CN109504772A - A kind of detection method based on digital pcr platform POLE gene mutation - Google Patents
A kind of detection method based on digital pcr platform POLE gene mutation Download PDFInfo
- Publication number
- CN109504772A CN109504772A CN201811448553.8A CN201811448553A CN109504772A CN 109504772 A CN109504772 A CN 109504772A CN 201811448553 A CN201811448553 A CN 201811448553A CN 109504772 A CN109504772 A CN 109504772A
- Authority
- CN
- China
- Prior art keywords
- nos
- digital pcr
- seq
- pole
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of detection methods based on digital pcr platform POLE gene mutation.This method is to carry out abrupt climatic change based on F367S site of the ABI QuantStudio 3D digital pcr system to POLE gene, utilize the differentiation wild type of MGB probe specificity and the sample of saltant type, good testing result can be obtained in the sample of low abundance and muting sensitivity simultaneously, assay reproducibility can be good, error is small, is the advantage technology of with detecting low abundance mutant proportion.
Description
Technical field
The present invention relates to biological detecting method technical fields, and in particular to one kind is prominent based on digital pcr platform POLE gene
The detection method of change.
Background technique
Since round pcr is since the 1980s is by invention, this method has become life science field
In one of most basic and most conventional experimental method.The traditional round pcr of the first generation using the method for agarose gel electrophoresis come
PCR product is analyzed, but this method is primarily adapted for use in quantitative and semi-quantitative research.Go out at the beginning of 2 () century 9 () ages
Quantitative PCR (quantitative PCR, the qPCR) technology for having showed the second generation, by the way that fluorescent dye is added in reaction method,
The fluorescence signal issued in detection reaction reaches the recurring number i.e. cycle threshold (cycle threshold, Ct) of threshold value to calculate
The content of purpose acid sequence.QPCR technology is still widely made by each laboratory at present because of its quick, simple and economic feature
With.But qPCR technology it is so-called it is " quantitative " be still it is opposite, depend on Ct value and standard curve.QPCR is in aim sequence content
It is low, expression difference is very small, in reaction method containing when a large amount of background sequences or mortifier, sensitivity and accuracy
All it is very limited.In this background, third generation PCR --- digital pcr (digitalPCR, dPCR) comes into being.
The principle of digital pcr be dPCR reaction method is evenly distributed in a large amount of reaction members, do not include in each reaction member or
Multiple purpose nucleic acid sequences are arrived comprising one, the quantity of purpose nucleic acid sequence meets Poisson distribution.Then in each reaction member
In independently carry out PCR amplification.After amplification, detect the fluorescence signal of each reaction member, finally according to Poisson distribution and
The reaction member of the fluorescence signal positive accounts for the ratio of all reaction members to calculate the copy number of purpose nucleic acid sequence.It is anti-in dPCR
Answer the generation process of middle fluorescence signal substantially identical as qPCR.DPCR technology qPCR technology has advantage below: (1) highly sensitive
Degree.One traditional PCR reaction is substantially become tens of thousands of a PCR and reacted by dPCR, in this tens of thousands of a reaction member respectively
Independent detection aim sequence, to substantially increase the sensitivity of detection.(2) pinpoint accuracy.DPCR is by calculating at tens of thousands of
Positive numbe rof reactor unit amount and ratio, can accurately detect out the aim sequence difference varied less in reaction member.(3) high
Tolerance.The process of dPCR technology first step reaction method distribution, can be such that background sequence and PCR response inhabitation object is uniformly divided
It is fitted on each reaction member, and in most of reaction member and does not contain aim sequence, low-abundance aim sequence is by relatively rich
It combines in certain reaction members, reaction is done to reduce background sequence and mortifier in these reaction members significantly
It disturbs.In addition, dPCR only judges male/female two states when carrying out result interpretation to each reaction member, independent of Ct
Value, is influenced to be greatly lowered, also be greatly improved to the tolerance of background sequence and mortifier by amplification efficiency.(4) absolutely fixed
Amount.PCR directly calculates the copy number of aim sequence, and needing not rely upon ct value and standard curve can be carried out accurately absolutely determining
Amount detection.
At least l5 kind archaeal dna polymerase in human genome, the common duplication and reparation for participating in genome.According to the homologous of gene
Property, archaeal dna polymerase can be divided into 7 families, be respectively as follows: A, B, C, D, X, Y and RT family.Archaeal dna polymerase e (DNA
Polymerase epsilon, polr) with pola, po18, pol belong to archaeal dna polymerase B family.The catalysis of archaeal dna polymerase ￡
Subunit fcatalytic subunit ofDNA polymerase epsilon, POLE) be polr core, tool is there are two types of urging
Change activity, first is that the duplication for being responsible for the new chain of DNA extends using DNA as the polymerase activity of template；Second is that the school in exonuclease area
Positive activity is responsible for that base mismatch is identified and repaired.Wherein, the structure of proofreading activity is known as the exonuclease of POLE
Area has 3 ' exonuclease activities, can identify in time and cut off the false bases generated in reproduction process.Encode P0LE core
The gene mutation in sour excision enzyme area will lead to calibration function missing, leads mutagenic gene and largely accumulates in cell.In recent years
Detect POLE.EDMs in the kinds of tumors such as endometrioid carcinoma, colon cancer, show unique molecular phenotype, prognosis compared with
It is good, therefore detect OLE exonuclease area and be expected to become the useful indicators for judging tumor prognosis with the presence or absence of mutation.POLE nucleic acid
Excision enzyme area is responsible for the calibration function of cellular replication, and mutation will cause calibration function to lack, and intracellular error mutation largely tires out
Product, influences tumor development.The tumor patient of POLE exonuclease region mutation light, good prognosis spy with age of onset
Point is expected to the New Set as judging prognosis.But now for the morphology and Immunohistochemical Expression of POLE mutated tumor
The research of rate is relatively fewer, can be used as the new direction of research from now on, provides more diagnosis for clinical diagnosis POLE mutant tumours
Foundation.
Summary of the invention
In view of the above-mentioned problems existing in the prior art and demand, it is flat based on digital pcr that the object of the present invention is to provide one kind
The detection method of platform POLE gene mutation, using the low abundance recall rate of digital pcr platform, high sensitivity, high specific it is excellent
Gesture improves the detection performance to gene mutation site, to better meet the requirement of scientific research and clinic.
Technical solution: to achieve the goals above, the present invention provides a kind of based on digital pcr platform POLE gene mutation
Detection method: the detection method includes the following steps:
(1) prepare digital pcr reaction mixture: the sample containing genes DNA template to be detected, POLE gene forward and reverse expand
Increase primer, POLE genetic marker TaqMan probe, reference gene B2M forward and reverse amplimer, reference gene B2M label
TaqMan probe and the mixing of PCR reaction premixed liquid, are prepared digital pcr reaction mixture；
(2) digital pcr reaction chip is prepared；
(3) digital pcr amplification program is carried out；
(4) reading of pcr chip fluorescence signal is carried out；
(5) data analysis and result statistics.
Preferably, the POLE gene forward and reverse amplimer designed in the step (1) includes for expanding POLE gene
Specific primer pair, the specific primer is to including an a forward primer SEQ ID Nos:1 and reverse primer SEQ
The sequence of ID Nos:2, forward primer SEQ ID Nos:1 are as follows: AGCCACCTCCTAAGTCGACATGGGA, reverse primer SEQ
The sequence of ID Nos:2 are as follows: CTGCTTCTGAACTTTGGGAGAGG.
Preferably, POLE genetic marker TaqMan probe can be with specific hybrid POLE gene comprising two in the step (1)
Probe SEQ ID Nos:3 and SEQ the ID Nos:4 of amplification region, probe SEQ ID Nos:3 specific hybrid wild-type amplification
Product, the sequence of SEQ ID Nos:3 are as follows: AGTCAAAAAAGTCCC；Probe SEQ ID Nos:4 specific hybrid saltant type expands
Increase production object, the sequence of SEQ ID Nos:4 are as follows: ACTCACCAGTCAGAAAAG.
Preferably, which is characterized in that the reference gene forward and reverse amplimer designed in the step (1) includes for expanding
Increase the specific primer pair of reference gene B2M, the specific primer is to including a forward primer SEQ ID Nos:5 and one
The sequence of reverse primer SEQ ID Nos:6, forward primer SEQ ID Nos:5 are as follows: CACTGAATTCACCCCCACTG, reversely
The sequence of primer SEQ ID Nos:6 are as follows: AAGCAGAATTTGGAATTCATCC.
Preferably, the reference gene label TaqMan probe in the step (1) can be with specific hybrid internal reference base comprising one
Because of the probe SEQ ID Nos:7 of B2M amplification region, probe SEQ ID Nos:7 sequence are as follows: ATGGAGGTTTGAAGA.
Preferably, the fluorescein of the probe label of POLE genes of SEQ ID Nos:3 specific hybrid wild-type amplification product is
The fluorescein of the probe label of VIC, POLE genes of SEQ ID Nos:4 specific hybrid saltant type amplified production is FAM.
Preferably, it is ROX that reference gene B2M, which marks the fluorescein of TaqMan probe label,.
Preferably, the digital pcr amplification program of the step (3) are as follows: 95 DEG C of thermal startings, 10 minutes；94 DEG C of denaturation, 30 seconds；60
DEG C annealing, 60 seconds；Expand 40 circulations；98 DEG C of enzyme inactivations, 10 minutes；4 DEG C of heat preservations.
Compared with prior art, the invention has the following beneficial effects:
(1) detection method of the present invention based on digital pcr platform POLE gene mutation relatively passes in terms of detection sensitivity
System method increases significantly, the minimum mutation that can detecte to 1% of when previous traditional fluorescence quantitative PCR detection gene mutation
Ratio, and the present invention is based on the detection method of digital pcr platform development, its lowest detection ratio can achieve 0.1%, be mutated
There is very big advantage in the low detection demand of ratio.
(2) detection method of the present invention based on digital pcr platform POLE gene mutation has the advantage of absolute quantitation, passes
Quantitative fluorescent PCR of uniting is the detection method for belonging to relative quantification, needs to take the concentration for calculating sample to be tested according to standard curve,
And the bright detection method based on digital pcr platform POLE gene mutation of this law is a kind of detection method of absolute quantitation, detection
As a result the concentration of sample to be examined and the quantity of the corresponding sample containing mutated gene are directly prompted in, to count mutation ratio
Example.
(3) detection method of the present invention based on digital pcr platform POLE gene mutation is easy to operate, fixed with conventional fluorescent
The compatibility for measuring round pcr is high, and as a result detection consistency is good, application value with higher.
Detailed description of the invention
Fig. 1 is the digital pcr testing result figure of sample-1；
Fig. 2 is the digital pcr testing result figure of sample-2.
Specific embodiment
It is of the invention below by way of combining following specific embodiments to further illustrate.It should be pointed out that real in detail below
It applies mode for explaining only the invention, is not used to be defined the contents of the present invention.
A kind of detection method based on digital pcr platform POLE gene mutation, which is characterized in that the detection method includes
Following steps:
(1) prepare digital pcr reaction mixture: the sample containing genes DNA template to be detected, POLE gene forward and reverse expand
Increase primer, POLE genetic marker TaqMan probe, reference gene B2M forward and reverse amplimer, reference gene B2M label
TaqMan probe and the mixing of PCR reaction premixed liquid, are prepared digital pcr reaction mixture；
(2) digital pcr reaction chip is prepared；
(3) digital pcr amplification program is carried out；
(4) reading of pcr chip fluorescence signal is carried out；
(5) data analysis and result statistics.
Detection method of the present invention based on digital pcr platform POLE gene mutation is mainly based upon digital pcr platform pair
The method that POLE gene F367S gene mutation site is detected.According to the Statistics of digital pcr, this method be can detecte
The sample of low-abundance sample size and low mutant proportion.First choice is that the sequence design based on the site POLE gene F367S is a pair of
The primer pair of specific amplification, at the same mutational site region design two 15bp TaqMan probe, respectively by with it is wild
Type and the hybridization of saltant type amplified production, obtain fluorescence signal.Signal receipts are further carried out to reaction chip by CCD imaging technique
Collection eventually passes through software calculating, using Poisson distribution Statistics to wild-type probe signal and saltant type probe signals into
Line number calculates according to statistics, finally obtains the concentration information of sample to be examined, mutant proportion information.
The digital pcr platform involved in the present invention arrived is ABI QuantStudioTM3D digital pcr system, used experiment
Reagent is the matched pcr amplification reaction method of the platform.
Below by embodiment, the present invention is furture elucidated.It should be pointed out that the present invention is not intended to be limited to the reality
Apply example.
Embodiment 1
(1) patient's extracting genome DNA
Extracting genome DNA operation is carried out to the tumor sample of patient in Biohazard Safety Equipment.Using QIAamp DNA FFPE
Tissue Kit (Qiagen Cat No:56404) extracts experiment.
(2) design of primers
Design of primers is carried out for the site gene F367S people POLE, is drawn respectively for the PCR of a pair of of specificity of this site design
Object and two hybridization probes are respectively used to hybridization wild-type amplification product and saltant type amplified production, while according to reference gene
The sequence design pair for amplification primer of B2M, while hybridization probe is marked with ROX.Designed PCR primer and probe sequence such as table
Shown in 1.
Table 1
(3) specific PCR reacts
The target fragment comprising the site POLE gene F367S is amplified using specific PCR technology, according to the reaction method of table 2
Amplified reaction is prepared, reaction method is expanded after the completion of preparing according to the response procedures of table 3.
Table 2
Table 3
(4) reading of pcr chip fluorescence signal is carried out:
Chip after reaction, is put into the card slot of reading data by PCR, and push-in, instrument is read automatically；Screen shows read access time
After, chip can be directly taken out.If primary experiment detects multiple samples, can take out after a chip directly
It is put into next chip to be read, until after last chip is read, all chips of reading before analyzing together.
After all chip analysis are complete, data are exported to USB.
(5) data analysis and result statistics:
Pcr chip detection data is directed on the Cloud Server of Thermo, using cloud processing software, detection data is carried out
Analysis.It needs to register user account before data analysis, can freely be used after completing register flow path.
The analysis result of the present embodiment is as shown in table 4, table 5 and Fig. 1, Fig. 2.The present embodiment pattern detection result is mutant proportion
0.12%, it carries out repeating to test twice respectively, is denoted as sample-1 and sample-2.The valid data of whole reaction chip are
16350/16360, wherein saltant type valid data are 2/2, and wild type valid data are 2354/2290, with practical PCR applied sample amount
10ng is almost the same.
Table 4
Table 5
| Sample | #FAM | #VIC | #FAMVIC | #Undetermined | #NOAMP |
| sample-1 | 2 | 2354 | 1 | 0 | 16350 |
| sample-2 | 2 | 2290 | 1 | 0 | 16360 |
The embodiments described above only express several embodiments of the present invention, and the description thereof is more specific and detailed, but simultaneously
It cannot therefore be construed as limiting the scope of the patent.It should be pointed out that coming for those of ordinary skill in the art
It says, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to protection of the invention
Range.
Claims (8)
1. a kind of detection method based on digital pcr platform POLE gene mutation, which is characterized in that the detection method includes such as
Lower step:
(1) prepare digital pcr reaction mixture: the sample containing genes DNA template to be detected, POLE gene forward and reverse expand
Increase primer, POLE genetic marker TaqMan probe, reference gene B2M forward and reverse amplimer, reference gene B2M label
TaqMan probe and the mixing of PCR reaction premixed liquid, are prepared digital pcr reaction mixture；
(2) digital pcr reaction chip is prepared；
(3) digital pcr amplification program is carried out；
(4) reading of pcr chip fluorescence signal is carried out；
(5) data analysis and result statistics.
2. the detection method according to claim 1 based on digital pcr platform POLE gene mutation, which is characterized in that institute
Stating the POLE gene forward and reverse amplimer designed in step (1) includes the specific primer for expanding POLE gene
Right, the specific primer is to comprising a forward primer SEQ ID Nos:1 and a reverse primer SEQ ID Nos:2, just
To the sequence of primer SEQ ID Nos:1 are as follows: the sequence of AGCCACCTCCTAAGTCGACATGGGA, reverse primer SEQ ID Nos:2
It is classified as: CTGCTTCTGAACTTTGGGAGAGG.
3. the detection method according to claim 1 based on digital pcr platform POLE gene mutation, which is characterized in that institute
Stating POLE genetic marker TaqMan probe in step (1) can be with the spy in specific hybrid POLE gene magnification region comprising two
Needle SEQ ID Nos:3 and SEQ ID Nos:4, probe SEQ ID Nos:3 specific hybrid wild-type amplification product, SEQ ID
The sequence of Nos:3 are as follows: AGTCAAAAAAGTCCC；Probe SEQ ID Nos:4 specific hybrid saltant type amplified production, SEQ ID
The sequence of Nos:4 are as follows: ACTCACCAGTCAGAAAAG.
4. the detection method according to claim 1 based on digital pcr platform POLE gene mutation, which is characterized in that institute
Stating the reference gene forward and reverse amplimer designed in step (1) includes drawing for expanding the specificity of reference gene B2M
Object pair, the specific primer to comprising a forward primer SEQ ID Nos:5 and a reverse primer SEQ ID Nos:6,
The sequence of forward primer SEQ ID Nos:5 are as follows: the sequence of CACTGAATTCACCCCCACTG, reverse primer SEQ ID Nos:6
Are as follows: AAGCAGAATTTGGAATTCATCC.
5. the detection method according to claim 1 based on digital pcr platform POLE gene mutation, which is characterized in that institute
The reference gene label TaqMan probe stated in step (1) can be with specific hybrid reference gene B2M amplification region comprising one
Probe SEQ ID Nos:7, probe SEQ ID Nos:7 sequence are as follows: ATGGAGGTTTGAAGA.
6. the detection method according to claim 3 based on digital pcr platform POLE gene mutation, which is characterized in that
The fluorescein of the probe label of POLE genes of SEQ ID Nos:3 specific hybrid wild-type amplification product is VIC, POLE gene
The fluorescein of the probe label of SEQ ID Nos:4 specific hybrid saltant type amplified production is FAM.
7. the detection method according to claim 5 based on digital pcr platform POLE gene mutation, which is characterized in that interior
The fluorescein for joining gene B2M label TaqMan probe label is ROX.
8. the detection method according to claim 1 based on digital pcr platform POLE gene mutation, which is characterized in that institute
State the digital pcr amplification program of step (3) are as follows: 95 DEG C of thermal startings, 10 minutes；94 DEG C of denaturation, 30 seconds；60 DEG C of annealing, 60 seconds；Expand
Increase 40 circulations；98 DEG C of enzyme inactivations, 10 minutes；4 DEG C of heat preservations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811448553.8A CN109504772A (en) | 2018-11-29 | 2018-11-29 | A kind of detection method based on digital pcr platform POLE gene mutation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811448553.8A CN109504772A (en) | 2018-11-29 | 2018-11-29 | A kind of detection method based on digital pcr platform POLE gene mutation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109504772A true CN109504772A (en) | 2019-03-22 |
Family
ID=65751292
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811448553.8A Pending CN109504772A (en) | 2018-11-29 | 2018-11-29 | A kind of detection method based on digital pcr platform POLE gene mutation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109504772A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110144386A (en) * | 2019-04-12 | 2019-08-20 | 嘉兴雅康博医学检验所有限公司 | For detecting the primer, probe and kit of POLE gene mutation |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105274104A (en) * | 2015-12-01 | 2016-01-27 | 湖南宏雅基因技术有限公司 | Detection kit for predicting efficacy of anti-PD-L1 antibody medicine |
| CN107488728A (en) * | 2017-09-26 | 2017-12-19 | 臻和（北京）科技有限公司 | Primer combination of probe thing, kit and the method for 3D digital pcrs detection EGFR specific gene mutation |
| US20180135135A1 (en) * | 2016-11-15 | 2018-05-17 | Quest Diagnostics Investments Llc | Methods for detecting dna mutations using mitra tip extraction |
| CN108699608A (en) * | 2015-10-09 | 2018-10-23 | 基因前沿公司 | Method and kit for predicting and diagnosing human cytomegalovirus (hCMV) congenital transmission |
-
2018
- 2018-11-29 CN CN201811448553.8A patent/CN109504772A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108699608A (en) * | 2015-10-09 | 2018-10-23 | 基因前沿公司 | Method and kit for predicting and diagnosing human cytomegalovirus (hCMV) congenital transmission |
| CN105274104A (en) * | 2015-12-01 | 2016-01-27 | 湖南宏雅基因技术有限公司 | Detection kit for predicting efficacy of anti-PD-L1 antibody medicine |
| US20180135135A1 (en) * | 2016-11-15 | 2018-05-17 | Quest Diagnostics Investments Llc | Methods for detecting dna mutations using mitra tip extraction |
| CN107488728A (en) * | 2017-09-26 | 2017-12-19 | 臻和（北京）科技有限公司 | Primer combination of probe thing, kit and the method for 3D digital pcrs detection EGFR specific gene mutation |
Non-Patent Citations (5)
| Title |
|---|
| CAROLINE C BILLINGSLEY等: ""Polymerase ε (POLE) mutations in endometrial cancer clinical outcomes and implications for Lynch Syndrome testing"", 《CANCER》 * |
| GUY ROSNER, M.D.等: ""POLD1 and POLE Gene Mutations in Jewish Cohorts of Early-Onset Colorectal Cancer and of Multiple Colorectal Adenomas"", 《DISEASES OF THE COLON & RECTUM》 * |
| RINTARO YOSHIDA等: ""Concurrent genetic alterations in DNA polymerase proofreading and mismatch repair in human colorectal cancer"", 《EUROPEAN JOURNAL OF HUMAN GENETICS》 * |
| 陈超编著: "《新技术与精准医学》", 31 December 2017, 上海：上海交通大学出版社 * |
| 黄茜等: ""POLE突变在肿瘤发生发展中的作用"", 《临床与病理杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110144386A (en) * | 2019-04-12 | 2019-08-20 | 嘉兴雅康博医学检验所有限公司 | For detecting the primer, probe and kit of POLE gene mutation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104099425B (en) | A kind of test kit for detecting B-raf transgenation | |
| CN108504742A (en) | A kind of kit and method detecting HER-2 gene copy number variations based on digital pcr technology | |
| JP2005516603A (en) | Digital amplification for detection of mismatch repair deficient tumor cells | |
| CN108841953A (en) | The kit of 22 kinds of EGFR gene mutation is detected using digital pcr technology | |
| US20120053075A1 (en) | Probes, liquid chips and methods for detecting braf gene mutations | |
| CN105441573A (en) | Primer, probe and kit for detecting mutation of human JAK2 gene V617F | |
| CN110951843A (en) | Kit and method for detecting HER2 copy number variation of CTCs based on ddPCR | |
| CN113718021A (en) | Primer, probe and kit for quantitatively detecting BCR-ABL1 fusion gene | |
| CN109593847B (en) | Primer pair, kit and method for detecting stability of NR24 locus of microsatellite | |
| CN106480201A (en) | Metastasis in Breast Cancer assesses test kit | |
| CN114438214A (en) | Colorectal cancer tumor marker and detection method and device thereof | |
| CN110863053A (en) | Primer, probe and method for detecting EGFR vIII mutant | |
| CN109593832A (en) | A kind of detection method of ARMS-ddPCR point mutation | |
| CN111485023A (en) | Composition and kit for multiple detection of breast cancer typing based on RNA molecular marker | |
| CN107475253B (en) | Detection primer, amplification system and detection kit for microsatellite instability site-BAT 26 site | |
| CN107641649B (en) | Primer pair, kit and method for detecting stability of NR27 locus of microsatellite | |
| CN109504772A (en) | A kind of detection method based on digital pcr platform POLE gene mutation | |
| CN111500687A (en) | Breast cancer 21 gene detection kit | |
| CN108949926A (en) | A kind of detection method based on digital pcr platform EGFR gene Exon19 deletion mutation | |
| CN109439704B (en) | Method and kit for detecting leukemia related gene variation | |
| CN108929907A (en) | A kind of detection method based on digital pcr platform ARV7 gene mutation | |
| CN109439754A (en) | A kind of detection method based on digital pcr platform JAK2V617F gene mutation | |
| CN109136367A (en) | The method for improving the diagnosis efficiency of BRAF gene V600E mutation | |
| CN1884580B (en) | Fluorescent quantitative PCR reagent kit for detecting epidermal growth factor receptor gene point mutation | |
| CN108929908A (en) | A kind of detection method skipped based on digital pcr platform c-MET gene Exon14 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190322 |
|
| WD01 | Invention patent application deemed withdrawn after publication |