CN109777803B

CN109777803B - Application of ZSQA gene in significantly enhancing expression of A549/DDP cell ABCC1 gene

Info

Publication number: CN109777803B
Application number: CN201910099016.5A
Authority: CN
Inventors: 邵淑丽; 张伟伟; 张珍珠; 朱少伟; 杜洋
Original assignee: Qiqihar University
Current assignee: Qiqihar University
Priority date: 2019-01-31
Filing date: 2019-01-31
Publication date: 2022-09-02
Anticipated expiration: 2039-01-31
Also published as: CN109777803A

Abstract

The application of the ZSQA gene in the significant enhancement of the gene expression of A549/DDP cell ABCC1 belongs to the technical field of genetic engineering, and is characterized in that the nucleotide sequence of the ZSQA gene in the significant enhancement of the gene expression of A549/DDP cell ABCC1 is shown as Seq ID No: 1. Respectively detecting expression levels of mRNA and protein of ZSQA and ABCC1 genes by qRT-PCR and Western blot; the qRT-PCR result shows that after the ZSQWa is over-expressed, the expression of the ABCC1 gene is increased along with the over-expression, and the difference is obvious. The Western blot result and the qRT-PCR result have the same trend, and the result shows that the ZSQA gene can positively regulate the expression of the ABCC1 gene.

Description

Application of ZSQA gene in significantly enhancing expression of A549/DDP cell ABCC1 gene

Technical Field

The invention relates to application of a ZSW gene in obviously enhancing the gene expression of A549/DDP cell ABCC1, belonging to the technical field of genetic engineering.

Background

The ABCC1 gene is one of the members of the ABC (ABC) transmembrane transporter family (Sodani K and patel a, 2012). The protein is widely present in various tumor tissues, has a relative molecular mass of 190kD, is located in human chromosome 16P 13.1, is mainly distributed in cell membranes and endomembrane systems, and performs a transport function by applying energy generated by ATP binding/hydrolysis (Kim H S and Lee J H, 2015). ABCC1 can expel intracellular drug from the cell, reduce intracellular drug concentration, keep intracellular drug concentration below a critical cell-killing level, and redistribute intracellular drug. The specific mechanism is as follows: ABCC1 directly participates in active transfer of medicine into subcellular organelles or indirectly influences medicine distribution, reduces medicine nuclear mass distribution ratio to reduce medicine concentration in nucleus and absolute concentration of medicine to DNA target; secondly, the pH value in cytoplasm or organelle is changed by forming a Cl-channel or changing the activity of the channel, and the relative reduction of the pH value in the organelle can cause the discharge of a large amount of protonated drugs in an acid environment; thirdly, the medicine is discharged out of the cells through vesicle transport and exocytosis; (iv) detaching the pharmaceutically active ingredient from its site of action (Sodani K and Patel A, 2012). Early growth response-1 (Egr 1) is an important nuclear transcription factor (Karthikkeyan G and Nagaraj N R, 2018) and is widely present in the nuclei of zebrafish, mouse and human cells. Plays an important role in regulating the growth, differentiation, development, proliferation and the like of cells. The Egr1 gene is located at 5q31 and is 2.1kb long, encoding a mature mRNA of 3.3 kb. The DNA domain of the Egr1 gene promoter region for structures such as response elements of different transcription factors, cAMP response elements, AP1 binding sites, SP1 consensus sequences, Egr1 self binding sites (billows, 2013), and transcription activator 5 binding sites, is a transcription factor (korean lei, 2007) containing 3 Cyc2-His2 zinc finger structures, and the zinc finger structures bind to GC-rich regions in the DNA sequence in the presence of zinc ions, thereby exerting a transcription regulation effect. Thus, Egr1 may act as a transcription factor to regulate expression of many target genes. Therefore, how to transform a gene ZSW capable of obviously enhancing the gene expression of the cell ABCC1 becomes a big problem to be solved urgently, so that the application of the ZSW gene in obviously enhancing the gene expression of the A549/DDP cell ABCC1 utilizes the steps of carrying out total RNA extraction on the A549/DDP cell and then carrying out reverse transcription on the extracted total RNA to obtain cDNA, finding an mRNA sequence corresponding to a CDS region of an Egr1 gene on an NCBI website, designing primers according to a primer design principle, respectively adding HindIII and EcoRI enzyme cutting sites at the upstream and the downstream, amplifying the CDS region of the Egr1 gene through PCR, then carrying out mutation on a 1500,1503,1506 site of the CDS region of the Egr1 gene, carrying out enzyme cutting on a pcDNA3.1(+) vector, and connecting a target fragment with the pcDNA3.1 (+); the recombinant vector is named pcDNA3.1-ZSWa after being transformed, detected and identified; the mutation information is as follows: the A mutation of 1500 is G; 1503 to A; 1506G to A. Then, the expression levels of mRNA and protein of ZSQWa and ABCC1 genes are detected by qRT-PCR and Western blot methods respectively; the qRT-PCR result shows that after the ZSQWa is over-expressed, the expression of the ABCC1 gene is increased along with the over-expression, and the difference is obvious. The Western blot result is consistent with the trend of the qRT-PCR result, and the result shows that the ZSW gene can positively regulate the expression of the ABCC1 gene, so that the invention of the gene ZSW capable of obviously enhancing the expression of the ABCC1 gene of the lung cancer is necessary.

Disclosure of Invention

In order to overcome the problem of how to construct a gene ZWa capable of obviously enhancing the gene expression of a cell ABCC1, the invention provides the application of the ZWa gene in obviously enhancing the gene expression of an A549/DDP cell ABCC1, the application of the ZWa gene in obviously enhancing the gene expression of the A549/DDP cell ABCC1 utilizes the steps of carrying out total RNA extraction on an A549/DDP cell and then carrying out reverse transcription on the cell to obtain cDNA, finding out an mRNA sequence corresponding to a CDS region of an Egr1 gene on an NCBI website, designing primers according to a primer design principle, respectively adding HindIII and EcoRI enzyme cutting sites at the upstream and the downstream, amplifying the CDS region of the Egr1 gene by PCR, then carrying out mutation on a 1500,1503,1506 site of the CDS region of the Egr1 gene, carrying out enzyme cutting on a pcDNA3.1(+) vector, and connecting a target fragment with the pcDNA3.1 (+); the recombinant vector is named pcDNA3.1-ZSWa after being transformed, detected and identified; the mutation information is as follows: the A mutation of 1500 is G; 1503 to A; 1506G to A. The nucleotide sequence is shown as Seq ID No: 1; then, detecting the expression levels of mRNA and protein of ZSQA and ABCC1 genes by qRT-PCR and Western blot; the qRT-PCR result shows that after the ZSW is over-expressed, the ABCC1 gene expression is increased along with the over-expression, and the difference is obvious. The Western blot result and the qRT-PCR result have the same trend, and the result shows that the ZSW gene can positively regulate the expression of the ABCC1 gene.

The technical scheme adopted by the invention for solving the technical problems is as follows:

the invention discloses an application of a ZSWa gene in obviously enhancing the expression of an A549/DDP cell ABCC1 gene, and the specific scheme is as follows:

A549/DDP cell recovery and culture

1.1 cell recovery: (1) taking out the frozen cells from the liquid nitrogen, and shaking the frozen cells in a water bath kettle at 37 ℃ until the frozen cells are completely melted; (2) slowly dropping into a centrifuge tube containing 5mL 1640 culture medium, centrifuging for 5min at 1000g, and discarding the supernatant; (3) the cell pellet was suspended in 5mL 1640 complete medium, transferred to a cell flask, and cultured in a 5% CO2 incubator at 37 ℃.

1.2 cell passages (subculture until cell confluence reaches 90%): (1) abandoning the culture medium in the original bottle, and gently washing the cells for 2 times by using 5 mLPBS; (2) adding 1mL of 0.25% pancreatin digestive cells, observing under a mirror, adding a complete culture medium to stop digestion when 60% of adherent cells shrink into a bright spot form, and repeatedly blowing to make the adherent cells fall off the wall; (3) after 10mL of complete medium was added to the cell suspension and blown down uniformly, 5mL of the complete medium was taken out and added to two new flasks, and the cells were cultured in a 5% CO2 incubator at 37 ℃. As can be seen from fig. 2: the cells grow adherently, A549/DDP is polygonal, and the growth state of the cells is good.

2. Regulation of ABCC1 gene expression by gene ZSW

2.1 construction of Egr1 overexpression vector: the CDS region of Egr1 Gene was searched based on the sequence of Egr1 Gene known in NCBI Genebank (Gene ID: 1958), the CDS region of Egr1 Gene and the cleavage sites available for pcDNA3.1(+) vector were analyzed using Primer 5.0, and specific amplification primers were designed, Primer sequences: egr 1-F: CCCAAGCTTATGGCCGCGGCCAAG, respectively; egr 1-R: CCGGAATTCTTAGCAAATTTCAATTG, PCR amplification was carried out using human cDNA as a template, and Hind III and EcoRI sites were added to the 5 'and 3' ends of the upstream primers. After agarose gel electrophoresis detection, the PCR product is purified and recovered, and directionally inserted into a pcDNA3.1(+) vector, and after the accuracy is determined by double enzyme digestion and sequencing identification, the PCR product is named as pcDNA3.1-Egr 1.

2.2 construction of vector ZSWa: based on the known sequence of Egr1 Gene in NCBI Genebank (Gene ID: 1958), the CDS region of Egr1 Gene was searched, the CDS region of Egr1 Gene and the cleavage site available in pcDNA3.1(+) vector were analyzed by Primer 5.0, and specific amplification primers were designed, the sequences of which are shown in Table 1, PCR was performed using pcDNA3.1-Egr1 as a template, and HindIII cleavage site was added to the 5 'end and EcoRI cleavage site was added to the 3' end of the upstream Primer. Then, mutation is carried out on 1500,1503,1506 locus of CDS region of Egr1 gene, agarose gel electrophoresis detection is carried out, PCR product is purified and recovered, and is directionally inserted into pcDNA3.1(+) vector, accuracy is determined through double enzyme digestion and sequencing identification, and then the PCR product is named as pcDNA3.1-ZSWa. The mutation information is as follows: the A mutation of 1500 is G; 1503 to A; 1506G to A.

2.3 PEI transfection: (1) inoculating the cells with the confluence degree of 90% into a 24-well plate, and replacing the cells with a culture medium without double antibody for continuous culture; (2) carrying out transfection when the cells in the 24-pore plate grow to about 60%; changing the culture medium to a serum-free 1640 culture medium; (3) preparing 2 times of 1.5mL EP tubes according to the number of experimental groups, adding 25 mu LOpti-DMEM into each tube, adding 2 mu LPEI into one half of the tubes, adding pcDNA3.1-ZSWa into the other half of the tubes, and incubating for 5min at room temperature; (4) mixing the PEI-containing Opti-DMEM incubation solution and the plasmid-containing Opti-DMEM incubation solution into a 1.5mL EP tube, and incubating for 20min at room temperature; (5) and uniformly dropwise adding the mixed solution into each cell culture hole, gently mixing, culturing in a cell culture box for 4 hours, changing the culture medium to 1640 complete culture medium, and continuously culturing for 48 hours.

2.4 qRT-PCR detection of expression level of mRNA of ZSQA and ABCC1 genes

2.4.1 Total RNA extraction from cells: (1) collecting the cells of the experimental group, adding 1mL Trizol Reagent, uniformly mixing, and standing for 30min at room temperature; (2) adding 0.2mL of chloroform, shaking vigorously for 30s, standing at room temperature for 3min, 12000r/min, and centrifuging at 4 ℃ for 10 min; (3) absorbing the upper aqueous phase, transferring to a clean centrifuge tube, adding 1/2 times of volume of absolute ethyl alcohol, and mixing uniformly; transferring the solution to an adsorption column, standing at room temperature for 2min, 12000r/min, centrifuging at 4 ℃ for 3min, and removing liquid in a collection tube; (4) adding 500 μ L RPE Solution, standing for 2min, 10000r/min, centrifuging at 4 deg.C for 30s, pouring out liquid in the collecting tube, and repeating once; (5) putting the adsorption column back into the collection tube, centrifuging at 10000r/min and 4 ℃ for 2 min; (6) the adsorption column was placed in a DEPC-treated 1.5mL centrifuge tube, and 30. mu.L DEPC-treated ddH was added to the center of the adsorption membrane ₂ Standing at room temperature for 5min, 12000r/min, and centrifuging at 4 ℃ for 2 min; (7) total RNA concentration was determined using a Nano Drop 2000C spectrophotometer.

2.4.2 reverse transcription of cDNA: the Total RNA obtained was reverse transcribed into cDNA using a two-step procedure according to the reverse transcription kit instructions. (1) Reverse transcription was performed according to the following system: total RNAor Poly (A) RNA, 0.2-2 μ g; oligo (dT) or Random primer (50. mu.M), 1. mu.L; dntp texture (10mM each), 1. mu.L; RNase Free H ₂ O, Up to 14. mu.L. (2) The following reactions were performed on a PCR instrument: 65 deg.CFor 5min, then placed on ice to quench. (3) The second step of reverse transcription reaction was to add a reverse transcription reaction solution (20. mu.L system) to the above PCR tube as follows: 14. mu.L of the denatured and annealed reaction solution; 5 first-strand Buffer, 4 μ L; M-MuLVReverse Transcriptase (200U/. mu.L), 1. mu.L; RNase Inhibitor, 1. mu.L. (4) The reverse transcription reaction was performed on a PCR instrument under the following conditions: 60min at 45 ℃; 10min at 70 ℃; storing at-20 deg.C.

2.4.3qRT-PCR assay: (1) reaction system: cDNA, 1 uL; sense primer, 0.4 μ L; anti-sense primer, 0.4 μ L; 2 x Mix, 10 μ L; rox, 0.4. mu.L; ddH ₂ O, 7.8. mu.L. The cDNA obtained was subjected to Real Time PCR using Power 2X SYBR Real-Time PCR Prefix kit (20. mu.L). (2) The reaction conditions are as follows: 95 ℃ for 2min, 40 × (95 ℃ for 15s, 60 ℃ for 40s), 95 ℃ for 15s, 60 ℃ for 1 min; and (5) carrying out dissolution curve detection after the circulation is finished. Data in 2 ^-ΔΔCt The method carries out calculation.

2.4.4 Western blot detection of ZSWa and ABCC1 protein expression levels

2.4.4.1 extraction of cell whole protein: (1) collecting the cell sediment of the experimental group to a 1.5mL centrifuge tube, adding 300 mu L of protein lysate, and placing on a shaking table at 4 ℃ for 30 min; (2) centrifuging at 12000g for 20min, collecting supernatant to a new 1.5mL centrifuge tube, and storing at-80 deg.C.

2.4.4.2 Western blot: (1) the extracted protein sample was mixed with loading buffer according to 4: 1, boiling in boiling water for 5-10 min, cooling to room temperature, and subpackaging at-20 ℃ for storage or continuing the experiment. (2) Installing a rubber plate, and preparing a separation rubber according to the following system: 8.2mL of water; 30% acrylamide, 6.6 mL; 10% SDS, 0.2 mL; Tris-Cl (pH8.8), 5 mL; 10% APS, 200 μ L; TEMED, 20 μ L. (3) And injecting the separating glue into the two layers of glass plates, adding the separating glue into the two layers of glass plates at proper positions, and then sliding the gun head to add the isopropanol until the liquid level overflows. (4) After gelling, the isopropanol was decanted and the residual isopropanol was blotted with filter paper. (5) The concentrated glue is prepared according to the following proportion: 5.7mL of water; 30% acrylamide, 1.7 mL; 10% SDS, 0.1 mL; Tris-Cl (pH6.8), 2.5 mL; 10% APS, 200 μ L; TEMED, 20 μ L. Injecting the concentrated glue into two layers of glass plates until the liquid level overflows, and inserting a comb. (6) After the gelation, the comb is pulled out, assembled with the electrophoresis tank and added with the electrophoresis liquid. (7) Sample application: the experimental histone sample is 30 mu L protein sample, and the sample loading amount of the Marker is 10 mu L; and setting the power supply voltage to be 100V, and stopping electrophoresis when the bromophenol blue reaches the bottom end. (8) And taking out the rubber plate, and reserving the rubber near the strip according to Marker indication. (9) The remaining gel was soaked in the transfer solution and filter paper (four layers) and PVDF membrane (methanol soak 30sec) slightly larger than the gel were prepared. (10) Placing in the following order: sponge → filter paper → glue → PVDF membrane → filter paper → sponge (avoid air bubbles when placed). (11) And placing the assembled clamping plate in a transfer printing groove, pouring transfer liquid, switching on a power supply, setting the current to be about 300mA, and setting the power to be less than 40W for 90 min. (12) And (4) after the transfer printing is finished, taking out the PVDF membrane, placing the PVDF membrane in the lithopone red staining solution, and staining for 5min on a shaking table. (13) Washing PVDF membrane, shearing membrane according to marker and protein size of target band, placing in blocking solution prepared from 5% skimmed milk powder, and incubating at room temperature for 1 h. (14) The blocking solution was decanted off, incubated once (1: 300), and incubated overnight at 4 ℃ with shaking. (15) Primary antibody was recovered and membrane washed with PBST for 10min, three times. (16) PBST was discarded, the secondary antibody incubated (1: 10000), and the mixture was incubated at 4 ℃ for 1h on a shaker. (17) The secondary antibody is recovered, and the membrane is washed for 10min by PBST for three times. (18) The Odyssey double infrared laser imaging system detects the change of the protein band.

2.5 Regulation of ABCC1 Gene expression by Gene ZSW

The qRT-PCR result shows that after the ZSW is over-expressed, the ABCC1 gene expression is increased along with the over-expression, and the difference is obvious. The Western blot result is consistent with the trend of the qRT-PCR result, the result shows that the ZSW gene can positively regulate the expression of the ABCC1 gene, and the details of the changes of the ZSW and ABCC1 gene expression after the ZSW is over-expressed are shown in fig. 4 and fig. 5.

The invention has the advantages that the application of the ZSW gene in the obvious enhancement of the A549/DDP cell ABCC1 gene expression utilizes the total RNA extraction of the A549/DDP cell and then reverse transcription to cDNA, an mRNA sequence corresponding to the CDS region of the Egr1 gene is found on an NCBI website, primers are designed according to the primer design principle, HindIII and EcoRI enzyme cutting sites are respectively added at the upstream and the downstream, the CDS region of the Egr1 gene is amplified through PCR, then the 1500,1503,1506 site of the CDS region of the Egr1 gene is mutated, a pcDNA3.1(+) vector is subjected to enzyme cutting, and a target fragment and the pcDNA3.1(+) are connected; the recombinant vector is named pcDNA3.1-ZSWa after being transformed, detected and identified; the mutation information is as follows: the A mutation of 1500 is G; 1503 to A; 1506G to A. The nucleotide sequence is shown as Seq ID No: 1; then, respectively detecting expression levels of mRNA and protein of ZSQWa and ABCC1 genes by using a qRT-PCR (quantitative reverse transcription-polymerase chain reaction) and a Western blot method; the qRT-PCR result shows that after ZSQWa is over-expressed, ABCC1 gene expression is increased along with the ZSQWa, and the difference is obvious. The Western blot result and the qRT-PCR result have the same trend, and the result shows that the ZSQA gene can positively regulate the expression of the ABCC1 gene.

Drawings

The invention is further described below with reference to the accompanying drawings.

FIG. 1 is a base sequence diagram of a ZSQA gene applied to significantly enhancing the expression of an ABCC1 gene of an A549/DDP cell by the ZSQA gene.

FIG. 2 is a state diagram of A549/DDP cells observed under a common optical microscope by using the ZWa gene in the invention to significantly enhance the expression of the ABCC1 gene of the A549/DDP cells.

FIG. 3 is a pcDNA3.1-ZSQA over-expression plasmid map of the application of the ZSQA gene in the significant enhancement of the expression of the A549/DDP cell ABCC1 gene.

FIG. 4 is a diagram of the expression change of ZSW and ABCC1 gene mRNA in the application of the ZSW gene in the significant enhancement of the expression of the A549/DDP cell ABCC1 gene.

FIG. 5 is a protein expression change diagram of ZSQA and ABCC1 genes of the invention when the ZSQA gene is applied to significantly enhance the expression of the ABCC1 gene of A549/DDP cells.

Detailed Description

The first embodiment is as follows:

as shown in the figure, the application experiment method and the result of the ZSW gene in the significant enhancement of the gene expression of the A549/DDP ABCC1 are as follows:

resuscitating and culturing A549/DDP (dendritic cell proliferation) cells

1.1 cell Resuscitation

(1) Taking out the frozen cells from the liquid nitrogen, and shaking the cells in a water bath kettle at 37 ℃ until the cells are completely melted;

(2) slowly dropping into a centrifuge tube containing 5mL 1640 culture medium, centrifuging for 5min at 1000g, and discarding the supernatant;

(3) the cell pellet was suspended in 5mL 1640 complete medium, transferred to a cell flask, and cultured in a 5% CO2 incubator at 37 ℃.

1.2 cell passages (subculture until the confluency of cells reaches 90%)

(1) Abandoning the culture medium in the original bottle, and gently washing the cells for 2 times by using 5 mLPBS;

(2) adding 1mL of 0.25% pancreatin digestive cells, observing under a mirror, adding a complete culture medium to stop digestion after 60% of adherent cells are shrunk into a bright spot form, and repeatedly blowing to make the adherent cells fall off from the wall;

(3) after 10mL of complete medium was added to the cell suspension and blown down uniformly, 5mL of the complete medium was taken out and added to two new flasks, and the cells were cultured in a 5% CO2 incubator at 37 ℃.

As can be seen from fig. 2: the cells grow adherently, A549/DDP is polygonal, and the growth state of the cells is good.

2. Regulation of ABCC1 gene expression by gene ZSWa

2.1 construction of Egr1 overexpression vector

Based on the known sequence of Egr1 Gene in NCBI Genebank (Gene ID: 1958), the CDS region of Egr1 Gene was searched, the CDS region of Egr1 Gene and the cleavage site available in pcDNA3.1(+) vector were analyzed by Primer 5.0, and specific amplification primers were designed, the sequences of which are shown in Table 1, PCR was performed using human cDNA as a template, and HindIII cleavage site was added to the 5 'end and EcoRI cleavage site was added to the 3' end of the upstream Primer. After agarose gel electrophoresis detection, the PCR product is purified and recovered, and directionally inserted into a pcDNA3.1(+) vector, and after the accuracy is determined by double enzyme digestion and sequencing identification, the PCR product is named as pcDNA3.1-Egr 1.

TABLE 1 CDS amplification primers

2.2 construction of the overexpression mutation vector ZSWa

(1) Based on the known sequence of Egr1 Gene in NCBI Genebank (Gene ID: 1958), the CDS region of Egr1 Gene was searched, the CDS region of Egr1 Gene and the cleavage site available in pcDNA3.1(+) vector were analyzed by Primer 5.0, and specific amplification primers were designed, the sequences of which are shown in Table 1, PCR was performed using human pcDNA3.1-Egr1 as a template, and HindIII cleavage site was added to the 5 'end and EcoRI cleavage site was added to the 3' end of the upstream Primer. Then, mutating 1500,1503,1506 site of CDS region of Egr1 gene, enzyme-cutting pcDNA3.1(+) vector, and connecting target fragment and pcDNA3.1 (+); the recombinant vector is named pcDNA3.1-ZSWa after being transformed, detected and identified; the mutation information is as follows: the A mutation of 1500 is G; 1503 to A; 1506G to A.

2.3 PEI transfection

(1) Inoculating the cells with the confluence degree of 90% into a 6-well plate, and replacing the cells with a culture medium without double antibody for continuous culture;

(2) when the cells in the 6-hole plate grow to about 60 percent, carrying out transfection; the culture medium is replaced by a serum-free 1640 culture medium;

(3) 2-fold 1.5mL EP tubes were prepared according to the number of experimental groups, 100. mu. LOpti-DMEM was added to each tube, 2. mu. LPEI was added to one half, and pcDNA3.1-ZSWa was added to the other half, and incubation was carried out at room temperature for 5 min.

(4) The PEI-containing Opti-DMEM incubation and plasmid-containing Opti-DMEM incubation were mixed into a 1.5mL EP tube and incubated at room temperature for 20 min.

(5) And uniformly dropwise adding the mixed solution into each cell culture hole, gently mixing, culturing in a cell culture box for 4 hours, changing the culture medium to 1640 complete culture medium, and continuously culturing for 48 hours.

2.4 qRT-PCR detection of expression levels of ZSQA and ABCC1 Gene mRNA

2.4.1 Total RNA extraction from cells

(1) Collecting the cells of the experimental group, adding 1ml of Trizol Reagent, mixing uniformly, standing at room temperature for 30min,

(2) adding 0.2mL of chloroform, violently shaking for 30s, standing at room temperature for 3min, 12000r/min, and centrifuging at 4 ℃ for 10 min;

(3) absorbing the upper water phase, transferring to a clean centrifuge tube, adding 1/2 times volume of absolute ethyl alcohol, and mixing uniformly; transferring the solution to an adsorption column, standing at room temperature for 2min, 12000r/min, centrifuging at 4 ℃ for 3min, and removing liquid in a collection tube;

(4) adding 500 mu LRPE Solution, standing for 2min, centrifuging at 10000r/min at 4 ℃ for 30s, pouring off the liquid in the collecting pipe, and repeating once;

(5) putting the adsorption column back into the collection tube, centrifuging at 10000r/min and 4 ℃ for 2 min;

(6) the adsorption column was placed in a DEPC-treated 1.5mL centrifuge tube, and 30. mu.L DEPC-treated ddH was added to the center of the adsorption membrane ₂ Standing at room temperature for 5min, 12000r/min, and centrifuging at 4 ℃ for 2 min;

(7) total RNA concentration was determined using a Nano Drop 2000C spectrophotometer.

2.4.2 reverse transcription of cDNA

The obtained Total RNA was reverse transcribed into cDNA using a two-step method according to the reverse transcription kit instructions.

(1) Reverse transcription according to the system of Table 2

TABLE 2 reverse transcription System

(2) The following reactions were performed on a PCR instrument: at 65 deg.C for 5min, then placing on ice to quench

(3) The reverse transcription reaction solution (20. mu.L system) was added to the PCR tube as shown in Table 3.

TABLE 3 second step of reverse transcription

(4) The reverse transcription reaction was performed on a PCR instrument under the following conditions: 60min at 45 ℃; 10min at 70 ℃; storing at-20 deg.C. 2.4.3qRT-PCR detection

(1) Table 4 reaction System the cDNA obtained was subjected to Real Time PCR using Power 2X SYBR Real-Time PCR amplification kit, 20. mu.L reaction system.

TABLE 4 qRT-PCR reaction System

(2) The reaction conditions are as follows: 95 ℃ for 2min, 40 × (95 ℃ for 15s, 60 ℃ for 40s), 95 ℃ for 15s, 60 ℃ for 1 min; and (5) carrying out dissolution curve detection after the circulation is finished. Data in 2 ^-ΔΔCt The method carries out calculation.

2.5 Western blot detection of ZSWa and ABCC1 protein expression levels

2.5.1 extraction of cell Total proteins

(1) Collecting the cell sediment of the experimental group to 1.5mL, adding 300 mu L of protein lysate, and placing on a shaking table at 4 ℃ for 30 min;

(2) centrifuging at 12000g for 20min, collecting supernatant to a new 1.5mL centrifuge tube, and storing at-80 deg.C.

2.5.2 Westernblot

(1) The extracted protein sample was mixed with loading buffer according to 4: 1, boiling in boiling water for 5-10 min, cooling to room temperature, and subpackaging at-20 ℃ for storage or continuing experiments.

(2) Mounting a rubber plate, and preparing a separation rubber according to the following table 5:

TABLE 5 separation gel

(3) Injecting the separating glue into two layers of glass plates, adding the separating glue into proper positions, and then sliding the gun head to add isopropanol until the liquid level overflows;

(4) after the gelation, pouring out the isopropanol, and completely sucking the residual isopropanol by using filter paper;

(5) the concentrated gels were prepared as in table 6:

TABLE 6 concentrated gums

Injecting the concentrated glue into the two layers of glass plates until the liquid level overflows, and inserting a comb;

(6) after the gel is formed, pulling out the comb, assembling the comb with an electrophoresis tank, and adding electrophoresis liquid;

(7) sample application: the experimental histone sample is 30 mu L protein sample, and the sample loading amount of the Marker is 10 mu L; and setting the power supply voltage to be 100V, and stopping electrophoresis when the bromophenol blue reaches the bottom end.

(8) Taking out the rubber plate, and reserving the rubber near the strip according to Marker indication;

(9) the remaining gel was soaked in the transfer solution and filter paper (four layers) slightly larger than the gel and PVDF membrane (methanol soak 30sec) were prepared;

(10) the following placing procedures are carried out: sponge → filter paper → glue → PVDF membrane → filter paper → sponge (to avoid air bubbles when placed);

(11) placing the assembled clamping plate in a transfer printing groove, pouring transfer liquid, switching on a power supply, setting the current to be about 300mA, setting the power to be less than 40W, and setting the time to be 90 min;

(12) after the transfer printing is finished, taking out the PVDF membrane, placing the PVDF membrane in an early spring red staining solution, and staining for 5min on a shaking table;

(13) washing a PVDF membrane, shearing the membrane according to Marker instructions and the protein size of a target strip, placing the membrane in a confining liquid prepared from 5% skimmed milk powder, and incubating for 1h at room temperature;

(14) pouring off the blocking solution, incubating the primary antibody (1: 300), and incubating overnight at 4 deg.C with shaking;

(15) recovering primary antibody, and washing the membrane for 10min by PBST for three times;

(16) removing PBST, incubating with secondary antibody (1: 10000), and incubating in a shaker at 4 deg.C for 1 h;

(17) recovering the second antibody, and washing the membrane for 10min by PBST for three times;

(18) the Odyssey double infrared laser imaging system detects the change of the protein band.

2.6 Regulation of ABCC1 Gene expression by Gene ZSW

The qRT-PCR result shows that after the ZSW is over-expressed, the ABCC1 gene expression is increased along with the over-expression, and the difference is obvious. The Western blot result is consistent with the trend of the qRT-PCR result, and the result shows that the ZSW gene can positively regulate the expression of the ABCC1 gene, and the changes of the ZSW and ABCC1 gene expression after the ZSW is over-expressed are shown in the detailed chart 4 and the detailed chart 5.

The foregoing shows and describes the general principles and broad features of the present invention and advantages thereof. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are merely illustrative of the principles of the invention, but that various changes and modifications may be made without departing from the spirit and scope of the invention, which is defined by the appended claims and their equivalents.

Nucleotide and/or amino acid sequence listing

Nucleotide and/or amino acid sequence listing

<110> university of ziqi hall

<120> 1.a gene ZSWa capable of obviously enhancing gene expression of ABCC1 of cells

<160>3

<210>1

<211>2160

<212>DNA

<213> Artificial sequence

<400>1

1 gcgcagaact tggggagccg ccgccgccat ccgccgccgc agccagcttc cgccgccgca

61 ggaccggccc ctgccccagc ctccgcagcc gcggcgcgtc cacgcccgcc cgcgcccagg

121 gcgagtcggg gtcgccgcct gcacgcttct cagtgttccc cgcgccccgc atgtaacccg

181 gccaggcccc cgcaactgtg tcccctgcag ctccagcccc gggctgcacc cccccgcccc

241 gacaccagct ctccagcctg ctcgtccagg atggccgcgg ccaaggccga gatgcagctg

301 atgtccccgc tgcagatctc tgacccgttc ggatcctttc ctcactcgcc caccatggac

361 aactacccta agctggagga gatgatgctg ctgagcaacg gggctcccca gttcctcggc

421 gccgccgggg ccccagaggg cagcggcagc aacagcagca gcagcagcag cgggggcggt

481 ggaggcggcg ggggcggcag caacagcagc agcagcagca gcaccttcaa ccctcaggcg

541 gacacgggcg agcagcccta cgagcacctg accgcagagt cttttcctga catctctctg

601 aacaacgaga aggtgctggt ggagaccagt taccccagcc aaaccactcg actgcccccc

661 atcacctata ctggccgctt ttccctggag cctgcaccca acagtggcaa caccttgtgg

721 cccgagcccc tcttcagctt ggtcagtggc ctagtgagca tgaccaaccc accggcctcc

781 tcgtcctcag caccatctcc agcggcctcc tccgcctccg cctcccagag cccacccctg

841 agctgcgcag tgccatccaa cgacagcagt cccatttact cagcggcacc caccttcccc

901 acgccgaaca ctgacatttt ccctgagcca caaagccagg ccttcccggg ctcggcaggg

961 acagcgctcc agtacccgcc tcctgcctac cctgccgcca agggtggctt ccaggttccc

1021 atgatccccg actacctgtt tccacagcag cagggggatc tgggcctggg caccccagac

1081 cagaagccct tccagggcct ggagagccgc acccagcagc cttcgctaac ccctctgtct

1141 actattaagg cctttgccac tcagtcgggc tcccaggacc tgaaggccct caataccagc

1201 taccagtccc agctcatcaa acccagccgc atgcgcaagt accccaaccg gcccagcaag

1261 acgccccccc acgaacgccc ttacgcttgc ccagtggagt cctgtgatcg ccgcttctcc

1321 cgctccgacg agctcacccg ccacatccgc atccacacag gccagaagcc cttccagtgc

1381 cgcatctgca tgcgcaactt cagccgcagc gaccacctca ccacccacat ccgcacccac

1441 acaggcgaaa agcccttcgc ctgcgacatc tgtggaagaa agtttgccag gagcgatgag

1501 cgaaaaaggc ataccaagat ccacttgcgg cagaaggaca agaaagcaga caaaagtgtt

1561 gtggcctctt cggccacctc ctctctctct tcctacccgt ccccggttgc tacctcttac

1621 ccgtccccgg ttactacctc ttatccatcc ccggccacca cctcataccc atcccctgtg

1681 cccacctcct tctcctctcc cggctcctcg acctacccat cccctgtgca cagtggcttc

1741 ccctccccgt cggtggccac cacgtactcc tctgttcccc ctgctttccc ggcccaggtc

1801 agcagcttcc cttcctcagc tgtcaccaac tccttcagcg cctccacagg gctttcggac

1861 atgacagcaa ccttttctcc caggacaatt gaaatttgct aaagggaaag gggaaagaaa

1921 gggaaaaggg agaaaaagaa acacaagaga cttaaaggac aggaggagga gatggccata

1981 ggagaggagg gttcctctta ggtcagatgg aggttctcag agccaagtcc tccctctcta

2041 ctggagtgga aggtctattg gccaacaatc ctttctgccc acttcccctt ccccaattac

2101 tattcccttt gacttcagct gcctgaaaca gccatgtcca agttcttcac ctctatccaa

<210>2

<211>24

<212>DNA

<213> Artificial sequence

<400>2

CCCAAGCTTA TGGCCGCGGC CAAG 24

<210>3

<211>26

<212>DNA

<213> Artificial sequence

<400>3

CCGGAATTCT TAGCAAATTT CAATTG 26

Claims

The application of the ZSW gene in the significant enhancement of the gene expression of the A549/DDP cell ABCC1 is characterized in that the nucleotide sequence of the gene ZSW is shown as Seq ID No:1, and the ZSW gene can positively regulate the expression of the ABCC1 gene.