CN109593844A - A kind of kit and detection method detecting neurotic personality gene - Google Patents

A kind of kit and detection method detecting neurotic personality gene Download PDF

Info

Publication number
CN109593844A
CN109593844A CN201910020843.0A CN201910020843A CN109593844A CN 109593844 A CN109593844 A CN 109593844A CN 201910020843 A CN201910020843 A CN 201910020843A CN 109593844 A CN109593844 A CN 109593844A
Authority
CN
China
Prior art keywords
snp site
idno
seq
seq idno
nucleotide sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201910020843.0A
Other languages
Chinese (zh)
Inventor
陈龙
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shou Tse Kang Health Care Co Ltd
Original Assignee
Shou Tse Kang Health Care Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shou Tse Kang Health Care Co Ltd filed Critical Shou Tse Kang Health Care Co Ltd
Priority to CN201910020843.0A priority Critical patent/CN109593844A/en
Publication of CN109593844A publication Critical patent/CN109593844A/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to field of biotechnology more particularly to a kind of kits and detection method for detecting neurotic personality gene.The present invention provides a kind of kits for detecting neurotic personality, primer pair including expanding following SNP site, the SNP site includes: SNP site rs169235, SNP site rs7005884, SNP site rs10097870, SNP site rs2953805, SNP site rs6982308, SNP site rs72694263, SNP site rs7107356, SNP site rs7111031, SNP site rs7502590, SNP site rs11090045, SNP site rs1422192, SNP site rs2921036, SNP site rs1521732, SNP site rs717508 3 and SNP site rs11082011.A kind of kit detecting neurotic personality gene provided by the invention and detection method can improve the accuracy rate of neurotic personality detection.

Description

A kind of kit and detection method detecting neurotic personality gene
Technical field
The invention belongs to field of biotechnology more particularly to a kind of kit for detecting neurotic personality gene and detections Method.
Background technique
Neurotic (Neuroticism) is a kind of theory of peronality that Britain psychologist H.J. Ai Senke is proposed, " nerve What matter " was reflected is not only our emotional stability, be also presented we cognition perception, in terms of feelings Thread psychic trait.Nervousness is a kind of metastable personality characteristics, (such as anxiety and compunction), meeting characterized by negative feeling It is too sensitive to the people and things of surrounding, the meaning, subtle limb action to small things and other people each word expression Concern can be compared.People with neurotic personality can be overstretched to some things, lacks to oneself and affirms, has a hunch do-it-yourself It obtains bad.The characteristics of pessimism is neurotic personality, people's often problem from the point of view of pessimism with neurotic personality.But have There is the individual of neurotic personality there was only negative one side, the one side that neurotic personality has also had.With neurotic personality People is more stronger than the observation ability of ordinary people, to small things more be absorbed in, can be showed when Problems more from Hold.The average IQ of neurotic personality individual is more slightly higher than average IQ, and the individual of neurotic personality is happy to help others, It can be concerned about friend, household, lover in addition to oneself, be ready to look after other side, can give people a kind of comfortable feeling.Neurotic people The individual of lattice can show more have implementation capacity at work, have higher productivity.
Psychogenetics the study found that the formation of personal traits, which has 40%-60%, to be determined by congenital heredity, In, the neurotic horizontal height of a people, 41%-58% is the influence by congenital heredity.At present to nervousness et al. The existing method that lattice speciality is measured and evaluated has been measured using scale to personal traits using personality mental scale Following shortcoming: 1, the formulation of scale is rule of thumb completed by researcher, and ununified standard causes the form of scale Various kinds, can be variant using the detection of different scales;Scale is filled in by subject, and subject feels according to the subjective of oneself Feel to fill out scale, the case where during filling in it is possible that some option active concealments, causes finally to use scale The result of evaluation and test is not objective;3, it formulates scale and is difficult to unification using evaluation criterion of the scale to personal traits.
Gene information is hereditary information more stable with individual, is assessed by gene pairs individual compared to usage amount Table, solution formulation and implement can form objective, unified standard, can't because of test implementation person scheme implementation and it is tested Person's influence factor during the test and testing result is impacted.Therefore, it researches and develops a kind of to come from the angle of gene to mind The product being measured through matter personality is those skilled in the art's technical issues that need to address.
Summary of the invention
In view of this, being used for the present invention provides a kind of kit and detection method for detecting neurotic personality gene The detection method and testing product of another neurotic personality are provided.
The invention discloses SNP site rs169235, SNP site rs7005884, SNP site in mankind's full-length genome Rs10097870, SNP site rs2953805, SNP site rs6982308, SNP site rs72694263, SNP site Rs7107356, SNP site rs7111031, SNP site rs7502590, SNP site rs11090045, SNP site Rs1422192, SNP site rs2921036, SNP site rs1521732, SNP site rs7175083 and SNP site Application of the rs11082011 in preparation detection neurotic personality product.
The present invention provides a kind of kits for detecting neurotic personality, the primer pair including expanding following SNP site, institute Stating SNP site includes: SNP site rs169235, SNP site rs7005884, SNP site rs10097870, SNP site Rs2953805, SNP site rs6982308, SNP site rs72694263, SNP site rs7107356, SNP site Rs7111031, SNP site rs7502590, SNP site rs11090045, SNP site rs1422192, SNP site Rs2921036, SNP site rs1521732, SNP site rs7175083 and SNP site rs11082011.
Preferably, the nucleotide sequence such as institute of SEQ IDNO.1~2 of the primer pair of the amplification SNP site rs169235 Show;
The nucleotide sequence of the primer pair of the amplification SNP site rs7005884 is as shown in IDNO.3~4 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs10097870 is as shown in IDNO.5~6 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs2953805 is as shown in IDNO.7~8 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs6982308 is as shown in IDNO.9~10 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs72694263 is as shown in IDNO.11~12 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs7107356 is as shown in IDNO.13~14 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs7111031 is as shown in IDNO.15~16 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs7502590 is as shown in IDNO.17~18 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs11090045 is as shown in IDNO.19~20 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs1422192 is as shown in IDNO.21~22 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs2921036 is as shown in IDNO.23~24 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs1521732 is as shown in IDNO.25~26 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs7175083 is as shown in IDNO.27~28 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs11082011 is as shown in IDNO.29~30 SEQ.
Preferably, the SEQ IDNO.1, SEQ IDNO.3, SEQ IDNO.5, SEQ IDNO.7, SEQ IDNO.9, SEQ IDNO.11、SEQ IDNO.13、SEQ IDNO.15、SEQ IDNO.17、 SEQ IDNO.19、SEQ IDNO.21、SEQ IDNO.23, SEQ IDNO.25, SEQ IDNO.27 and SEQ IDNO.29 5 ' ends be respectively equipped with the nucleotides sequence of multiplex PCR Column, the nucleotides sequence of the multiplex PCR are classified as ACACTCTTTCCCTACACGACGCTCTTCCGATCTTACG.
Preferably, the SEQ IDNO.2, SEQ IDNO.4, SEQ IDNO.6, SEQ IDNO.8, SEQ IDNO.10、SEQ IDNO.12、SEQ IDNO.14、SEQ IDNO.16、SEQ IDNO.18、 SEQ IDNO.20、SEQ IDNO.22, SEQ IDNO.24, SEQ IDNO.26, SEQ IDNO.28 and SEQ IDNO.30 5 ' ends be respectively equipped with it is multiple The nucleotides sequence of the nucleotide sequence of PCR, the multiplex PCR is classified as GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTG GAA。
Preferably, further including upstream sequencing primer, the nucleotides sequence of the upstream sequencing primer is classified as AATGATACG GCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCT TCCGATCT。
Preferably, further including downstream sequencing primer, the nucleotides sequence of the downstream sequencing primer is classified as CAAGCAGAA GACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACG TGTGCTCTTCCGATCT, the NNNNNN are preset alkali The library sequence label of base composition, for distinguishing different samples.
The invention also discloses the detection methods of the kit of the detection neurotic personality, comprising the following steps:
Step 1, the DNA sample for obtaining subject;
Step 2 obtains the SNP site rs169235, the site SNP using SEQ IDNO.1~30 is corresponding Rs7005884, the SNP site rs10097870, the SNP site rs2953805, the SNP site rs6982308, institute State SNP site rs72694263, the SNP site rs7107356, the SNP site rs7111031, the SNP site Rs7502590, the SNP site rs11090045, the SNP site rs1422192, the SNP site rs2921036, institute The segment for stating SNP site rs1521732, the SNP site rs7175083 and the SNP site rs11082011, is corresponded to Multiplex PCR segment;
Step 3, using corresponding multiplex PCR segment described in the upstream sequencing primer and the downstream sequencing primer pair PCR is carried out, obtains corresponding building library segment;
Step 4 is sequenced to the library segment of building, analyzes to obtain testing result.
Preferably, further including buffer, dNTPs and archaeal dna polymerase.
Preferably, the buffer includes the MgCl of the KCl and 15mM of Tris-HCl, 500mM of 100mM2
Wherein, in SEQ IDNO.1, SEQ IDNO.3, SEQ IDNO.5, SEQ IDNO.7, SEQ IDNO.9, SEQ IDNO.11、SEQ IDNO.13、SEQ IDNO.15、SEQ IDNO.17、SEQ IDNO.19、SEQ IDNO.21、SEQ IDNO.23, SEQ IDNO.25, SEQ IDNO.27 and SEQ IDNO.29 5 ' end be respectively equipped with:
ACACTCTTTCCCTACACGACGCTCTTCCGATCTTACG;In SEQ IDNO.2, SEQ IDNO.4, SEQ IDNO.6、SEQ IDNO.8、SEQ IDNO.10、SEQ IDNO.12、SEQ IDNO.14、SEQ IDNO.16、SEQ IDNO.18, SEQ IDNO.20, SEQ IDNO.22, SEQ IDNO.24, SEQ IDNO.26, SEQ IDNO.28 and SEQ 5 ' the ends of IDNO.30 are respectively equipped with: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGAA, in SEQ IDNO.1-30 The purpose of being equipped with specific fragment is the segment that amplification obtains 5 ' SNP sites of the end containing particular sequence;Draw by upstream sequencing (nucleotide of upstream sequencing primer is written as AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCT to object CT TCCGATCT) and downstream sequencing primer (nucleotide of downstream sequencing primer is written as CAAGCAGAAGACGGCATACGAGAT NNNNNNGTGACTGGAGTTCAGACG TGTGCTCTTCCGATCT, NNNNNN are the library label sequence of preset base composition Column, for distinguishing different samples) it carries out building library, upstream sequencing primer and downstream sequencing primer are compared to ACACTCTTTCCC TACACGACGCTCTTCCGATCTTACG and GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGAA is to partly overlap , wherein ACACTCTTTCCCTACACGACGCTCTTCCGATCTTACG holds more 4 bases close to 3 ' than upstream sequencing primer, GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGAA than downstream sequencing primer close to 3 ' hold more 4 bases the reason of It is, if upstream sequencing and downstream sequencing primer are specific bindings in multiple PCR primer during amplified library On, then it can detect that multiple PCR primer is sequenced compared to upstream sequencing primer and downstream at 5 ' ends of amplified production and 3 ' ends 4 bases that primer has more can be confirmed that the sequence that multiplex PCR obtains is specific sequence in sequencing procedure.Expand in library During increasing, sequencing primer is not integrated on multiple PCR primer, but non-specifically combines homology in the genome High region, then 5 ' the ends and/or 3 ' ends of the product expanded be not in multiple PCR primer compared to upstream sequencing primer and/ Or 4 bases that downstream sequencing primer has more can filter the partial data in the process that sequencing data is analyzed in downstream Fall, avoids generating interference to analysis.
Wherein, the archaeal dna polymerase of reagent constituents of the invention is multiplex archaeal dna polymerase, multiplex Archaeal dna polymerase is a kind of archaeal dna polymerase for multiplex PCR, and with specific good, high sensitivity, amplification is uniform, G/C content is suitable With the wide advantage of property, it is suitable for multi-PRC reaction.
The invention discloses a kind of kit and detection method for detecting neurotic personality, kit of the invention passes through Relevant SNP site is detected to be measured neurotic personality.The invention also discloses the applications of the detection kit.This hair Bright kit when in use, obtains the DNA that subject can be obtained by way of acquisition subjects saliva or blood sample Sample, then, the primer pair and reagent provided using kit carry out multi-PRC reaction to the DNA sample of the subject of acquisition, Sequencing library is constructed, sequencing library is subjected to upper machine sequencing using high-flux sequence instrument, sequencing result is analyzed, mind is obtained Testing result through matter personality.From the experimental results, by the testing result of the kit of detection neurotic personality of the invention Compared with the result for having used big five scale, the present invention is close to the testing result of neurotic personality and the result of scale, and P > 0.05, there is reliability.It follows that the invention has the advantages that, the present invention is using gene information to neurotic people Lattice are detected, and are not used scale, are avoided that usage amount table bring error and uncertainty, keep testing result more objective;Inspection It is accurate to survey result;Using the mode of multiplex PCR, have quickly, high-resolution and analysis large sample size data at low cost.
It is a discovery of the invention that positioned at CACNA1E rs169235, positioned at the rs7005884 of XKR6, positioned at USP17L2's Rs10097870, the rs2953805 positioned at ERI1, the rs6982308 positioned at MSRA, positioned at PTPRD rs72694263, be located at The rs7107356 of OR4X2, the rs7111031 positioned at TTC12, the rs7502590 positioned at BAIAP2, positioned at ZC3H7B's Rs11090045, rs1422192, rs2921036 positioned at LINC00461, the rs1521732 positioned at LINGO2, it is located at The rs7175083 of LINGO1 and have a great impact positioned at the rs11082011 of CELF4 to neurotic personality.
Wherein, CACNA1E (calcium voltage-gated channel α 1E subunit) is protein coding gene.Calcium voltage-gated channel is deposited It is in the film of most of excitable cells, and the inflow in response to depolarizing mediate calcium, adjusts the internal procedure of cell, such as muscle The albumen of contraction, hormone secretion, neurotransmitter regulator and gene expression, gene coding is present in the film of most of excitable cells In, and the inflow of electrolytic calcium ion test is influenced, intracellular bioprocess, such as hormone secretion, neurotransmitter regulator are adjusted, nerve passes It leads and reaction and fluctuation that hormone secretion can all sway the emotion, determines the stability of mood.
The albumen of XKR6 gene coding is mainly expressed in thyroid gland, lymphoid tissue.Thyroid gland is highly important endocrine Organ, influences thyroid hormone secretion, thyroid hormone and mood is excited, mood swing has important relationship.
USP17L2 (17 sample family member 2 of ubiquitin-specific peptase) is protein coding gene.Its relational approach includes egg White matter metabolism and deubiquitination.With the Gene Ontology (GO) of gene-correlation annotation include cystein-type endopeptidase activity and Sulfydryl dependence ubiquitin hydrolytic enzyme activities.The egg of USP17L2 gene coding 17 sample family member 2 of ubiquitin-specific peptase It is white.Its participate in brain nervous cell protein deubiquitination adjust, for nerve cell signal transmitting and protein metabolism all With important regulating and controlling effect, research shows that the mutation of the gene loci and brain emotion control, mood swing and mood sensibility The psychological activity of aspect is closely related.
ERI1 (exoribonuclease 1) is protein coding gene.Its relational approach includes in nucleus and cytoplasm Gene expression and rRNA processing.ERI1 gene encoding ribose exonuclease 1, the enzyme influence the conjunction of adrenaline, cortisol At secretion.Adrenaline, cortisol are referred to as " negative hormone ", worry depression mainly by human body (especially brain) among Negative hormone secretion produced by or cause.
MSRA (methionine sulfoxide reductase A) is protein coding gene.MSRA gene encodes methionine sulfoxide also Protoenzyme A, the enzyme influence protein reparation and metabolism.Protein metabolism and the energetic supersession of body are closely related, energetic supersession Slowly in the easier psychology physiological activity for transferring energy into the negative emotions such as processing anxiety.
PTPRD (protein tyrosine phosphatase, D receptor) is protein coding gene.Disease relevant to PTPRD Including melanoma-astrocytoma syndrome and restless leg syndrome.Its relational approach includes PAK approach and across chemical synapse biography It broadcasts.The D receptor of PTPRD gene encoding tyrosine phosphatase, tyrosine phosphatase have wide expression in brain, kidney, into One step influences dopamine, adrenergic synthesis secretion, both hormones belong to " happy hormone ", can influence whether psychology is held Easily fall into worry anxiety.
OR4X2 (4 subfamily X member 2 (gene/pseudogene) of olfactory receptor family) is protein coding gene.Its related way Diameter has GPCR signal transduction and Olfactory signal path.OR4X2 gene encoding olfactory receptor family albumen, olfactory receptor with Scent molecule interaction in nose, triggers the neural elementary reaction of smell.Olfactory Receptor Neurons and many neurotransmitters and hormone Acceptor interaction influences the signal transduction and nerve liveness of brain together, is easy the new thought of excitation, new thinking.
TTC12 (tetrapeptide repetitive structure domain 12) is protein coding gene.TTC12 gene encodes tetrapeptide repetitive structure domain 12 Albumen.The albumen influences the secretion of thyroid hormone, male sex hormone, and thyroid hormone, male sex hormone can increase the energy of muscle Amount, is conducive to that human thinking is active and creativity.
BAIAP2 (BAI1 GAP-associated protein GAP 2) is protein coding gene.BAIAP2 gene encodes brain specific blood vessels and generates Inhibiting factor (BAI1) binding protein.The identification that the albumen influences insulin utilizes, and prompts insulin in central nervous system Effect in system, the growth reparation for promoting neuron, the growing state of neuron can further influence brain nervous excitation and Impulsion influences the formation of struggle will in brain.
ZC3H7B (Zinc Finger CCCH-Type Containing 7B) is a kind of protein coding gene. The albumen of ZC3H7B gene coding influences the synthesis secretion of adrenaline, estrogen, and male sex hormone influences nervous excitation and big Regulation of the brain to muscular movement, nervous excitation are easy to have excited the brain will striven, struggled.
LINC00461 is the gene guarded in a kind of evolution, can shear generation long non-coding RNA.Its relational approach includes Respiratory electron transport chain is coupled by chemosmosis and carries out ATP synthesis and generate heat by uncoupling protein. LINC00461 is the gene guarded in a kind of evolution, the in the brain expression of restrictive.The gene influences breathing electronics and passes Chain is passed, the reaction that can be swayed the emotion.
Rs2921036 is located at the perception of negative information in this site on the 8th article of chromosome of the mankind and human thinking Power and processing mode are related.
LINGO2 (rich in leucine repetitive sequence and containing 2 Ig structural domains) is a kind of protein coding gene. The albumen of LINGO2 gene coding is related with the synthesis of leucine, related with the reparation of growth hormone, nerve cell.
LINGO1 (rich in leucine repetitive sequence and containing 1 Ig structural domain) is a kind of protein coding gene.LINGO1 The albumen of gene coding is related with the formation of leucine, related with growth hormone, the reparation of nerve cell and Neurotransmission.
CELF4 (CUGBP Elav-Like family member 4) is protein coding gene.CELF4 gene encodes CUGBP Elav-Like family member's albumen.The albumen is expressed in brain, adrenal gland, and whether associated hormone will affect to have to strive and put forth energy Bucket spirit.
Detailed description of the invention
In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below There is attached drawing needed in technical description to be briefly described.
Fig. 1 shows the detection method flow chart of the kit of detection neurotic personality gene provided in an embodiment of the present invention;
Fig. 2 is that the genetic mutation rate result that the embodiment of the present invention detects is related to the appraisal result of Big five inventory Property analysis chart;
Specific embodiment
The present invention provides a kind of kits for detecting neurotic personality gene, for providing another accuracy high inspection Survey the product and method of neurotic personality.
The technical scheme in the embodiments of the invention will be clearly and completely described below, it is clear that described implementation Example is only a part of the embodiment of the present invention, instead of all the embodiments.Based on the embodiments of the present invention, this field is common Technical staff's every other embodiment obtained without making creative work belongs to the model that the present invention protects It encloses.
Wherein, it is commercially available or self-control that following embodiment is raw materials used.
Embodiment 1
The embodiment of the present invention is to expand SNP site rs169235, SNP site according to following principle targeted design Rs7005884, SNP site rs10097870, SNP site rs2953805, SNP site rs6982308, SNP site Rs72694263, SNP site rs7107356, SNP site rs7111031, SNP site rs7502590, SNP site Rs11090045, SNP site rs1422192, SNP site rs2921036, SNP site rs1521732, SNP site The nucleotide sequence of rs7175083 and SNP site rs11082011, wherein Tm value of the principle followed between primer pair connects Closely;G/C content is between 40-60%;Dimer cannot be formed after primer mixing;Primer has the special of height with target area Property.Therefore, primer pair are as follows: the nucleotide sequence of the primer pair of amplification SNP site rs169235 is as shown in IDNO.1~2 SEQ; The nucleotide sequence of the primer pair of SNP site rs7005884 is expanded as shown in IDNO.3~4 SEQ;Expand SNP site The nucleotide sequence of the primer pair of rs10097870 is as shown in IDNO.5~6 SEQ;Expand the primer of SNP site rs2953805 Pair nucleotide sequence as shown in IDNO.7~8 SEQ;Expand the nucleotide sequence of the primer pair of SNP site rs6982308 such as Shown in IDNO.9~10 SEQ;Expand nucleotide sequence such as IDNO.11~12 SEQ of the primer pair of SNP site rs72694263 It is shown;The nucleotide sequence of the primer pair of SNP site rs7107356 is expanded as shown in IDNO.13~14 SEQ;Amplification SNP The nucleotide sequence of the primer pair of point rs7111031 is as shown in IDNO.15~16 SEQ;Amplification SNP site rs7502590's draws The nucleotide sequence of object pair is as shown in IDNO.17~18 SEQ;Expand the nucleotides sequence of the primer pair of SNP site rs11090045 Column are as shown in IDNO.19~20 SEQ;Expand the nucleotide sequence such as SEQ IDNO.21 of the primer pair of SNP site rs1422192 Shown in~22;The nucleotide sequence of the primer pair of SNP site rs2921036 is expanded as shown in IDNO.23~24 SEQ;Amplification The nucleotide sequence of the primer pair of SNP site rs1521732 is as shown in IDNO.25~26 SEQ;Expand SNP site The nucleotide sequence of the primer pair of rs7175083 is as shown in IDNO.27~28 SEQ;Amplification SNP site rs11082011's draws The nucleotide sequence of object pair is as shown in IDNO.29~30 SEQ.
In SEQ IDNO.1, SEQ IDNO.3, SEQ IDNO.5, SEQ IDNO.7, SEQ IDNO.9, SEQ IDNO.11、SEQ IDNO.13、SEQ IDNO.15、SEQ IDNO.17、SEQ IDNO.19、 SEQ IDNO.21、SEQ IDNO.23, SEQ IDNO.25, SEQ IDNO.27, SEQ IDNO.29 5 ' end be equipped with: ACACTCTTTCCCTACACGACG CTCTTCCGATCTTACG;
In SEQ IDNO.2, SEQ IDNO.4, SEQ IDNO.6, SEQ IDNO.8, SEQ IDNO.10, SEQ IDNO.12、SEQ IDNO.14、SEQ IDNO.16、SEQ IDNO.18、SEQ IDNO.20、 SEQ IDNO.22、SEQ IDNO.24, SEQ IDNO.26, SEQ IDNO.28, SEQ IDNO.30 5 ' end be equipped with: GTGACTGGAGTTCAGACGTGT GCTCTTCCGATCTGGAA.Obtain amplification SNP site rs169235, SNP site rs7005884, SNP site rs10097870, The site SNP rs2953805, SNP site rs6982308, SNP site rs72694263, SNP site rs7107356, SNP position Point rs7111031, SNP site rs7502590, SNP site rs11090045, SNP site rs1422192, SNP site The multiple PCR primer of rs2921036, SNP site rs1521732, SNP site rs7175083 and SNP site rs11082011 It is right.
It is electric to progress after carrying out multiplex PCR amplification for 15 SNP sites according to above 15 pairs of multiple PCR primers The multiple PCR primer of swimming, electrophoresis result display design has good specificity.
Synthesizing upstream sequencing primer, (sequence of upstream sequencing primer is AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGACGCTCT TCCGATCT);Synthesizing downstream sequencing primer, (sequence of downstream sequencing primer is CAAGCAG AAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACG TGTGCTCTTCCGATCT, NNNNNN are preset base The library sequence label of composition, for distinguishing different samples, NNNNNN can combine for known random nucleotide).
Use 1,10,100, the human gene group DNA of 500ng as template, PCR is the results show that people's base to various concentration Because of a group DNA profiling, multiple PCR primer has all shown good expanding effect, illustrates that multiplex PCR used in the present embodiment draws Object can apply to human gene group DNA's template of various concentration range.Even with human gene group DNA's mould of low initial concentration Plate, multiple PCR primer used in the present embodiment equally have good expanding effect, illustrate multiple used in the present embodiment PCR primer can apply to the DNA profiling of low initial amount.
Embodiment 2
Flow chart as shown in Figure 1, the embodiment of the present invention are to 100 subjects (50 people of male, 50 people of women, age 18-26 years old) detection of neurotic personality is carried out, detecting step is as follows:
Step 1 allows testee to acquire saliva sample with buccal swab, extracts DNA from saliva sample;
Step 2, using in the 15 pairs of multiple PCR primers pair and kit of embodiment 1 ingredient (buffer, dNTPs and Archaeal dna polymerase) carry out first round multi-PRC reaction;
Step 3 carries out first round magnetic beads for purifying to the product of first round multi-PRC reaction;
Step 4 mixes the nucleic acid product of first round magnetic beads for purifying with upstream sequencing primer and downstream sequencing primer, carries out Second wheel sequencing sequence PCR reaction, to obtain can be carried out the library of upper machine sequencing
Step 5 carries out the second wheel magnetic beads for purifying to the product of the second wheel joint sequence PCR reaction;
Step 6, using 2100 nucleic acid fragment analyzer of agilent to second wheel magnetic beads for purifying library carry out upper machine before Measurement and quality inspection, upper machine sequencing after qualified;
Step 7, second library of taking turns magnetic beads for purifying qualified to step 6 are sequenced, and analyze lower machine data
It is counted by quality of the following index to sequencing data, by taking the sequencing data of a sample as an example
(1) Sample:M1
(2) Raw bases (Mb): 15.76.Initial data total bases, unit Mb;
(3) Clean bases (Mb): 11.95.Remaining total bases, unit Mb unite down after initial data filtering Meter index is based on the data;
(4) QCrate (%): 75.8.Filter ratio, Clean bases (Mb)/Raw bases (Mb);
(5) Average read length:118.The average reading of sequencing is long, and (length is averagely read after Quality Control can compare original number According to reading, length is slightly short);
(6) Average base quality:33.6.Base average mass values are sequenced, generally >=30;
(7) Average insert size:217.7.Averagely build library length;
(8) Duplication rate (%): NA.Both-end length and the duplicate a pair of sequences of base, can be determined To be that repeating signal is got rid of, the ratio of the repeating signal is known as repetitive rate;
(9) Mapped reads (M): 0.08.Compare the sequence number on reference genome;
(10) Accurate mapped bases (Mb): 11.60.Compare the base sum (removal on reference genome Soft clip);
(11) Accurate mapping rate (%): 96%.Comparison rate, generally under normal circumstances >=90%;
(12) Target size:65.The target area size for needing to capture;
(13) Target covered size:65.The target area size of actual acquisition;
(14) Coverage rate (%): 100.Coverage rate, Target covered size/Target size;
(15) Target overlaped reads (M): 0.08.The sequence sum that target area covers;
(16) Reads capture rate (%): 100.Sequence capturing rate, Target overlaped reads/ Mapped reads;
(17) Target effective bases (Mb): 10.85.The base sum that target area covers;
(18) Bases capture rate (%): 93.5.Base capture rate, Target effective bases/ Accurate mapped bases;
(19) Target mean depth:250.The mean depth of target area, Target effective bases/ Target size;
(20) 4X coverage rate (%): 100.Depth >=4X target area ratio;
(21) 10X coverage rate (%): 99.31.Depth >=10X target area ratio;
(22) 20X coverage rate (%): 97.63.Depth >=20X target area ratio;
(23) 5%X mean depth coverage rate (%): 99.42.Depth >=mean depth 5%X mesh Mark region rate (assuming that 200 layers of mean depth, be exactly the ratio more than or equal to 10 layers);
(24) 20%X mean depth coverage rate (%): 97.95.Depth >=mean depth 20%X Target area ratio;
(25) 50%X mean depth coverage rate (%): 88.63.Depth >=mean depth 50%X Target area ratio;
(26) Flank 10%X mean depth coverage rate (%): 16.37.Mean depth two sides 10% are deep The target area ratio (assuming that 100 layers of mean depth, be exactly 90-110 layers of ratio) of degree;
Sequencing result detects qualification, and the sequence that sequencing result is compared to target area is carried out SNP site analysis.
Table 1
SNP site Gene With neurotic related base type
rs169235 CACNA1E G
rs7005884 XKR6 G
rs10097870 USP17L2 G
rs2953805 ERI1 T
rs6982308 MSRA G
rs72694263 PTPRD C
rs7107356 OR4X2 G
rs7111031 TTC12 C
rs7502590 BAIAP2 G
rs11090045 ZC3H7B A
rs1422192 LINC00461 A
rs2921036 It does not find T
rs1521732 LINGO2 C
rs7175083 LINGO1 C
rs11082011 CELF4 T
The testing result of the embodiment of the present invention are as follows:
If occurring the ratio with neurotic related base type in genetic test result less than 40%, illustrate nervousness Lesser extent;It is greater than 60% if there is the ratio with neurotic related base type, illustrates that neurotic degree is heavier;If Occur and the ratio of neurotic related base type is between 40-60%, illustrates that neurotic degree is moderate.
Testing result is as follows, and table 2 is the number result of the men and women of the neurotic degree of difference of detection of the embodiment of the present invention.
Table 2
Use Big five inventory as confirmatory experiment 100 subjects, the subject of Xiang Jinhang genetic test provides (Big five inventory, i.e. NEO personality inventory, are built upon on the basis of five-factor model personality theory Big five inventory.By the U.S. Psychologist Coase tower Costa and Mike's thunder McCrae were compiled into 1987), 100 parts in total, 100 parts are recycled, statistical Analysis is all effective.Scale result such as table 3.
Table 3
It is neurotic Flare It is open Pleasant property The sense of duty
Man 39.26±6.10 46.94±5.83 42.42±5.15 39.00±6.04 49.36±5.59
Woman 41.35±7.72 45.72±6.14 40.76±4.23 40.61±6.12 49.23±5.07
Wherein, table 4 is men and women's demographics result that neurotic degree is different in scale result.
Table 4
Neurotic degree is low (< 35) Neurotic degree is medium (35-40) Neurotic degree is high (40 <)
Man 16 18 18
Woman 13 15 20
Phase is carried out with the result obtained using Big five inventory detection using the result of kit to the embodiment of the present invention The analysis of closing property, the appraisal result correlation of the genetic mutation rate result that the embodiment of the present invention detects and Big five inventory is very Height, r 0.8214 illustrate that the kit of detection neurotic personality of the invention can be used for detecting neurotic personality.
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered It is considered as protection scope of the present invention.
Sequence table
<110>first kind health endowment group
<120>a kind of kit and detection method for detecting neurotic personality gene
<160> 30
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
catggcctgc aagggtttgg 20
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
ccatccactg cgtctccatc 20
<210> 3
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
gaatcttaaa tttttaaaaa atg 23
<210> 4
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
aagcaggaaa aggtccttgc 20
<210> 5
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
aacagacttc cacgcacttg c 21
<210> 6
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
ccaagagcct gcaatgtgag t 21
<210> 7
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
gacagggact cgctctgtcg 20
<210> 8
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
ggctaacacg tacacaggag c 21
<210> 9
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
tgtggttcct tctgctggca g 21
<210> 10
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
ataatatatt agtgtttaag tc 22
<210> 11
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
gaaaactgaa gttctggata c 21
<210> 12
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
gtattacttt cttaaaatct tgc 23
<210> 13
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
gaggctgagg taggcagatc a 21
<210> 14
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 14
gaggttcaag tgatccttat gc 22
<210> 15
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 15
gaatgaggct gggtgaggac 20
<210> 16
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 16
aagccctatt actcctcgtc 20
<210> 17
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 17
atctgtttgg gagtgtgcaa c 21
<210> 18
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 18
cgtgttcctt tggaaggctc 20
<210> 19
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 19
gccgccctca tcaggcagc 19
<210> 20
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 20
ccctcctcaa ccaggagagc 20
<210> 21
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 21
tgatttacac acatcatgag 20
<210> 22
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 22
gccactgtga ttgacattgc 20
<210> 23
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 23
agaccacctt cccaagccat cc 22
<210> 24
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 24
agggcagggg ccagtgtgac ag 22
<210> 25
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 25
ctggattgat tctgtttcaa g 21
<210> 26
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 26
aataatctgg attattttct g 21
<210> 27
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 27
ccttggaaaa tatcccacag c 21
<210> 28
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 28
atagggacag ctggtaagac tg 22
<210> 29
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 29
ccaagccccg tctcctcgat cc 22
<210> 30
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 30
cgcggtggag ggaggcgctc g 21

Claims (10)

1. SNP site rs169235, SNP site rs7005884, SNP site rs10097870, SNP position in mankind's full-length genome Point rs2953805, SNP site rs6982308, SNP site rs72694263, SNP site rs7107356, SNP site Rs7111031, SNP site rs7502590, SNP site rs11090045, SNP site rs1422192, SNP site Rs2921036, SNP site rs1521732, SNP site rs7175083 and SNP site rs11082011 are in preparation detection nerve Application in matter personality product.
2. a kind of kit for detecting neurotic personality, which is characterized in that the primer pair including expanding following SNP site, it is described SNP site includes: SNP site rs169235, SNP site rs7005884, SNP site rs10097870, SNP site Rs2953805, SNP site rs6982308, SNP site rs72694263, SNP site rs7107356, SNP site Rs7111031, SNP site rs7502590, SNP site rs11090045, SNP site rs1422192, SNP site Rs2921036, SNP site rs1521732, SNP site rs7175083 and SNP site rs11082011.
3. the kit of detection neurotic personality according to claim 2, which is characterized in that
The nucleotide sequence of the primer pair of the amplification SNP site rs169235 is as shown in IDNO.1~2 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs7005884 is as shown in IDNO.3~4 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs10097870 is as shown in IDNO.5~6 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs2953805 is as shown in IDNO.7~8 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs6982308 is as shown in IDNO.9~10 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs72694263 is as shown in IDNO.11~12 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs7107356 is as shown in IDNO.13~14 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs7111031 is as shown in IDNO.15~16 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs7502590 is as shown in IDNO.17~18 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs11090045 is as shown in IDNO.19~20 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs1422192 is as shown in IDNO.21~22 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs2921036 is as shown in IDNO.23~24 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs1521732 is as shown in IDNO.25~26 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs7175083 is as shown in IDNO.27~28 SEQ;
The nucleotide sequence of the primer pair of the amplification SNP site rs11082011 is as shown in IDNO.29~30 SEQ.
4. the kit of detection neurotic personality according to claim 3, which is characterized in that SEQ IDNO.1, SEQ IDNO.3、SEQ IDNO.5、SEQ IDNO.7、SEQ IDNO.9、SEQ IDNO.11、SEQ IDNO.13、SEQ IDNO.15、 SEQ IDNO.17, SEQ IDNO.19, SEQ IDNO.21, SEQ IDNO.23, SEQ IDNO.25, SEQ IDNO.27 and SEQ 5 ' the ends of IDNO.29 are respectively equipped with the nucleotide sequence of multiplex PCR, and the nucleotides sequence of the multiplex PCR is classified as ACACTCTTTC CCTACACGACGCTCTTCCGATCTTACG。
5. the kit of detection neurotic personality according to claim 4, which is characterized in that SEQ IDNO.2, SEQ IDNO.4、SEQ IDNO.6、SEQ IDNO.8、SEQ IDNO.10、SEQ IDNO.12、SEQ IDNO.14、SEQ IDNO.16、 SEQ IDNO.18, SEQ IDNO.20, SEQ IDNO.22, SEQ IDNO.24, SEQ IDNO.26, SEQ IDNO.28 and SEQ 5 ' the ends of IDNO.30 are respectively equipped with the nucleotide sequence of multiplex PCR, and the nucleotides sequence of the multiplex PCR is classified as GTGACTGGAG TTCAGACGTGTGCTCTTCCGATCTGGAA。
6. the kit of detection neurotic personality according to claim 5, which is characterized in that further include that upstream sequencing is drawn The nucleotides sequence of object, the upstream sequencing primer is classified as AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACG ACGCTCTTCCGATCT。
7. the kit of detection neurotic personality according to claim 6, which is characterized in that further include that downstream sequencing is drawn The nucleotides sequence of object, the downstream sequencing primer is classified as CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTC AGACGTGTGCTCTTCCGATCT, the NNNNNN are the library sequence label of preset base composition, different for distinguishing Sample.
8. the detection method of the kit of detection neurotic personality as claimed in claim 7, which is characterized in that including following step It is rapid:
Step 1, the DNA sample for obtaining subject;
Step 2, using SEQ IDNO.1~30 it is corresponding obtain the SNP site rs169235, the SNP site rs7005884, The SNP site rs10097870, the SNP site rs2953805, the SNP site rs6982308, the SNP site Rs72694263, the SNP site rs7107356, the SNP site rs7111031, the SNP site rs7502590, institute State SNP site rs11090045, the SNP site rs1422192, the SNP site rs2921036, the SNP site The segment of rs1521732, the SNP site rs7175083 and the SNP site rs11082011, obtain corresponding multiplex PCR Segment;
Step 3 is carried out using corresponding multiplex PCR segment described in the upstream sequencing primer and the downstream sequencing primer pair PCR obtains corresponding building library segment;
Step 4 is sequenced to the library segment of building, analyzes to obtain testing result.
9. the kit of detection neurotic personality according to claim 2, which is characterized in that further include buffer, dNTPs And archaeal dna polymerase.
10. the kit of detection neurotic personality according to claim 8, which is characterized in that the buffer includes The MgCl of the KCl and 15mM of Tris-HCl, 500mM of 100mM2
CN201910020843.0A 2019-01-09 2019-01-09 A kind of kit and detection method detecting neurotic personality gene Pending CN109593844A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910020843.0A CN109593844A (en) 2019-01-09 2019-01-09 A kind of kit and detection method detecting neurotic personality gene

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910020843.0A CN109593844A (en) 2019-01-09 2019-01-09 A kind of kit and detection method detecting neurotic personality gene

Publications (1)

Publication Number Publication Date
CN109593844A true CN109593844A (en) 2019-04-09

Family

ID=65965928

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910020843.0A Pending CN109593844A (en) 2019-01-09 2019-01-09 A kind of kit and detection method detecting neurotic personality gene

Country Status (1)

Country Link
CN (1) CN109593844A (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2666584A1 (en) * 2006-10-17 2008-04-24 Synergenz Bioscience Limited Methods and compositions for assessment of pulmonary function and disorders
US20090209622A1 (en) * 2006-11-21 2009-08-20 Smoller Jordan W Diagnosis of anxiety disorders
US20140045915A1 (en) * 2010-08-31 2014-02-13 The General Hospital Corporation Cancer-related biological materials in microvesicles
US20170240967A1 (en) * 2009-10-22 2017-08-24 Leiden University Disease susceptibility
CN107895303A (en) * 2017-11-15 2018-04-10 电子科技大学 A kind of method of the personalized recommendation based on OCEAN models

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2666584A1 (en) * 2006-10-17 2008-04-24 Synergenz Bioscience Limited Methods and compositions for assessment of pulmonary function and disorders
US20090209622A1 (en) * 2006-11-21 2009-08-20 Smoller Jordan W Diagnosis of anxiety disorders
US20170240967A1 (en) * 2009-10-22 2017-08-24 Leiden University Disease susceptibility
US20140045915A1 (en) * 2010-08-31 2014-02-13 The General Hospital Corporation Cancer-related biological materials in microvesicles
CN107895303A (en) * 2017-11-15 2018-04-10 电子科技大学 A kind of method of the personalized recommendation based on OCEAN models

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
MICHELLE LUCIANO等: "Association analysis in over 329,000 individuals identifies 116 independent variants influencing neuroticism", 《NAT GENET》 *
PUI-YAN KWOK: "《Single Nucleotide Polymorphisms: Methods and Protocols》", 31 December 2002, HUMANA PRESS *
丁振若等: "《实用检验医学手册》", 31 December 2008, 人民军医出版社 *
元英进等: "《现代制药工艺学 上》", 31 July 2004, 化学工业出版社 *
曾佑炜等: "《基因工程技术》", 31 July 2010, 中国轻工业出版社 *
李忻蓉等: "汉族人群去甲肾上腺素转运体T182C基因多态性与人格特征的关联性", 《中国组织工程研究与临床康复》 *
杨清玲等: "《分子生物学实验指导》", 31 December 2016, 中国科学技术大学出版社 *

Similar Documents

Publication Publication Date Title
Poo et al. Spatial maps in piriform cortex during olfactory navigation
Cadwell et al. Electrophysiological, transcriptomic and morphologic profiling of single neurons using Patch-seq
Evans et al. Genetics, morphology, advertisement calls, and historical records distinguish six new polyploid species of African clawed frog (Xenopus, Pipidae) from West and Central Africa
Schoenfeld et al. The anatomical logic of smell
Stoneking et al. New approaches to dating suggest a recent age for the human mtDNA ancestor
Manzini et al. Principles of odor coding in vertebrates and artificial chemosensory systems
Hatt Molecular and cellular basis of human olfaction
Gerhold et al. The star-nosed mole reveals clues to the molecular basis of mammalian touch
Wooding Phenylthiocarbamide: a 75-year adventure in genetics and natural selection
Zhan et al. Diverse patterns of odor representation by neurons in the anterior piriform cortex of awake mice
CN104359946B (en) It is a kind of that device is sequenced to the monomolecular nucleic acid of electrode based on nanometer
Labouesse et al. GPCR-based dopamine sensors—a detailed guide to inform sensor choice for in vivo imaging
CN104955958A (en) Nucleic acid sequencing using tags
CN105189748A (en) Methods of sequencing the immune repertoire
Muslimov et al. Spatial codes in dendritic BC1 RNA
JP2011007741A (en) Odor sensor, and odor detecting method
Estil et al. Why might language and motor impairments occur together?
CN106319074A (en) LNA probe for detecting KRAS gene mutation and detection method
CN110373474A (en) The relevant genetic marker of Gansu Province east Cashmere Goat diameter and its application
CN109593844A (en) A kind of kit and detection method detecting neurotic personality gene
CN109628610A (en) Detect the kit and detection method of neurotic personality gene
Yuferov et al. Biological clock: biological clocks may modulate drug addiction.
CN108138131A (en) Increase the DNA sequence dna that the odorant receptor in olfactory system represents
JP2008054590A (en) Method for evaluating exercise stress state
US20030093225A1 (en) Method for reducing noise in analytical assays

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20190409