about 8-10 minutes. After the development was clear, the developer was poured off, the gel was rinsed 2 times with tap water (tap water was added along the edge of the box), and the developer was completely removed. In order to avoid color change during storage, the preservative film is used for encapsulating, counting tape types and taking pictures for storage.

(4) Group segregation method for fine positioning female sterile gene: according to the molecular marker analysis method in the step (3), primers are selected firstly, PCR amplification is carried out, the banding patterns of each primer in two parents and population individuals are analyzed through gel electrophoresis, the genetic distance is calculated by utilizing Mapmarker3.0 according to the banding patterns, and the linkage relation is determined. The specific operation is as follows: is divided into two parts from 520Sub-tagged primers (from)www.gramene.org general SSRMolecular marker primers) 144 pairs of SSR, In/Del markers showing polymorphisms between fsv1 and 02428 were screened, with an average of 12 markers per chromosome and an average of 2.65M polymorphic markers across the whole genome. Constructing a mixed pool of 10 female sterile individuals, and screening 9 # chromosomes RM278 and RM3787 to be linked with target genes by using the 144 pairs of polymorphic markers.

Using the sterile 416 strain of the F2 population as the preliminary mapping population, the target gene was locked between RM24751 and RM24766 at a physical distance of 261 kb. In this section, the In/Del marker, SSR marker 9-22598, 9-22721, M1, M2, M3 and M4 are designed on NCBI by using nippon and 9311 sequence alignment and parent fsv1 and 02428 sequencing sequence alignment, the recessive mutation population is expanded to 3018 strains, the female sterile individuals In the population are located by using the molecular markers for genotype analysis, a linkage map of the molecular markers of the target gene region is constructed by using mapbrawv2.1, and finally the gene causing female sterility is finely located between the markers 9-22721 and M4 and respectively located on clones OJ1210_ a07 and P0489D11, and the physical distance is 20kb (see fig. 2 for specific location). See table 1 for primer sequences:

table 1: primer sequence Listing

(5) Cloning of OsMLH3 gene. Sequencing of 4 genes in the 20kb range separately revealed that ORF1(OsMLH3 gene; Os09g0551900) had a single base mutation in the longest exon and that there was a single base mutation from TGC (WT) to TGA (fsv1) which resulted in the formation of a stop codon during translation leading to premature termination of protein translation and loss of protein function. The OsMLH3 gene is cloned, and the specific steps are as follows:

extracting wild type Gui 99 young ear RNA, reverse transcribing into cDNA, and performing PCR amplification by using the cDNA as a template, wherein the specific steps are as follows:

designing a PCR primer: OsMLH 3-F: 5'-ATGATGGTATGCCTTTATAGCTTTGTACC-3', respectively;

OsMLH3-R：5’-CTACAGGCCACCACGTAGCTTTCT-3’。

and (3) PCR reaction system:

OsMLH3-F(10pmol/μl)：1.5μl；

OsMLH3-F(10pmol/μl)：1.5μl；

KOD FXneo Hi-Enzyme (1.0U/. mu.l): 1 mul;

2×KOD FX neo buffer：25μl

dNTP(2mM)：10μl

cDNA(200ng/μl)：1.5μl；

ddH₂O：9.5μl。

reaction procedure: 94 ℃ for 2 min; 1 time; 98 deg.C, 10sec, 68 deg.C, 2 min; 40 times; at 68 deg.C for 5min, 1 time. And (3) sending the PCR product to a biological company for sequencing to obtain the coding region sequence of the OsMLH3 gene.

The full-length CDS (3588bp) sequence of the OsMLH3 gene is shown in SEQ ID No.1, and the specific sequence is as follows:

atgcagacaataaaacggttgccgaaaagtgtccatagctcgttgcgctcaagcattgttctatttgacctatcaagggttgttgaggagctggtatataatagcattgacgcaaatgcgagcaagattgacatctcagtgaatgccagagcatgttatgttaaagtggaagatgatggctgtggtattactcgtgacgaactggttcttgtaggagaaaaatatgcaacatccaagtttcataatgtcatggttgatggggaacctagttccagaagttttggattaaatggcgaagcactcgcatcactatctgatatctctgttgttgaagtcaggacaaaagctcgcgggcgaccaaattcatattgcaagataataaagggatccaaatgctcacacctgggaatagatgagcagagggaagttgttggaaccacagttattgttcgcgagcttttttacaatcaacctgtacgcaggaaacaaatgcaatctagttacaaaagagaactacatcttgtgaagaagtctgttctgcgagttgcactcattcatccacaagtttcactcagactttttgatattgagagtgaagatgagttgctatacacgattccttcatcctcccccttgactcttgtatcaaacattttggggaaaaatgtctccagctgtcttcatgagatagctacctctgacaagcattttgctctttcagggcacatctccagaccaacagatgtgttctgtaataaggatttccagtacttgtatatcaactcaagattcgtcagtaaaagcccaatccacaatatgctcaataacctggcatctagttttcaatcttctgcaaggaatgaggaaattgatgttcggagtaagaagaggcagaagaatgaagtctaccctgcatatctgctaaacttgtgctgtcctagatcaagctatgatctacattttgagccttcacagactattgtggaattcaaggattggcaaactgtcatgtatttctttgaacgaactatcacagactattggaagaagcatgcacctcaactgccagaagtgaaagctattggcaatgatacctgtgtgcctttggaaagagatgtgaaatcaagtcaggaactgttaaggcgtcatggtgtgcagaagaaagaagatgtcgctgaattgtaccaaacagctctgcagaagaatacagtacgagacatgaattttgatacagctgccccagcagaacctaaagacaattacctttctttggatatggagccatccacatggcgtgcctgctatgaccagatcagtgatgcatcccacacagatgatgttgctaggaatggtcggaaatttggtcataagcaaatatgttcccttcaaagttatagttatcagtggttagaggacggctcttccctgttagaagactctgatctttcaagtgctaacccaactatttgtaaaatgcaaaagacagaagatatattccatgggcatgcatattctggtaagtttggactgctacaagatgcagaaatcgaaatcggtccagaaattaaactccaagaatattgctttgaatctcccaataaactgaacagaatgacctgcgattttgtgcaaaagcaaaccaaaatagaggcacacatttcaggccgtgatggattctatgttgattttgataaattgaacgaggactgtctactcaatgagatatcaaagacaatcactgatgtttcctgccctcaaatgccacactttaatgatggactctgtcctgaggacgttggctcctccaagagttcctgtagtgtcaggaagtctagtaaaaggcaaaatagtgctaatgcaattgcccagatgaagttccatgatatgcaagcagtttgcgaaagtggttacatggataggtccttcatcaaggatacatgtggccttcatttctttcatccattctcgttggctgatacacctcgcagtcacagtcgtgcaaggattgacttggaattgcatggaaggtcaaatgaaagcattaacagttggaaccgtgaaaatattggcactgattttggatttacttcagacaggtttaatattgattcatcaatgatttttgaaggaagcaaacatctcaataactttggcaatggaactcaatctcctagttacttcaatcatgaatattgttctgtcggtcagtttgcttccaaacaggatcggatacccttgaaatcaaaacatgatgcaagaatgtcatatgatatttctcctgagaaaagttctactggttgtcatttgaatgtttctttttcccaagtggcaaaaagcagcaagcttactgaagatcagtatggatgcagtcagaggcccaggctttccagaggtagatataggagtcgttctgcaccaccattttacagaggcaaaagaaaattccctagattaaacgaaccactaaccaaattgactacagaaggtggtaaatataccactgttaatgactcaggagatgcagatatcacacctgttcaggagtatacatcacatatgaacgcaacccaacctattcctgagacctttagcaatgacttttctgacctaaatttcagcttgaagggaaatgtcaaaatgtgcgaagagaaatgttctgatgaactcgaagattctactgcttcagatgaaataacaaaatggcgtgatgactctgaccatcatgcagtttcggagttgcaacatggtccttttgaacacgatgatgatgtacttagcatttcttatgggcccttacacctctcatgcagtgttctagttcctgaatgtattgataaaaattgctttgaggaggcaagagttttgttgcagctggataagaaatttattcctgtcatatctggggaagtactactccttgttgatcagcatgcagctgatgaaaggatacgtttggaggaactccgtcgaaaggttttatcagatgatggcagagggattacttacttggactctgaggaggacttagttctccctgagactggatttcaattgttccaaaagtatatgcaacagatccaaagttggggctggatcatcaacagtactaattcctgtgaatcattcaaaaagaacatgaacgttctgaggagacaatcgcgccgtcttactcttgctgctgttccatgtattttgggcgtcactttaacaggaaaagatcttatggacttcattcagcagcttgatgacacagatgggtcgtcagctatccccccagcggtcattcgtattctcaatttcaaggcttgcagaggtgcgatcatgtttggcgatcctctgctaccatcggagtgctctctgattatcgaagaactgaaagcaacatctctatgtttccagtgtgctcatggacgtccgaccaccgtgccgattgtgaacgtcgcatctctccgcggcgagttggcgaggctcggagcggtgaacggaaggcaagaagagacctggcatggtctctcgcaccatggacccagccttgagcgtgctcgaacgcgcctcagagaactgagaaagctacgtggtggcctgtag。

the protein sequence (1195) of OsMLH3 gene is shown in SEQ ID No.2, and is as follows:

MQTIKRLPKSVHSSLRSSIVLFDLSRVVEELVYNSIDANASKIDISVNARACYVKVEDDGCGITRDELVLVGEKYATSKFHNVMVDGEPSSRSFGLNGEALASLSDISVVEVRTKARGRPNSYCKIIKGSKCSHLGIDEQREVVGTTVIVRELFYNQPVRRKQMQSSYKRELHLVKKSVLRVALIHPQVSLRLFDIESEDELLYTIPSSSPLTLVSNILGKNVSSCLHEIATSDKHFALSGHISRPTDVFCNKDFQYLYINSRFVSKSPIHNMLNNLASSFQSSARNEEIDVRSKKRQKNEVYPAYLLNLCCPRSSYDLHFEPSQTIVEFKDWQTVMYFFERTITDYWKKHAPQLPEVKAIGNDTCVPLERDVKSSQELLRRHGVQKKEDVAELYQTALQKNTVRDMNFDTAAPAEPKDNYLSLDMEPSTWRACYDQISDASHTDDVARNGRKFGHKQICSLQSYSYQWLEDGSSLLEDSDLSSANPTICKMQKTEDIFHGHAYSGKFGLLQDAEIEIGPEIKLQEYCFESPNKLNRMTCDFVQKQTKIEAHISGRDGFYVDFDKLNEDCLLNEISKTITDVSCPQMPHFNDGLCPEDVGSSKSSCSVRKSSKRQNSANAIAQMKFHDMQAVCESGYMDRSFIKDTCGLHFFHPFSLADTPRSHSRARIDLELHGRSNESINSWNRENIGTDFGFTSDRFNIDSSMIFEGSKHLNNFGNGTQSPSYFNHEYCSVGQFASKQDRIPLKSKHDARMSYDISPEKSSTGCHLNVSFSQVAKSSKLTEDQYGCSQRPRLSRGRYRSRSAPPFYRGKRKFPRLNEPLTKLTTEGGKYTTVNDSGDADITPVQEYTSHMNATQPIPETFSNDFSDLNFSLKGNVKMCEEKCSDELEDSTASDEITKWRDDSDHHAVSELQHGPFEHDDDVLSISYGPLHLSCSVLVPECIDKNCFEEARVLLQLDKKFIPVISGEVLLLVDQHAADERIRLEELRRKVLSDDGRGITYLDSEEDLVLPETGFQLFQKYMQQIQSWGWIINSTNSCESFKKNMNVLRRQSRRLTLAAVPCILGVTLTGKDLMDFIQQLDDTDGSSAIPPAVIRILNFKACRGAIMFGDPLLPSECSLIIEELKATSLCFQCAHGRPTTVPIVNVASLRGELARLGAVNGRQEETWHGLSHHGPSLERARTRLRELRKLRGGL。

the mutation position is 1899 base of CDS sequence, wild type is C, mutant is A, TGA formed after mutation is stop codon, protein translation is terminated, and protein size is truncated from 1195 amino acids to only 632 amino acids, thus forming unknown protein with loss of function.

The nucleotide sequence of the OsMLH3 gene after mutation is shown in SEQ ID No.3, and specifically comprises the following steps:

atgcagacaataaaacggttgccgaaaagtgtccatagctcgttgcgctcaagcattgttctatttgacctatcaagggttgttgaggagctggtatataatagcattgacgcaaatgcgagcaagattgacatctcagtgaatgccagagcatgttatgttaaagtggaagatgatggctgtggtattactcgtgacgaactggttcttgtaggagaaaaatatgcaacatccaagtttcataatgtcatggttgatggggaacctagttccagaagttttggattaaatggcgaagcactcgcatcactatctgatatctctgttgttgaagtcaggacaaaagctcgcgggcgaccaaattcatattgcaagataataaagggatccaaatgctcacacctgggaatagatgagcagagggaagttgttggaaccacagttattgttcgcgagcttttttacaatcaacctgtacgcaggaaacaaatgcaatctagttacaaaagagaactacatcttgtgaagaagtctgttctgcgagttgcactcattcatccacaagtttcactcagactttttgatattgagagtgaagatgagttgctatacacgattccttcatcctcccccttgactcttgtatcaaacattttggggaaaaatgtctccagctgtcttcatgagatagctacctctgacaagcattttgctctttcagggcacatctccagaccaacagatgtgttctgtaataaggatttccagtacttgtatatcaactcaagattcgtcagtaaaagcccaatccacaatatgctcaataacctggcatctagttttcaatcttctgcaaggaatgaggaaattgatgttcggagtaagaagaggcagaagaatgaagtctaccctgcatatctgctaaacttgtgctgtcctagatcaagctatgatctacattttgagccttcacagactattgtggaattcaaggattggcaaactgtcatgtatttctttgaacgaactatcacagactattggaagaagcatgcacctcaactgccagaagtgaaagctattggcaatgatacctgtgtgcctttggaaagagatgtgaaatcaagtcaggaactgttaaggcgtcatggtgtgcagaagaaagaagatgtcgctgaattgtaccaaacagctctgcagaagaatacagtacgagacatgaattttgatacagctgccccagcagaacctaaagacaattacctttctttggatatggagccatccacatggcgtgcctgctatgaccagatcagtgatgcatcccacacagatgatgttgctaggaatggtcggaaatttggtcataagcaaatatgttcccttcaaagttatagttatcagtggttagaggacggctcttccctgttagaagactctgatctttcaagtgctaacccaactatttgtaaaatgcaaaagacagaagatatattccatgggcatgcatattctggtaagtttggactgctacaagatgcagaaatcgaaatcggtccagaaattaaactccaagaatattgctttgaatctcccaataaactgaacagaatgacctgcgattttgtgcaaaagcaaaccaaaatagaggcacacatttcaggccgtgatggattctatgttgattttgataaattgaacgaggactgtctactcaatgagatatcaaagacaatcactgatgtttcctgccctcaaatgccacactttaatgatggactctgtcctgaggacgttggctcctccaagagttcctgtagtgtcaggaagtctagtaaaaggcaaaatagtgctaatgcaattgcccagatgaagttccatgatatgcaagcagtttgagaaagtggttacatggataggtccttcatcaaggatacatgtggccttcatttctttcatccattctcgttggctgatacacctcgcagtcacagtcgtgcaaggattgacttggaattgcatggaaggtcaaatgaaagcattaacagttggaaccgtgaaaatattggcactgattttggatttacttcagacaggtttaatattgattcatcaatgatttttgaaggaagcaaacatctcaataactttggcaatggaactcaatctcctagttacttcaatcatgaatattgttctgtcggtcagtttgcttccaaacaggatcggatacccttgaaatcaaaacatgatgcaagaatgtcatatgatatttctcctgagaaaagttctactggttgtcatttgaatgtttctttttcccaagtggcaaaaagcagcaagcttactgaagatcagtatggatgcagtcagaggcccaggctttccagaggtagatataggagtcgttctgcaccaccattttacagaggcaaaagaaaattccctagattaaacgaaccactaaccaaattgactacagaaggtggtaaatataccactgttaatgactcaggagatgcagatatcacacctgttcaggagtatacatcacatatgaacgcaacccaacctattcctgagacctttagcaatgacttttctgacctaaatttcagcttgaagggaaatgtcaaaatgtgcgaagagaaatgttctgatgaactcgaagattctactgcttcagatgaaataacaaaatggcgtgatgactctgaccatcatgcagtttcggagttgcaacatggtccttttgaacacgatgatgatgtacttagcatttcttatgggcccttacacctctcatgcagtgttctagttcctgaatgtattgataaaaattgctttgaggaggcaagagttttgttgcagctggataagaaatttattcctgtcatatctggggaagtactactccttgttgatcagcatgcagctgatgaaaggatacgtttggaggaactccgtcgaaaggttttatcagatgatggcagagggattacttacttggactctgaggaggacttagttctccctgagactggatttcaattgttccaaaagtatatgcaacagatccaaagttggggctggatcatcaacagtactaattcctgtgaatcattcaaaaagaacatgaacgttctgaggagacaatcgcgccgtcttactcttgctgctgttccatgtattttgggcgtcactttaacaggaaaagatcttatggacttcattcagcagcttgatgacacagatgggtcgtcagctatccccccagcggtcattcgtattctcaatttcaaggcttgcagaggtgcgatcatgtttggcgatcctctgctaccatcggagtgctctctgattatcgaagaactgaaagcaacatctctatgtttccagtgtgctcatggacgtccgaccaccgtgccgattgtgaacgtcgcatctctccgcggcgagttggcgaggctcggagcggtgaacggaaggcaagaagagacctggcatggtctctcgcaccatggacccagccttgagcgtgctcgaacgcgcctcagagaactgagaaagctacgtggtggcctgtag。

the protein sequence after OsMLH3 gene mutation is shown in SEQ ID No.4, and specifically comprises the following steps:

MQTIKRLPKSVHSSLRSSIVLFDLSRVVEELVYNSIDANASKIDISVNARACYVKVEDDGCGITRDELVLVGEKYATSKFHNVMVDGEPSSRSFGLNGEALASLSDISVVEVRTKARGRPNSYCKIIKGSKCSHLGIDEQREVVGTTVIVRELFYNQPVRRKQMQSSYKRELHLVKKSVLRVALIHPQVSLRLFDIESEDELLYTIPSSSPLTLVSNILGKNVSSCLHEIATSDKHFALSGHISRPTDVFCNKDFQYLYINSRFVSKSPIHNMLNNLASSFQSSARNEEIDVRSKKRQKNEVYPAYLLNLCCPRSSYDLHFEPSQTIVEFKDWQTVMYFFERTITDYWKKHAPQLPEVKAIGNDTCVPLERDVKSSQELLRRHGVQKKEDVAELYQTALQKNTVRDMNFDTAAPAEPKDNYLSLDMEPSTWRACYDQISDASHTDDVARNGRKFGHKQICSLQSYSYQWLEDGSSLLEDSDLSSANPTICKMQKTEDIFHGHAYSGKFGLLQDAEIEIGPEIKLQEYCFESPNKLNRMTCDFVQKQTKIEAHISGRDGFYVDFDKLNEDCLLNEISKTITDVSCPQMPHFNDGLCPEDVGSSKSSCSVRKSSKRQNSANAIAQMKFHDMQAV。

example 2

The wild type plant (G99) and the mutant plant (fsv1) were sequenced, and the sequencing results are shown in FIG. 3. As can be seen from fig. 3: the presence of a single base mutation from TGC (WT) to TGA (fsv1) in exon 13 of the OsMLH3 gene of the mutant plant (fsv1) will form a stop codon, causing premature termination of protein translation.

Example 3

Through observation of an ovary tabletting laser confocal microscope of a wild-type plant (G99) and a mutant plant (fsv1) at different development stages, the development processes of embryo sacs of the wild-type plant (G99) and the mutant plant (fsv1) are compared, and fig. 4 is an ovary picture of the wild-type plant (G99) and the mutant plant (fsv1) at different development stages, and it is found that the wild-type plant (G99) and the mutant plant (fsv1) have no difference before functional megaspores but enter the mitotic stage of the functional megaspores, the functional megaspores of the mutant plant (fsv1) gradually degenerate and can not form normal octanuclear embryo sacs.

Example 4

Quantitative RT-PCR analysis of the expression profile in wild type plants, the results are shown in FIG. 5. As can be seen from fig. 5: OsMLH3 is constitutively expressed and is expressed in roots, stems, leaves and ears. The GUS tissue staining result of the transgenic plant with the promoter connected with the GUS reporter gene is consistent with the RT-PCR result, but the expression part in the glumous flower is mainly concentrated in the ovary.

Example 5

The function of the OsMLH3 gene for regulating the fertility of rice female organs is verified through a genome complementation experiment:

amplifying 12835b genome complementary fragments comprising candidate genes and promoter regions of the genes with about 2.5kb and downstream 0.5kb by using KOD FXneo enzyme,

the primers are as follows: cMLH3F 1: aattcgagctcggtacccggggatccCTGTGATTCGAGCTGTAACCTGTCC (containing BamHI endonuclease sites);

cMLH3R 1: aacgacggccagtgccaagcttGTGGAGGAGAGAGAGATGGGGAATT (containing HindIII endonuclease sites);

the expression vector pCAMBIA1300 was digested with BamHI and HindIII, and then the genome complementary fragment and the digested pCAMBIA1300 vector fragment were recombinantly ligated with an In-fusion kit (Clontech) to construct a genome complementary expression vector. The mutant parent fsv1 is transformed by the recombinant vector, and the seed setting rate of the T0 generation plant is obviously recovered and is close to that of the wild cinnamon 99. The setting rate of the contrast osmanthus fragrans 99 is 82%, the setting rate of the complementary single plant of the T0 generation is 77%, and the setting rate of the mutant is 18%.

In addition, an overexpression vector containing the full-length cDNA of the wild type OsMLH3 gene is constructed, the seed setting rate of a positive transgenic plant of the T0 generation is obviously recovered by transforming the mutant parent fsv 1. The setting rate of the contrast osmanthus fragrans 99 is 87%, the setting rate of the transgenic plants of the T0 generation is 80%, and the setting rate of the mutant is 17%.

The OsMLH3 gene is shown to be a gene for controlling the development of female organs of rice.

The foregoing is merely a preferred embodiment of the invention and is not intended to limit the invention in any manner. Although the present invention has been described with reference to the preferred embodiments, it is not intended to be limited thereto. Those skilled in the art can make many possible variations and modifications to the disclosed embodiments, or equivalent modifications, without departing from the spirit and scope of the invention, using the methods and techniques disclosed above. Therefore, any simple modification, equivalent replacement, equivalent change and modification made to the above embodiments according to the technical essence of the present invention are still within the scope of the protection of the technical solution of the present invention.

<110> research center for hybrid rice in Hunan province

<120> gene for regulating fertility of rice female organ, and coding protein and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3588

<212> DNA

<213> Rice (Rice)

<400> 1

atgcagacaa taaaacggtt gccgaaaagt gtccatagct cgttgcgctc aagcattgtt 60

ctatttgacc tatcaagggt tgttgaggag ctggtatata atagcattga cgcaaatgcg 120

agcaagattg acatctcagt gaatgccaga gcatgttatg ttaaagtgga agatgatggc 180

tgtggtatta ctcgtgacga actggttctt gtaggagaaa aatatgcaac atccaagttt 240

cataatgtca tggttgatgg ggaacctagt tccagaagtt ttggattaaa tggcgaagca 300

ctcgcatcac tatctgatat ctctgttgtt gaagtcagga caaaagctcg cgggcgacca 360

aattcatatt gcaagataat aaagggatcc aaatgctcac acctgggaat agatgagcag 420

agggaagttg ttggaaccac agttattgtt cgcgagcttt tttacaatca acctgtacgc 480

aggaaacaaa tgcaatctag ttacaaaaga gaactacatc ttgtgaagaa gtctgttctg 540

cgagttgcac tcattcatcc acaagtttca ctcagacttt ttgatattga gagtgaagat 600

gagttgctat acacgattcc ttcatcctcc cccttgactc ttgtatcaaa cattttgggg 660

aaaaatgtct ccagctgtct tcatgagata gctacctctg acaagcattt tgctctttca 720

gggcacatct ccagaccaac agatgtgttc tgtaataagg atttccagta cttgtatatc 780

aactcaagat tcgtcagtaa aagcccaatc cacaatatgc tcaataacct ggcatctagt 840

tttcaatctt ctgcaaggaa tgaggaaatt gatgttcgga gtaagaagag gcagaagaat 900

gaagtctacc ctgcatatct gctaaacttg tgctgtccta gatcaagcta tgatctacat 960

tttgagcctt cacagactat tgtggaattc aaggattggc aaactgtcat gtatttcttt 1020

gaacgaacta tcacagacta ttggaagaag catgcacctc aactgccaga agtgaaagct 1080

attggcaatg atacctgtgt gcctttggaa agagatgtga aatcaagtca ggaactgtta 1140

aggcgtcatg gtgtgcagaa gaaagaagat gtcgctgaat tgtaccaaac agctctgcag 1200

aagaatacag tacgagacat gaattttgat acagctgccc cagcagaacc taaagacaat 1260

tacctttctt tggatatgga gccatccaca tggcgtgcct gctatgacca gatcagtgat 1320

gcatcccaca cagatgatgt tgctaggaat ggtcggaaat ttggtcataa gcaaatatgt 1380

tcccttcaaa gttatagtta tcagtggtta gaggacggct cttccctgtt agaagactct 1440

gatctttcaa gtgctaaccc aactatttgt aaaatgcaaa agacagaaga tatattccat 1500

gggcatgcat attctggtaa gtttggactg ctacaagatg cagaaatcga aatcggtcca 1560

gaaattaaac tccaagaata ttgctttgaa tctcccaata aactgaacag aatgacctgc 1620

gattttgtgc aaaagcaaac caaaatagag gcacacattt caggccgtga tggattctat 1680

gttgattttg ataaattgaa cgaggactgt ctactcaatg agatatcaaa gacaatcact 1740

gatgtttcct gccctcaaat gccacacttt aatgatggac tctgtcctga ggacgttggc 1800

tcctccaaga gttcctgtag tgtcaggaag tctagtaaaa ggcaaaatag tgctaatgca 1860

attgcccaga tgaagttcca tgatatgcaa gcagtttgcg aaagtggtta catggatagg 1920

tccttcatca aggatacatg tggccttcat ttctttcatc cattctcgtt ggctgataca 1980

cctcgcagtc acagtcgtgc aaggattgac ttggaattgc atggaaggtc aaatgaaagc 2040

attaacagtt ggaaccgtga aaatattggc actgattttg gatttacttc agacaggttt 2100

aatattgatt catcaatgat ttttgaagga agcaaacatc tcaataactt tggcaatgga 2160

actcaatctc ctagttactt caatcatgaa tattgttctg tcggtcagtt tgcttccaaa 2220

caggatcgga tacccttgaa atcaaaacat gatgcaagaa tgtcatatga tatttctcct 2280

gagaaaagtt ctactggttg tcatttgaat gtttcttttt cccaagtggc aaaaagcagc 2340

aagcttactg aagatcagta tggatgcagt cagaggccca ggctttccag aggtagatat 2400

aggagtcgtt ctgcaccacc attttacaga ggcaaaagaa aattccctag attaaacgaa 2460

ccactaacca aattgactac agaaggtggt aaatatacca ctgttaatga ctcaggagat 2520

gcagatatca cacctgttca ggagtataca tcacatatga acgcaaccca acctattcct 2580

gagaccttta gcaatgactt ttctgaccta aatttcagct tgaagggaaa tgtcaaaatg 2640

tgcgaagaga aatgttctga tgaactcgaa gattctactg cttcagatga aataacaaaa 2700

tggcgtgatg actctgacca tcatgcagtt tcggagttgc aacatggtcc ttttgaacac 2760

gatgatgatg tacttagcat ttcttatggg cccttacacc tctcatgcag tgttctagtt 2820

cctgaatgta ttgataaaaa ttgctttgag gaggcaagag ttttgttgca gctggataag 2880

aaatttattc ctgtcatatc tggggaagta ctactccttg ttgatcagca tgcagctgat 2940

gaaaggatac gtttggagga actccgtcga aaggttttat cagatgatgg cagagggatt 3000

acttacttgg actctgagga ggacttagtt ctccctgaga ctggatttca attgttccaa 3060

aagtatatgc aacagatcca aagttggggc tggatcatca acagtactaa ttcctgtgaa 3120

tcattcaaaa agaacatgaa cgttctgagg agacaatcgc gccgtcttac tcttgctgct 3180

gttccatgta ttttgggcgt cactttaaca ggaaaagatc ttatggactt cattcagcag 3240

cttgatgaca cagatgggtc gtcagctatc cccccagcgg tcattcgtat tctcaatttc 3300

aaggcttgca gaggtgcgat catgtttggc gatcctctgc taccatcgga gtgctctctg 3360

attatcgaag aactgaaagc aacatctcta tgtttccagt gtgctcatgg acgtccgacc 3420

accgtgccga ttgtgaacgt cgcatctctc cgcggcgagt tggcgaggct cggagcggtg 3480

aacggaaggc aagaagagac ctggcatggt ctctcgcacc atggacccag ccttgagcgt 3540

gctcgaacgc gcctcagaga actgagaaag ctacgtggtg gcctgtag 3588

<210> 2

<211> 1195

<212> PRT

<213> Rice (Rice)

<400> 2

Met Gln Thr Ile Lys Arg Leu Pro Lys Ser Val His Ser Ser Leu Arg

1 5 10 15

Ser Ser Ile Val Leu Phe Asp Leu Ser Arg Val Val Glu Glu Leu Val

20 25 30

Tyr Asn Ser Ile Asp Ala Asn Ala Ser Lys Ile Asp Ile Ser Val Asn

35 40 45

Ala Arg Ala Cys Tyr Val Lys Val Glu Asp Asp Gly Cys Gly Ile Thr

50 55 60

Arg Asp Glu Leu Val Leu Val Gly Glu Lys Tyr Ala Thr Ser Lys Phe

65 70 75 80

His Asn Val Met Val Asp Gly Glu Pro Ser Ser Arg Ser Phe Gly Leu

85 90 95

Asn Gly Glu Ala Leu Ala Ser Leu Ser Asp Ile Ser Val Val Glu Val

100 105 110

Arg Thr Lys Ala Arg Gly Arg Pro Asn Ser Tyr Cys Lys Ile Ile Lys

115 120 125

Gly Ser Lys Cys Ser His Leu Gly Ile Asp Glu Gln Arg Glu Val Val

130 135 140

Gly Thr Thr Val Ile Val Arg Glu Leu Phe Tyr Asn Gln Pro Val Arg

145 150 155 160

Arg Lys Gln Met Gln Ser Ser Tyr Lys Arg Glu Leu His Leu Val Lys

165 170 175

Lys Ser Val Leu Arg Val Ala Leu Ile His Pro Gln Val Ser Leu Arg

180 185 190

Leu Phe Asp Ile Glu Ser Glu Asp Glu Leu Leu Tyr Thr Ile Pro Ser

195 200 205

Ser Ser Pro Leu Thr Leu Val Ser Asn Ile Leu Gly Lys Asn Val Ser

210 215 220

Ser Cys Leu His Glu Ile Ala Thr Ser Asp Lys His Phe Ala Leu Ser

225 230 235 240

Gly His Ile Ser Arg Pro Thr Asp Val Phe Cys Asn Lys Asp Phe Gln

245 250 255

Tyr Leu Tyr Ile Asn Ser Arg Phe Val Ser Lys Ser Pro Ile His Asn

260 265 270

Met Leu Asn Asn Leu Ala Ser Ser Phe Gln Ser Ser Ala Arg Asn Glu

275 280 285

Glu Ile Asp Val Arg Ser Lys Lys Arg Gln Lys Asn Glu Val Tyr Pro

290 295 300

Ala Tyr Leu Leu Asn Leu Cys Cys Pro Arg Ser Ser Tyr Asp Leu His

305 310 315 320

Phe Glu Pro Ser Gln Thr Ile Val Glu Phe Lys Asp Trp Gln Thr Val

325 330 335

Met Tyr Phe Phe Glu Arg Thr Ile Thr Asp Tyr Trp Lys Lys His Ala

340 345 350

Pro Gln Leu Pro Glu Val Lys Ala Ile Gly Asn Asp Thr Cys Val Pro

355 360 365

Leu Glu Arg Asp Val Lys Ser Ser Gln Glu Leu Leu Arg Arg His Gly

370 375 380

Val Gln Lys Lys Glu Asp Val Ala Glu Leu Tyr Gln Thr Ala Leu Gln

385 390 395 400

Lys Asn Thr Val Arg Asp Met Asn Phe Asp Thr Ala Ala Pro Ala Glu

405 410 415

Pro Lys Asp Asn Tyr Leu Ser Leu Asp Met Glu Pro Ser Thr Trp Arg

420 425 430

Ala Cys Tyr Asp Gln Ile Ser Asp Ala Ser His Thr Asp Asp Val Ala

435 440 445

Arg Asn Gly Arg Lys Phe Gly His Lys Gln Ile Cys Ser Leu Gln Ser

450 455 460

Tyr Ser Tyr Gln Trp Leu Glu Asp Gly Ser Ser Leu Leu Glu Asp Ser

465 470 475 480

Asp Leu Ser Ser Ala Asn Pro Thr Ile Cys Lys Met Gln Lys Thr Glu

485 490 495

Asp Ile Phe His Gly His Ala Tyr Ser Gly Lys Phe Gly Leu Leu Gln

500 505 510

Asp Ala Glu Ile Glu Ile Gly Pro Glu Ile Lys Leu Gln Glu Tyr Cys

515 520 525

Phe Glu Ser Pro Asn Lys Leu Asn Arg Met Thr Cys Asp Phe Val Gln

530 535 540

Lys Gln Thr Lys Ile Glu Ala His Ile Ser Gly Arg Asp Gly Phe Tyr

545 550 555 560

Val Asp Phe Asp Lys Leu Asn Glu Asp Cys Leu Leu Asn Glu Ile Ser

565 570 575

Lys Thr Ile Thr Asp Val Ser Cys Pro Gln Met Pro His Phe Asn Asp

580 585 590

Gly Leu Cys Pro Glu Asp Val Gly Ser Ser Lys Ser Ser Cys Ser Val

595 600 605

Arg Lys Ser Ser Lys Arg Gln Asn Ser Ala Asn Ala Ile Ala Gln Met

610 615 620

Lys Phe His Asp Met Gln Ala Val Cys Glu Ser Gly Tyr Met Asp Arg

625 630 635 640

Ser Phe Ile Lys Asp Thr Cys Gly Leu His Phe Phe His Pro Phe Ser

645 650 655

Leu Ala Asp Thr Pro Arg Ser His Ser Arg Ala Arg Ile Asp Leu Glu

660 665 670

Leu His Gly Arg Ser Asn Glu Ser Ile Asn Ser Trp Asn Arg Glu Asn

675 680 685

Ile Gly Thr Asp Phe Gly Phe Thr Ser Asp Arg Phe Asn Ile Asp Ser

690 695 700

Ser Met Ile Phe Glu Gly Ser Lys His Leu Asn Asn Phe Gly Asn Gly

705 710 715 720

Thr Gln Ser Pro Ser Tyr Phe Asn His Glu Tyr Cys Ser Val Gly Gln

725 730 735

Phe Ala Ser Lys Gln Asp Arg Ile Pro Leu Lys Ser Lys His Asp Ala

740 745 750

Arg Met Ser Tyr Asp Ile Ser Pro Glu Lys Ser Ser Thr Gly Cys His

755 760 765

Leu Asn Val Ser Phe Ser Gln Val Ala Lys Ser Ser Lys Leu Thr Glu

770 775 780

Asp Gln Tyr Gly Cys Ser Gln Arg Pro Arg Leu Ser Arg Gly Arg Tyr

785 790 795 800

Arg Ser Arg Ser Ala Pro Pro Phe Tyr Arg Gly Lys Arg Lys Phe Pro

805 810 815

Arg Leu Asn Glu Pro Leu Thr Lys Leu Thr Thr Glu Gly Gly Lys Tyr

820 825 830

Thr Thr Val Asn Asp Ser Gly Asp Ala Asp Ile Thr Pro Val Gln Glu

835 840 845

Tyr Thr Ser His Met Asn Ala Thr Gln Pro Ile Pro Glu Thr Phe Ser

850 855 860

Asn Asp Phe Ser Asp Leu Asn Phe Ser Leu Lys Gly Asn Val Lys Met

865 870 875 880

Cys Glu Glu Lys Cys Ser Asp Glu Leu Glu Asp Ser Thr Ala Ser Asp

885 890 895

Glu Ile Thr Lys Trp Arg Asp Asp Ser Asp His His Ala Val Ser Glu

900 905 910

Leu Gln His Gly Pro Phe Glu His Asp Asp Asp Val Leu Ser Ile Ser

915 920 925

Tyr Gly Pro Leu His Leu Ser Cys Ser Val Leu Val Pro Glu Cys Ile

930 935 940

Asp Lys Asn Cys Phe Glu Glu Ala Arg Val Leu Leu Gln Leu Asp Lys

945 950 955 960

Lys Phe Ile Pro Val Ile Ser Gly Glu Val Leu Leu Leu Val Asp Gln

965 970 975

His Ala Ala Asp Glu Arg Ile Arg Leu Glu Glu Leu Arg Arg Lys Val

980 985 990

Leu Ser Asp Asp Gly Arg Gly Ile Thr Tyr Leu Asp Ser Glu Glu Asp

995 1000 1005

Leu Val Leu Pro Glu Thr Gly Phe Gln Leu Phe Gln Lys Tyr Met Gln

1010 1015 1020

Gln Ile Gln Ser Trp Gly Trp Ile Ile Asn Ser Thr Asn Ser Cys Glu

1025 1030 1035 1040

Ser Phe Lys Lys Asn Met Asn Val Leu Arg Arg Gln Ser Arg Arg Leu

1045 1050 1055

Thr Leu Ala Ala Val Pro Cys Ile Leu Gly Val Thr Leu Thr Gly Lys

1060 1065 1070

Asp Leu Met Asp Phe Ile Gln Gln Leu Asp Asp Thr Asp Gly Ser Ser

1075 1080 1085

Ala Ile Pro Pro Ala Val Ile Arg Ile Leu Asn Phe Lys Ala Cys Arg

1090 1095 1100

Gly Ala Ile Met Phe Gly Asp Pro Leu Leu Pro Ser Glu Cys Ser Leu

1105 1110 1115 1120

Ile Ile Glu Glu Leu Lys Ala Thr Ser Leu Cys Phe Gln Cys Ala His

1125 1130 1135

Gly Arg Pro Thr Thr Val Pro Ile Val Asn Val Ala Ser Leu Arg Gly

1140 1145 1150

Glu Leu Ala Arg Leu Gly Ala Val Asn Gly Arg Gln Glu Glu Thr Trp

1155 1160 1165

His Gly Leu Ser His His Gly Pro Ser Leu Glu Arg Ala Arg Thr Arg

1170 1175 1180

Leu Arg Glu Leu Arg Lys Leu Arg Gly Gly Leu

1185 1190 1195

<210> 3

<211> 3588

<212> DNA

<213> Rice (Rice)

<400> 3

atgcagacaa taaaacggtt gccgaaaagt gtccatagct cgttgcgctc aagcattgtt 60

ctatttgacc tatcaagggt tgttgaggag ctggtatata atagcattga cgcaaatgcg 120

agcaagattg acatctcagt gaatgccaga gcatgttatg ttaaagtgga agatgatggc 180

tgtggtatta ctcgtgacga actggttctt gtaggagaaa aatatgcaac atccaagttt 240

cataatgtca tggttgatgg ggaacctagt tccagaagtt ttggattaaa tggcgaagca 300

ctcgcatcac tatctgatat ctctgttgtt gaagtcagga caaaagctcg cgggcgacca 360

aattcatatt gcaagataat aaagggatcc aaatgctcac acctgggaat agatgagcag 420

agggaagttg ttggaaccac agttattgtt cgcgagcttt tttacaatca acctgtacgc 480

aggaaacaaa tgcaatctag ttacaaaaga gaactacatc ttgtgaagaa gtctgttctg 540

cgagttgcac tcattcatcc acaagtttca ctcagacttt ttgatattga gagtgaagat 600

gagttgctat acacgattcc ttcatcctcc cccttgactc ttgtatcaaa cattttgggg 660

aaaaatgtct ccagctgtct tcatgagata gctacctctg acaagcattt tgctctttca 720

gggcacatct ccagaccaac agatgtgttc tgtaataagg atttccagta cttgtatatc 780

aactcaagat tcgtcagtaa aagcccaatc cacaatatgc tcaataacct ggcatctagt 840

tttcaatctt ctgcaaggaa tgaggaaatt gatgttcgga gtaagaagag gcagaagaat 900

gaagtctacc ctgcatatct gctaaacttg tgctgtccta gatcaagcta tgatctacat 960

tttgagcctt cacagactat tgtggaattc aaggattggc aaactgtcat gtatttcttt 1020

gaacgaacta tcacagacta ttggaagaag catgcacctc aactgccaga agtgaaagct 1080

attggcaatg atacctgtgt gcctttggaa agagatgtga aatcaagtca ggaactgtta 1140

aggcgtcatg gtgtgcagaa gaaagaagat gtcgctgaat tgtaccaaac agctctgcag 1200

aagaatacag tacgagacat gaattttgat acagctgccc cagcagaacc taaagacaat 1260

tacctttctt tggatatgga gccatccaca tggcgtgcct gctatgacca gatcagtgat 1320

gcatcccaca cagatgatgt tgctaggaat ggtcggaaat ttggtcataa gcaaatatgt 1380

tcccttcaaa gttatagtta tcagtggtta gaggacggct cttccctgtt agaagactct 1440

gatctttcaa gtgctaaccc aactatttgt aaaatgcaaa agacagaaga tatattccat 1500

gggcatgcat attctggtaa gtttggactg ctacaagatg cagaaatcga aatcggtcca 1560

gaaattaaac tccaagaata ttgctttgaa tctcccaata aactgaacag aatgacctgc 1620

gattttgtgc aaaagcaaac caaaatagag gcacacattt caggccgtga tggattctat 1680

gttgattttg ataaattgaa cgaggactgt ctactcaatg agatatcaaa gacaatcact 1740

gatgtttcct gccctcaaat gccacacttt aatgatggac tctgtcctga ggacgttggc 1800

tcctccaaga gttcctgtag tgtcaggaag tctagtaaaa ggcaaaatag tgctaatgca 1860

attgcccaga tgaagttcca tgatatgcaa gcagtttgag aaagtggtta catggatagg 1920

tccttcatca aggatacatg tggccttcat ttctttcatc cattctcgtt ggctgataca 1980

cctcgcagtc acagtcgtgc aaggattgac ttggaattgc atggaaggtc aaatgaaagc 2040

attaacagtt ggaaccgtga aaatattggc actgattttg gatttacttc agacaggttt 2100

aatattgatt catcaatgat ttttgaagga agcaaacatc tcaataactt tggcaatgga 2160

actcaatctc ctagttactt caatcatgaa tattgttctg tcggtcagtt tgcttccaaa 2220

caggatcgga tacccttgaa atcaaaacat gatgcaagaa tgtcatatga tatttctcct 2280

gagaaaagtt ctactggttg tcatttgaat gtttcttttt cccaagtggc aaaaagcagc 2340

aagcttactg aagatcagta tggatgcagt cagaggccca ggctttccag aggtagatat 2400

aggagtcgtt ctgcaccacc attttacaga ggcaaaagaa aattccctag attaaacgaa 2460

ccactaacca aattgactac agaaggtggt aaatatacca ctgttaatga ctcaggagat 2520

gcagatatca cacctgttca ggagtataca tcacatatga acgcaaccca acctattcct 2580

gagaccttta gcaatgactt ttctgaccta aatttcagct tgaagggaaa tgtcaaaatg 2640

tgcgaagaga aatgttctga tgaactcgaa gattctactg cttcagatga aataacaaaa 2700

tggcgtgatg actctgacca tcatgcagtt tcggagttgc aacatggtcc ttttgaacac 2760

gatgatgatg tacttagcat ttcttatggg cccttacacc tctcatgcag tgttctagtt 2820

cctgaatgta ttgataaaaa ttgctttgag gaggcaagag ttttgttgca gctggataag 2880

aaatttattc ctgtcatatc tggggaagta ctactccttg ttgatcagca tgcagctgat 2940

gaaaggatac gtttggagga actccgtcga aaggttttat cagatgatgg cagagggatt 3000

acttacttgg actctgagga ggacttagtt ctccctgaga ctggatttca attgttccaa 3060

aagtatatgc aacagatcca aagttggggc tggatcatca acagtactaa ttcctgtgaa 3120

tcattcaaaa agaacatgaa cgttctgagg agacaatcgc gccgtcttac tcttgctgct 3180

gttccatgta ttttgggcgt cactttaaca ggaaaagatc ttatggactt cattcagcag 3240

cttgatgaca cagatgggtc gtcagctatc cccccagcgg tcattcgtat tctcaatttc 3300

aaggcttgca gaggtgcgat catgtttggc gatcctctgc taccatcgga gtgctctctg 3360

attatcgaag aactgaaagc aacatctcta tgtttccagt gtgctcatgg acgtccgacc 3420

accgtgccga ttgtgaacgt cgcatctctc cgcggcgagt tggcgaggct cggagcggtg 3480

aacggaaggc aagaagagac ctggcatggt ctctcgcacc atggacccag ccttgagcgt 3540

gctcgaacgc gcctcagaga actgagaaag ctacgtggtg gcctgtag 3588

<210> 4

<211> 632

<212> PRT

<213> Rice (Rice)

<400> 4

Met Gln Thr Ile Lys Arg Leu Pro Lys Ser Val His Ser Ser Leu Arg

1 5 10 15

Ser Ser Ile Val Leu Phe Asp Leu Ser Arg Val Val Glu Glu Leu Val

20 25 30

Tyr Asn Ser Ile Asp Ala Asn Ala Ser Lys Ile Asp Ile Ser Val Asn

35 40 45

Ala Arg Ala Cys Tyr Val Lys Val Glu Asp Asp Gly Cys Gly Ile Thr

50 55 60

Arg Asp Glu Leu Val Leu Val Gly Glu Lys Tyr Ala Thr Ser Lys Phe

65 70 75 80

His Asn Val Met Val Asp Gly Glu Pro Ser Ser Arg Ser Phe Gly Leu

85 90 95

Asn Gly Glu Ala Leu Ala Ser Leu Ser Asp Ile Ser Val Val Glu Val

100 105 110

Arg Thr Lys Ala Arg Gly Arg Pro Asn Ser Tyr Cys Lys Ile Ile Lys

115 120 125

Gly Ser Lys Cys Ser His Leu Gly Ile Asp Glu Gln Arg Glu Val Val

130 135 140

Gly Thr Thr Val Ile Val Arg Glu Leu Phe Tyr Asn Gln Pro Val Arg

145 150 155 160

Arg Lys Gln Met Gln Ser Ser Tyr Lys Arg Glu Leu His Leu Val Lys

165 170 175

Lys Ser Val Leu Arg Val Ala Leu Ile His Pro Gln Val Ser Leu Arg

180 185 190

Leu Phe Asp Ile Glu Ser Glu Asp Glu Leu Leu Tyr Thr Ile Pro Ser

195 200 205

Ser Ser Pro Leu Thr Leu Val Ser Asn Ile Leu Gly Lys Asn Val Ser

210 215 220

Ser Cys Leu His Glu Ile Ala Thr Ser Asp Lys His Phe Ala Leu Ser

225 230 235 240

Gly His Ile Ser Arg Pro Thr Asp Val Phe Cys Asn Lys Asp Phe Gln

245 250 255

Tyr Leu Tyr Ile Asn Ser Arg Phe Val Ser Lys Ser Pro Ile His Asn

260 265 270

Met Leu Asn Asn Leu Ala Ser Ser Phe Gln Ser Ser Ala Arg Asn Glu

275 280 285

Glu Ile Asp Val Arg Ser Lys Lys Arg Gln Lys Asn Glu Val Tyr Pro

290 295 300

Ala Tyr Leu Leu Asn Leu Cys Cys Pro Arg Ser Ser Tyr Asp Leu His

305 310 315 320

Phe Glu Pro Ser Gln Thr Ile Val Glu Phe Lys Asp Trp Gln Thr Val

325 330 335

Met Tyr Phe Phe Glu Arg Thr Ile Thr Asp Tyr Trp Lys Lys His Ala

340 345 350

Pro Gln Leu Pro Glu Val Lys Ala Ile Gly Asn Asp Thr Cys Val Pro

355 360 365

Leu Glu Arg Asp Val Lys Ser Ser Gln Glu Leu Leu Arg Arg His Gly

370 375 380

Val Gln Lys Lys Glu Asp Val Ala Glu Leu Tyr Gln Thr Ala Leu Gln

385 390 395 400

Lys Asn Thr Val Arg Asp Met Asn Phe Asp Thr Ala Ala Pro Ala Glu

405 410 415

Pro Lys Asp Asn Tyr Leu Ser Leu Asp Met Glu Pro Ser Thr Trp Arg

420 425 430

Ala Cys Tyr Asp Gln Ile Ser Asp Ala Ser His Thr Asp Asp Val Ala

435 440 445

Arg Asn Gly Arg Lys Phe Gly His Lys Gln Ile Cys Ser Leu Gln Ser

450 455 460

Tyr Ser Tyr Gln Trp Leu Glu Asp Gly Ser Ser Leu Leu Glu Asp Ser

465 470 475 480

Asp Leu Ser Ser Ala Asn Pro Thr Ile Cys Lys Met Gln Lys Thr Glu

485 490 495

Asp Ile Phe His Gly His Ala Tyr Ser Gly Lys Phe Gly Leu Leu Gln

500 505 510

Asp Ala Glu Ile Glu Ile Gly Pro Glu Ile Lys Leu Gln Glu Tyr Cys

515 520 525

Phe Glu Ser Pro Asn Lys Leu Asn Arg Met Thr Cys Asp Phe Val Gln

530 535 540

Lys Gln Thr Lys Ile Glu Ala His Ile Ser Gly Arg Asp Gly Phe Tyr

545 550 555 560

Val Asp Phe Asp Lys Leu Asn Glu Asp Cys Leu Leu Asn Glu Ile Ser

565 570 575

Lys Thr Ile Thr Asp Val Ser Cys Pro Gln Met Pro His Phe Asn Asp

580 585 590

Gly Leu Cys Pro Glu Asp Val Gly Ser Ser Lys Ser Ser Cys Ser Val

595 600 605

Arg Lys Ser Ser Lys Arg Gln Asn Ser Ala Asn Ala Ile Ala Gln Met

610 615 620

Lys Phe His Asp Met Gln Ala Val

625 630

Claims (5)

1. A gene for regulating fertility of female organs of rice, wherein the gene is OsMLH3 gene; the sequence of the OsMLH3 gene is a nucleotide sequence of SEQ ID NO. 3.

2. A protein encoded by the OsMLH3 gene of claim 1, wherein the amino acid sequence of the protein is the amino acid sequence of SEQ ID No. 4.

3. Use of the gene of claim 1 for regulating fertility of rice female organs.

4. The application according to claim 3, wherein the application method is as follows: OsMLH3 gene is knocked out by Cas9 technology, and a new rice female sterile restorer line is cultivated.

5. The application according to claim 3, wherein the application method is as follows: the molecular marker is used to assist in selecting, hybridizing and transferring to dark glume rice variety, so as to cultivate new rice female sterile restoring line.

Images