CN109453382A - EphrinA1 albumen is preparing the application in the drug for inhibiting tumor cell invasion, transfer - Google Patents

Abstract

The invention discloses application of the EphrinA1 in tumor development, transfer, treatment and survival of patients prognosis.The invention discloses growth, invasion and transfer processes that EphrinA1 participates in tumour, high expression of the EphrinA1 in stomach organization leads to Patients with Gastric Cancer prognosis mala, and expression that is low or knocking out EphrinA1 is struck in targeting can significantly inhibit the invasive ability and the intracorporal transfer ability of mouse of stomach cancer cell.The present invention can effectively inhibit the invasive ability of stomach cancer cell using the function of the antibody blocking EphrinA1 of targeting EphrinA1.Present invention discover that EphrinA1 has important application value in oncotherapy, the target spot of anti-tumor drug can be used as.

Description

EphrinA1 albumen is in preparing the drug for inhibiting tumor cell invasion, transfer Application

Technical field

The present invention relates to EphrinA1 albumen to prepare the application in the drug for inhibiting tumor cell invasion, transfer

Background technique

Newest global cancer statistical data carries out the morbidity and mortality of 36 kinds of cancers of global 185 countries within 2018 Estimation, report display, the newly-increased cases of cancer in the whole world in 2018 are up to 18,100,000 people, and death is up to 9,600,000 people, cancer The estimated first cause that will become 21 century death of disease.The highest 5 kinds of cancers of disease incidence are that lung cancer (accounts for cancer respectively in both sexes The 11.6% of total number of the infected), women with breast cancer (11.6%), colorectal cancer (10.2%), prostate cancer (7.1%) and gastric cancer (5.7%), the highest 5 kinds of cancers of the death rate are lung cancer (account for the total death toll of cancer 18.4%), colorectal cancer respectively (9.2%), gastric cancer (8.2%), liver cancer (8.2%) and breast cancer (6.6%).The result shows the cancers in the whole world to bear into one Step aggravates, while also illustrating the importance and urgency for finding the research of antitumor crucial target spot and its associated treatment means.

The occurrence and development of tumour are a sufficiently complex biological processes.Compared with normal cell, tumour cell has The characteristics such as cell death are resisted in infinite multiplication, abnormal energy metabolism, active oxygen radical raising, tissue infiltration and transfer.At present Most cancers lack the method and effective treatment means of early diagnosis, its prognosis of the patient especially shifted is worse.And Cancer metastasis is the biological process of an extremely complex multi-step, mainly includes that cancer cell is detached from from primary tumor, breaks through Basilar memebrane simultaneously enters blood circulation or Lymphatic Circulation, is pierced by blood vessel or lymphatic vessel, field planting is formed micro- in specific organization or organ Small transfer stove, final proliferation form macroscopic transfer stove.However, up to now, related cancer occurrence and development and transfer Molecular mechanism is still indefinite, finds and inhibits the crucial target spot of tumor development and transfer most important.

Ephrins (Eph family receptor interacting proteins) family is heretofore known maximum Receptor tyrosine kinase subfamily (RTKs) Eph ligand.Ephrin ligand is divided into two kinds of hypotypes according to structure difference: Totally 5 kinds of EphrinA hypotype, be the memebrane protein being fixed on after birth by glycosyl phosphinositides (GPI)；EphrinB hypotype category In transmembrane protein, there are the combined area Eph and short cytoplasmic domain.According to homology difference, Eph receptor is divided into two Asias EphA and EphB Race.Ephrin family and its receptor Eph play important regulating and controlling effect during Embryonic Development in Animal and tissue homeostasis etc., The occurrence and development of dysfunction and central nervous system disease and cancer are closely related.

EphrinA1 (EFNA1) be in this family first by specific ligand, nineteen ninety is as a kind of bad by tumour The gene of necrosis factor (TNF α) induction, clones from Human umbilical vein endothelial cells (HUVECs) and, which contaminates at No. 1 The position colour solid q21-q22, molecular weight are about 22KD.The most important receptor of EphrinA1 is EphA2, durings angiogenesis etc. Play the part of indispensable role, abnormal expression promote tumour occur (melanoma, liver cancer, squamous cell carcinoma, colon cancer and Gastric cancer etc.), angiogenesis and cancer metastasis etc. play an important role.

EphrinA1 abnormal expression in Several Kinds of Malignancy, many carcinogenic signal paths are all by the shadow of EphrinA1 It rings, such as MAP/ERK and PI3K signal path.Some evidences show the complexity and cell type due to EphrinA1 itself Dependence, play the role of promoting in some type of cell or cancer it is tumorigenic, but in the cell of other types or It may play the role of inhibiting tumor progression in cancer.Research shows that in breast cancer and glioma, EphrinA1 expression by Inhibit.EphrinA1 is related with ras/MAPK access in breast cancer, and main mechanism is that the low expression of EphrinA1 makes EphA2 Phosphorylation reduce the activation so as to cause downstream ras signal, and the activation of ras signal can further increase the table of EphA2 It reaches, inhibits the expression of EphrinA1, form a feedback control loop in this way, promote the process of tumour.In melanoma, bladder cancer, Liver cancer, in the cancers such as oophoroma, EphrinA1 and EphA2 expression are increased, research shows that in oophoroma EphrinA1 high table Up to the prognosis that will lead to patient's difference；EphrinA1 can promote the proliferation of tumour cell by regulation alpha-fetoprotein in liver cancer.

EphrinA1 is studied in gastric cancer at present seldom, evidence suggests EphrinA1 to express up-regulation in gastric cancer, But its specific mechanism of action is unclear, not yet has report at present as the research of curing gastric cancer potential about EphrinA1 Road.

Gastric cancer is one of an important factor for leading to cancer mortality as one of most common malignant tumour in the whole world.In the whole world In range, gastric cancer is the malignant tumour of the 5th high incidence and third high mortality, and China is the most high-incidence country of gastric cancer One.In China, the age-standardized incidence and the China death rate Jun Ju malignant tumour age-standardized incidence and the death rate of gastric cancer Second, seriously endangered the health of the mankind.But since gastric cancer onset is hidden, and lack effective hand of early diagnosis Section, most of patients is all in middle and advanced stage when discovery, thus poor prognosis, and the patient of far-end transfer especially occurs, survives within 5 years One of the main reason for rate only has 5% or so, is late gastric cancer death.Therefore, we there is an urgent need to understand gastric cancer in depth The pathogenesis of occurrence and development and transfer finds the key factor of regulation stomach cancer cell development and transfer process.EphrinA1 exists It plays an important role in kinds of tumors, the prognostic factor and therapeutic target for prompting EphrinA1 that may be in progress and shift as gastric cancer Point.

Summary of the invention

In view of the deficiencies of the prior art, it is an object of the present invention to provide EphrinA1 albumen in preparation for inhibiting tumour thin Application in born of the same parents' invasion, the drug shifted.

The present invention adopts the following technical scheme: EphrinA1 albumen is in preparation for inhibiting tumor cell invasion and/or turning Application in the drug of shifting.The drug targeting EphrinA1 albumen inhibits, strikes expression that is low or knocking out EphrinA1.

Further, the drug includes at least one of following effective component: the Nano medication of EphrinA1 is targeted, The CRISPR gene editing plasmid for targeting EphrinA1, targets the siRNA of EphrinA1, targets the shRNA of EphrinA1, targets The LNA of EphrinA1 targets the ASO of the chemical modification of EphrinA1, blocks the micromolecular inhibitor of EphrinA1 function, The polyclonal antibody of EphrinA1, the monoclonal antibody of EphrinA1, the humanized antibody of EphrinA1, the nanometer of EphrinA1 Antibody, bispecific antibody target the antibody drug of EphrinA1.

Further, monoclonal antibody includes rabbit source, source of mouse, dog source, monkey source, hunchbacked source, Ji Yuan, shark source etc., Anti-TNF-α Body includes Ji Yuan, rabbit source, Yang Yuan, hunchbacked source etc..

Further, low, knockout EphrinA1 albumen: siRNA, shRNA, gene editing is struck by the following means；Wherein Gene editing technology includes DNA homologous recombination, TALEN-TALEA targeted gene disruption technology, Cre/Loxp system, FLP-frt System, the inductivities Cre/Loxp system such as tetracycline/interferon, CRISPR/Cas9 gene editing technology.

Further, tumour includes nasal cavity and nasal sinus malignant tumour, nasopharyngeal carcinoma, carcinoma of mouth, laryngocarcinoma, salivary tumor transformation, encephalic Tumour, thyroid cancer, tongue cancer, lung cancer, the cancer of the esophagus, cardia cancer, breast cancer, mediastinum tumor, gastric cancer, colorectal cancer, the carcinoma of the rectum, liver Cancer, cancer of pancreas and peri-ampullar carcinoma, intestinal malignant tumor, kidney, prostate cancer, bladder cancer, cervix cancer, oophoroma, skin Malignant mela noma, lymthoma etc..

The beneficial effects of the present invention are: find that EphrinA1 is in gastric cancer by a series of internal, external functional experiments It plays an important role in occurrence and development and transfer.Poor prognosis and transfer of the high expression of EphrinA1 with patient in gastric cancer Significant correlation prompts EphrinA1 to have the potential as patients with gastric cancer survival region index.And by inhibiting EphrinA1 to exist Expression in cancer cell can significantly inhibit the invasive ability and intracorporal transfer ability of stomach cancer cell.Pass through antibody blocking Functional experiment shows that the antibody of EphrinA1 can effectively inhibit the invasive ability of stomach cancer cell.The invention shows EphrinA1 can be used as a new drug targets for clinically inhibiting metastases.

Detailed description of the invention

Fig. 1 is EphrinA1 structural schematic diagram；

Fig. 2 .1 is EphrinA1 significantly high expression figure in stomach organization；

Fig. 2 .2 is expression of the EphrinA1 in different gastric carcinoma cell lines；

Fig. 2 .3 is that the expression of EphrinA1 protein level height is significant related to Metastasis of Gastric Cancer；

Fig. 2 .4 is that the expression of EphrinA1 albumen height is significant related to the poor prognosis of Patients with Gastric Cancer；

Fig. 3 .1 strikes poor efficiency for Western blot detection EphrinA1's；

Fig. 3 .2 is the influence that MTT and adhesion experiment detect EphrinA1 cell proliferation and adherency；N.s., nonsensical；

Fig. 3 .3 is to strike low EphrinA1 to the migration of stomach cancer cell and the influence of invasive ability；* *, P < 0.001；

Fig. 4 .1 is that the stabilization of Western blot detection EphrinA1 strikes poor efficiency；

Fig. 4 .2 is that stabilization strikes influence of the low EphrinA1 to the invasive ability of stomach cancer cell；；*, P < 0.01；*, P < 0.05；

Fig. 5 .1 is the overexpression effect that Western blot detects EphrinA1；

Fig. 5 .2 is the influence of overexpression EphrinA1 cell proliferation and adhesive capacity；

Fig. 5 .3 is overexpression EphrinA1 to the cell migration of stomach cancer cell and the influence of invasive ability, * * *, P < 0.001；*, P < 0.01；

Fig. 6 .1 is to construct the cell strain that EphrinA1 is knocked out using CRISPR/Cas9 gene editing；

Fig. 6 .2 is influence of the EphrinA1 knockout to the cell Proliferation and adhesive capacity of stomach cancer cell；

Fig. 6 .3 is that EphrinA1 is knocked out to the migration of stomach cancer cell and the influence of invasive ability；* *, P < 0.001；

Fig. 6 .4 is influence of the EphrinA1 knockout to the Lung metastases ability of stomach cancer cell；* *, P < 0.001 (n=5)；

Fig. 6 .5 is that the lung HE dyeing detection EphrinA1 of mouse knocks out the shadow to stomach cancer cell Lung metastases ability It rings；* *, P < 0.001 (n=5)；

Fig. 6 .6 is influence of the stomach cancer cell of EphrinA1 knockout to mouse weight；

Fig. 6 .7 is influence of the EphrinA1 knockout to stomach cancer cell one-tenth knurl ability in Mice Body；

Fig. 7 .1 is identification of the Western blot experiment detection monoclonal antibody to EphrinA1 albumen；

The influence after EphrinA1 antibody to cell cross endothelial migration ability is added for stomach cancer cell by Fig. 7 .2.

Fig. 8 .1 is expression of the EphrinA1 in various cancers in GEPIA database；

Fig. 8 .2 is the correlation of the EphrinA1 expression in various cancers and prognosis in GEPIA database.

Specific embodiment

According to the sequence information of the EphrinA1 recorded in ncbi database, it can determine that EphrinA1 is one and is located in No. 1 chromosome, the gene of long 1590bp, 205aa.As shown in Figure 1.

The application strikes low EphrinA1 by targeting, finds the cell Proliferation to stomach cancer cell, cell cycle, Clone formation It is had not significant impact with cell adherence, but the vitro invasion that can significantly inhibit stomach cancer cell and transfer in vivo.It utilizes CRISPR/Cas9 technology targets EphrinA1 gene, and after display EphrinA1 is lacked, the invasion of cell and transfer ability are by aobvious The inhibition of work.With the function of antibody blocking EphrinA1, the invasive ability of stomach cancer cell can be significantly inhibited.Below with reference to embodiment The present invention is further described.

Embodiment 1, EphrinA1 significantly high expression in the stomach organization and gastric carcinoma cell lines of people

1. the expression of EphrinA1 in the Various Tissues and human gastric cancer cell line of people

1.1 groups are woven under extremely low temperature the separation and Extraction using mortar grinder at the total serum IgE of powdered, powdered tissue Using TRIZOL reagent (being purchased from U.S. Invitrogen), and carried out according to the standard operation of reagent specification.

1.2 take a PCR pipe A that the total RNA of 800ng is added, and supply DEPC water to 10 μ L of total volume, mix.Take another 2 μ L, 10x random primer of 10xRT buffer, 2 0.8 μ L, RNA reverse transcriptase of μ L, dNTP, 1 μ L is added in PCR pipe B, 4.2 μ L of DEPC water is mixed.The mixture of B pipe is added in pipe A, is mixed, reverse transcription reaction is carried out using PCR instrument and (is purchased from the U.S. ABI).Program is as follows:

25℃	10min
		37℃	120min
85℃	5min

It is spare by -20 DEG C of cDNA product placement.

2. real-time fluorescence quantitative PCR (qRT-PCR) detects EphrinA1 in stomach organization and its normal tissue of pairing Expression

Quantitative fluorescent PCR reaction is carried out using Bio Rad company CFX-Touch System fluorescence quantitative PCR instrument.It is all Reaction all in triplicate.Δ Ct value is obtained according to the fluorogram that instrument provides, to calculate the opposite change of corresponding expression Change.

Primer is as follows:

3. the expression of organization chip detection EphrinA1 protein level

EphrinA1 is detected in the expression of protein level by stomach organization chip, and as a result the albumen of EphrinA1 exists High expression in Patients with Gastric Cancer, the analysis of Kaplan-Meier survivorship curve have raw stored patients with gastric cancer queue in 5 years, as a result The relatively high expression of EphrinA1 is significant related to the poor prognosis of Patients with Gastric Cancer.

Experimental result

It is carried out by the normal tissue that 109 pairs of stomach organizations are matched in real-time fluorescence quantitative PCR reaction (qRT-PCR) with it The analysis of EphrinA1 expression, EphrinA1 opposite up-regulated expression in 72.5% gastric cancer tumor tissue (Fig. 2 .1 is left).This Outside, in M0 the and M1 phase patient's sample that 11 pairs of ages, gender are matched, EphrinA1 is significantly high in the M1 sample with transfer Expression (Fig. 2 .1 is right).In addition, also having detected the expression of EphrinA1 in people's difference gastric carcinoma cell lines by qRT-PCR, it is Follow-up function experiment, which provides, refers to (Fig. 2 .2).The prompt of these results, EphrinA1 may play weight in the transfer process of gastric cancer The effect wanted.EphrinA1 is detected in the expression of protein level by stomach organization chip, as a result the albumen of EphrinA1 The high expression (Fig. 2 .3) in Patients with Gastric Cancer, the analysis of Kaplan-Meier survivorship curve have 5 years raw stored patients with gastric cancer teams Column, as a result the relatively high expression of EphrinA1 is significant related (Fig. 2 .4) to the poor prognosis of Patients with Gastric Cancer.

Embodiment 2, the expression that RNA perturbation technique strikes low EphrinA1 can significantly inhibit the invasion of stomach cancer cell

1. cell transfecting siRNA

By siRNA design software, two special target EphrinA1, the siRNA (purchase of its expression of silencing are designed and synthesized From Chinese Shanghai Ji Ma).The cell of logarithmic growth phase paves plate, reaches 50% or so to cell density, transfects according to following table System, respectively with OPTI culture medium (be purchased from U.S. Gibco) dilution Lipo RNAi MAX (being purchased from U.S. Invitrogen) and Diluted siRNA is added in Lipo RNAi MAX pipe, 5min is stood after mixing, is then added in cell culture fluid by siRNA, It shakes up, culture medium is replaced after 24.

Component	24-well	6-well
			SiRNA-lipid complex per well	50ul	250ul
Final siRNA used per well	5pmol	25pmol
			Final Lipo RNAi MAX used per well	1.5ul	7.5ul

2. cell Proliferation (MTT) is tested

Cell after transfection carries out weight with 1640 culture mediums (being purchased from U.S. Gibco) of 10%FBS (being purchased from Israel BI) It is outstanding, it is counted with blood counting chamber.For MTT experiment, 1000 cells (100ul culture medium) are added in every hole in 96 orifice plates, often Five multiple holes of group need to spread 4 blocks of plates for detecting the proliferative conditions (0h, for 24 hours, 48h, 72h) of cell in different time points altogether.Every A time point, every hole add 5mg/ml MTT (purchased from U.S. Sigma) to be incubated for 4h in 37 DEG C of incubators, are carefully drawn in hole with pipette tips Solution (is careful not to encounter the bottom in hole), and 150ul DMSO (purchased from Chinese traditional Chinese medicines) are added, mix.It is detected in M5 microplate reader The absorption light value of the OD490/OD570 at each time point is simultaneously analyzed.

3. cell adhesion experiments

3.1 take 96-well plate to be pre-processed.Matrigel (being purchased from U.S. BD) coated cell plates, with the nothing of pre-cooling 1640 (being purchased from U.S. Gibco) of FBS carry out the dilution of 1:40 to matrigel, and every hole is added 50 μ L and is coated with； Fibronectin (being purchased from U.S. BD) coated cell plates, with the 1640 dilution fibronectin to 0.02 μ without FBS of pre-cooling G/ μ L, every hole are added 50 μ L and are coated with.The coated 96-well plate of matrigel and fibronectin is put into 37 DEG C of cells It is incubated for for 24 hours in incubator.

3.2 suck not solidified matrigel and fibronectin, and 100 μ L, 0.5%BSA are added (purchased from China in every hole Give birth to work in Shanghai) (PBS is molten), 37 DEG C of closing 30min.

3.3 discard BSA, and PBS is mildly washed twice, and 100 μ L, 2x10 are added in every hole⁴1%FBS 1640 culture mediums be resuspended Cell, 37 DEG C of incubator culture 30min.

3.4 discard supernatant, and PBS is mildly washed twice, and every hole adds the 100 fixed 30min of μ L, 4%PFA, discard PFA (Chinese state Medicine), PBS is mildly washed twice.

3.5 every holes add 100 μ L methylene blue staining 30min, discard methylene blue staining liquid, are mildly washed 4-5 times with PBS.

3.6 prepare lysate (dehydrated alcohol is mixed with 0.1M HCl volume ratio 1:1), and 150 μ L lysates are added in every hole, mix It is even.And 150 μ L lysates are added in cell-free hole as blank control.

3.7 detect the absorption light value of OD620 and are analyzed in M5 microplate reader.

4. cell migration and Matrigel

4.1 Cell migration assays: (the 1640 of 1%FBS are resuspended in the way of cell passage in the cell after transfection Cell is resuspended in culture medium) and cell count is carried out with blood counting chamber.It is added in every hole in the upper layer cell of transwell 200ul cell suspension (cell number: 5 × 10⁴), 1640 culture mediums of the 10%FBS of 700ul are added in lower room, are put into training It supports in case.After cell migration appropriate time, takes out transwell and fix 10min with 4%PFA.0.1% crystal violet dye Color 15min.PBS washes extra crystal violet, with the cell for wiping the cell transwell upper layer film that cotton swab is careful, is showing Micro- microscopic observation invasion are to the cell in transwell lower membrane and are taken pictures and statisticallyd analyze.

The experiment of 4.2 cell invasions: 10 are spread in advance in 8 μm of Transwell (24-well is purchased from U.S. Corning) Again diluted matrigel (being purchased from U.S. BD) or 0.5% gelatin (purchased from the raw work of Chinese Shanghai) 50ul, 37 DEG C of cell incubators It is incubated for 2h.Then after the cell after transfection being resuspended, subsequent operating procedure is identical as migration experiment.

Experimental result

The result of front prompts, EphrinA1 significantly high expression in stomach organization, and the prognosis of its height expression and difference It is related.Does so, how EphrinA1 especially play a role in the transfer process of gastric cancer in the process of gastric cancer? therefore We devise two special target EphrinA1, the siRNA of silencing EphrinA1 expression.In gastric carcinoma cell lines BGC823 transfer Dye siRNA strikes the expression of low EphrinA1, and strikes poor efficiency by what Western blot detected EphrinA1, as the result is shown with The siRNA of control group compares, and the siRNA of selectively targeted EphrinA1 lowers the horizontal to the 30% of control group of EphrinA1 Left and right (Fig. 3 .1, si-nc indicate that control siRNA, si-1 and si-2 indicate the siRNA of two targeting EphrinA1).

Influence of the low EphrinA1 to gastric carcinoma cell lines is struck in detection on gastric carcinoma cell lines BGC823.Due to tumour cell Two important features are being capable of infinite multiplication and easy transfer.We detect EphrinA1 pairs by MTT experiment and adhesion experiment The influence of the ability of cell proliferation of stomach cancer cell and the adhesive capacity to matrix, the results show that striking for EphrinA1 is low to gastric cancer The cell Proliferation and matrix attachment ability of cell have not significant impact (Fig. 3 .2).It is detected by cell migration and Matrigel EphrinA1 is to the influence in terms of metastases.As a result the enough significant cells for inhibiting stomach cancer cell of low energy that strike of EphrinA1 move It moves and invasive ability (Fig. 3 .3).As a result it prompts, EphrinA1 may influence gastric cancer by influencing the invasive ability of stomach cancer cell Occur and develops.

Embodiment 3, stabilization, which strikes low EphrinA1, can significantly inhibit the invasive ability of stomach cancer cell

1. slow virus carrier constructs

1.1 design synthesis shEphrinA1

According to shRNA design principle, using EphrinA1RNA as target sequence, two target position for being directed to EphrinA1 are devised Point sequence synthesizes corresponding forward and reverse sequence (purchased from the raw work of Chinese Shanghai), is respectively as follows:

1.2 annealing:

100pM single stranded DNA is respectively taken, 10x annealing buffer is added, adds ddH2O 50uL.It is put into the water just boiled, It is set to be slowly cooled to room temperature.

By digestion, link, identification, sequencing and etc. building EphrinA1 shRNA Lentiviral.

2. slow virus is packed

2.1 spread HEK293T cell in T25 bottles, when cell density reaches 80-90%, are transfected.

2.2 prepare plasmid mixing according to following system

Ingredient	Volume (ul)
		Slow virus carrier plasmid (1 μ g/ μ L)	2.2
Packaging plasmid pVSVG (1 μ g/ μ L)	1.1
		Packaging plasmid △ 8.91 (1 μ g/ μ L)	1.65
P3000	10
		OPTI	250

2.3 take 15 μ L Lippo3000 to be mixed into 250ul OPTI, and (specific transfection method is detailed in lipo3000 plasmid transfection Step).

2.4 collect 48h, and the cell of 72h trains liquid, and after filtering packing, concentration is surveyed titre, saved in -80 DEG C of refrigerators.

3. screening EphrinA1 strikes low stable cell lines

The cell of logarithmic growth phase paves plate, reaches 80% or so to cell density, discards culture medium, PBS cleaning two Time, 1640 culture mediums of fresh 10%FBS are added.Suitable virus stock solution used is added dropwise in culture dish, and 5ug/ is added The Polybrene of mL promotes the efficiency of infection of virus, mixes, and 37 DEG C are changed liquid after incubator culture 24 hours.Slow virus carrier band There is puromycin resistance label, by applying puromycin drug, the cell of screening slow virus expression to cell.Infect 48h Afterwards, suitable puromycin drug is added, for about two weeks.Do not apply drug culture for a period of time, collect appropriate cell, QRT-PCR detection EphrinA1's strikes inefficient fruit, if EphrinA1 strikes low group compared with the slow virus carrier of control group EphrinA1 expression is significantly lowered, and display screening obtains EphrinA1 and strikes low stable cell lines.

Experimental result

EphrinA1 can significantly promote the invasive ability of stomach cancer cell.The Notes of Key Data of front, EphrinA1 may be It plays an important role in the transfer of gastric cancer.We construct EphrinA1 and strike low stable cell lines, and Western blot is real It tests and shows that cell line constructs successfully (two targeting EphrinA1 of Fig. 4 .1, sh-nc expression control shRNA, sh-1 and sh-2 expression ShRNA).EphrinA1 stabilization strikes the vitro invasion ability (Fig. 4 .2) that low energy significantly inhibits stomach cancer cell, this with It is consistent that the clinical expression level of EphrinA1, prognosis situation and siRNA strike low experimental result.

Embodiment 4, overexpression EphrinA1 can significantly promote the invasive ability of stomach cancer cell

1. constructing the plasmid of pcDNA3.1-EphrinA1

The full length sequence that EphrinA1 is obtained according to ncbi database, designs the primer of overall length, is obtained by the method for PCR The DNA product of EphrinA1, by digestion, link and etc. pcDNA3.1 of the building containing EphrinA1 overall length be overexpressed matter Grain.

2. cell transfecting plasmid

The cell of logarithmic growth phase paves plate, reaches 80% or so to cell density, according to following table rotaring redyeing system, respectively With OPTI culture medium dilution Lipo3000 (being purchased from U.S. Invitrogen) and plasmid, Lipo3000 pipe is added in diluted plasmid In, 5min is stood after mixing, is then added in cell culture fluid, is shaken up, and culture medium is replaced after 24.

Component	24-well	6-well
			Plasmid-lipid complex per well	50ul	250ul
Final plasmid used per well	500ng	2500ng
			Final P3000 used per well	1ul	5ul
Final Lipo3000 used per well	1.5ul	7.5ul

Experimental result

The expression that low EphrinA1 is struck in the BGC823 cell of EphrinA1 content relative abundance can significantly inhibit The invasive ability of stomach cancer cell.Does so, overexpression EphrinA1 have influence how to stomach cancer cell again? we pick One plant of EphrinA1 expresses relatively small number of cell AGS, detection overexpression EphrinA1 in human gastric cancer cell line ags cell Influence to the biological function of stomach cancer cell.Western blot detects the overexpression efficiency of EphrinA1, and as compareing Empty plasmid compare, the effect of EphrinA1 overexpression be its expression 5-10 times (Fig. 5 .1).Result of study shows, Overexpression EphrinA1 in ags cell, cell Proliferation and cell adherence (Fig. 5 .2) to stomach cancer cell have not significant impact, But it can significantly promote migration and the invasive ability (Fig. 5 .3) of stomach cancer cell.These data and EphrinA1siRNA strike low Data result is consistent, the invasion of display EphrinA1 regulation stomach cancer cell.

Embodiment 5, stomach cancer cell can significantly be inhibited by knocking out EphrinA1 using CRISPR/Cas9 gene editing technology Invasion and internal transfer ability

1. targeting the CRISPR/Cas9 gene editing of EphrinA1

CRISPR/Cas9 gene editing technology targeting proteins encoding gene can pass through several bases of change encoding gene Cause the effects such as frameshift mutation, knocks out the expression of the albumen of coding.

The sgRNA of two selectively targeted EphrinA1 is designed and synthesized, CRISPR/Cas9-EphrinA1sgRNA is constructed Carrier.Sequence is as follows:

EphrinA1sgRNA 1

EphrinA1-1-sense:5 '-ACCGCTGATCGCCACACCGTCTTC-3 '

EphrinA1-1-antisense:5 '-AACGAAGACGGTGTGGCGATCAGC-3 '

EphrinA1sgRNA 2

EphrinA1-2-sense:5 '-ACCGACGGTGTGGCGATCAGCAG-3 '

EphrinA1-2-antisense:5 '-AACCTGCTGATCGCCACACCGTC-3 '

According to the method for plasmid transfection, the CRISPR/Cas9 carrier of EphrinA1sgRNA is transfected human gastric cancer cell line, It is screened by monoclonal, and identifies knockout using the verifying of the methods of Genomic PCR and sequencing, the PCR of cDNA and sequencing The cell strain of EphrinA1.It on the other hand, is the undershooting-effect for avoiding CRISPR/Cas9 from generating, we are in addition to implementation sequence spy Different sgRNA, while the potential site of missing the target predicted according to sgRNA, carry out PCR and sequence verification, and guarantee is not missed the target.

2. shift experiment in mouse lung body

By 1X10⁶Wild type stomach cancer cell and the stomach cancer cell of EphrinA1 gene knockout that filters out, it is quiet by tail Arteries and veins is injected into the internal of mouse, observes the state and changes of weight of mouse weekly, after 4-5 weeks, takes the lung of lung observation tumour cell Transfer case.

3. the subcutaneous tumor formation experiment of mouse

By 5X10⁶Wild type stomach cancer cell and the stomach cancer cell of EphrinA1 gene knockout that filters out, with After matrigel is by 1:1 mixing, the subcutaneous of mouse is squeezed into, the growing state of tumour is observed, after 10-15 days, subcutaneous tumor mass is taken Out, it weighs, the variation between observation group.

Experimental result

In order to further explore the biological function that EphrinA1 is played in gastric cancer, we utilize CRISPR/Cas9 base It because editing technique designs the special sgRNA of two targeting EphrinA1, is screened by monoclonal, sequencing identification and effect of missing the target Should identify, be successfully established knock out EphrinA1 knock out stomach cancer cell line (Fig. 6 .1, WT represent the stomach cancer cell line of wild type, Ko1 and ko2 is the cell strain that the two plants of EphrinA1 screened are knocked out).Detect the thin of the stomach cancer cell line that EphrinA1 is knocked out The discovery of born of the same parents' biological function, compared with normal wild type stomach cancer cell, EphrinA1 knock out to the proliferation of stomach cancer cell and Cell adherence (Fig. 6 .2) has not significant impact.But the migration of the stomach cancer cell line of EphrinA1 knockout and invasive ability are obvious It is suppressed (Fig. 6 .3).It is low caused that these data show that the cell biological function that EphrinA1 is knocked out and EphrinA1 strike The variation of cell biological function is that height is consistent.Meanwhile also illustrating the cell strain that our benefit CRISPR/Cas9 technologies are established It is the cell strain of successful knockout EphrinA1.

We establish the stomach cancer cell line that the EphrinA1 of building is knocked out by tail vein injection the Lung metastases mould of mouse Type, the influence that research EphrinA1 shifts stomach cancer cell.After mouse inoculation stomach cancer cell 4 weeks, the Lung metastases feelings of mouse are assessed Condition.Lung observation display is taken by solution, the stomach cancer cell of control group wild type develops serious Lung metastases, and the volume of lung significantly increases Greatly, the weight of lung also obviously increases weight, and a large amount of tumour cell is contained in lung, forms substantive tumor mass, is barely perceivable complete Alveolar structure, and EphrinA1 knock out mouse lung transfer stove substantially reduce, volume size is more normal, also not bright in lung It is aobvious to increase, there is relatively complete lung mechanics (Fig. 6 .4).Further lung HE dyeing is also shown, and the lung of control group produces It is raw to be permitted great transfer stove, but the lung of EphrinA1 knockout group only observes fraction of micrometastasis stove (Fig. 6 .5).Meanwhile We observe weekly the growth conditions of mouse, and measure the weight of mouse, show compared with the mouse of EphrinA1 knockout group, right According to group mouse due to generating serious Lung metastases, and then endanger the health status of mouse, make mouse in the post-weight of transfer It is decreased obviously (Fig. 6 .6).The stomach cancer cell that studies have shown that EphrinA1 is knocked out can significantly reduce the Lung metastases ability of gastric cancer.

After we are mixed stomach cancer cell by 1:1 with matrigel, the subcutaneous of mouse is squeezed into, the animal of tumor formation in construct Model.The growing state that tumour is observed after 10-15 days, the results show that the stomach cancer cell of control group wild type grows up to very big tumor Block, and the stomach cancer cell tumor size of EphrinA1 gene knockout is obviously reduced, or even is unable to tumor formation (Fig. 6 .7).This result Although illustrating the growth for having no effect on stomach cancer cell in vitro, EphrinA1 under the action of complicated tumor microenvironment in vivo Knockout can significantly inhibit the growth ability of stomach cancer cell in vivo.

Embodiment 6 inhibits Metastasis of Gastric Cancer using the function of EphrinA1 antibody blocking EphrinA1 in turn

1.EphrinA1 antigen presentation plasmid construction

According to the EphrinA1 gene order in ncbi database, designs overall length primer and expanded by PCR means EphrinA1 full length gene is connected by digestion, conversion, plasmid extraction and etc., EphrinA1 full length sequence is building up to In pET-28a carrier, the total length expressed plasmid of pET-28a-EphrinA1 is obtained.Primer is as follows:

Primer-F:GTCAAAGCTTGCGAGTTCCTCTGGGCCCCTCTCTT

Primer-R:GTCACTCGAGTCACGGGGTTTGCAGCAGCAGAA

2. protein expression and purification

2.1 conversion plasmids: 0.5 μ L of recombinant plasmid is taken, is transformed into 100 μ L ROSETTA competence, coated plate culture 12- 16h。

2.2 a small amount of inductions: two single colonies of picking are inoculated in 5mL LB liquid medium, 37 DEG C of shake cultures respectively Overnight.Inducer is not added in control group, and IPTG to final concentration 1mmol/l is added in experimental group, and 37 DEG C are continued to cultivate 4h.12 000rpm It is centrifuged 10min, abandons supernatant, after thallus is cracked with lysate, 20-30 μ l 5 × Loading Buffer boiling water is added and boils 10min takes 10ul sample to analyze for SDS-PAGE.

2.3 a large amount of inductions: inoculation 3ml bacterium solution is into LB culture medium of the 300ml containing corresponding antibiotic, and abductive approach is the same as 2.2.

2.4 carrying out ultrasonic bacteria breaking: 5000rpm is centrifuged the thallus in the 300ml bacterium solution after 10min collects inducing expression respectively, bacterium Body is resuspended with 0.01M PBS (pH 7.4) solution of 10ml；100W ultrasound 16min under ice-water bath；4 DEG C, 5000rpm centrifugation 10min collect respectively precipitating and supernatant, supernatant keep sample 20ul carry out SDS-PAGE electrophoresis detection；With the 8M urine without imidazoles of 10ml Dispersion precipitating is resuspended in plain solution；100W ultrasound 10min under ice-water bath, the 20ul that keeps sample carry out electrophoresis detection；4 DEG C, 5000rpm centrifugation 15min collects supernatant.

The selection of 2.5 samples: albumen is carried out the purifying of His label protein in inclusion body by protein expression after testing.

The dialysis of 2.6 albumen and concentration are quantitative: the purity and concentration of albumen are improved by dialysis, finally by the albumen after concentration Sample takes out, and carries out electrophoresis detection and determination of protein concentration.

3. prepared by polyclonal antibody

3.1 animal immune: taking two New Zealand White Rabbit, antigen injection is previously required to collect some normal serums, standby inspection As negative control when surveying antibody.With normal saline dilution immunogene, 1:1 mixing then is carried out with corresponding adjuvant.Antigen and Adjuvant is thoroughly mixed to form stable emulsion, which is carried out subcutaneous injection and rear thigh using multi-point injection method on rabbit Carry out intramuscular injection.Each region with about 1/4 immunogene.Immunogene can persistently exist to improve immune answer in this way It answers.

3.2 take blood: being immunized after a week, blood examination can be taken to survey antibody titer with arteria auricularis.Originally the antibody generated is immunized several times Potency it is relatively low, three times be immunized after, the antibody of more efficient valence can be obtained.Last time takes blood that can put using arteria carotis Blood, a general rabbit can bloodletting 100-120ml.

The separation of 3.3 serum: if collected with centrifuge tube, 37 DEG C of baking ovens place 2h, are transferred to 4 DEG C of precipitates overnights, and second Centrifugation in its morning, 10000rcf, 10 minutes.NaN3 is added in serum to final concentration 0.02%, is saved for -20 DEG C after packing.

3.4 by antigen affinity purification mode antibody purification and detect antibody titer.

4. prepared by monoclonal antibody

4.1 animal immunes: immune altogether with 5 Balb/c mouse of target protein EphrinA1 protein immunization according to conventional scheme 3-4 times, after being immunized 7 days every time, immune serum is detected with indirect ELISA method, the level of immune response is determined with this.

4.2 cell fusions and screening: taking mouse spleen, and splenocyte and myeloma cell are carried out 2 using electro' asion method Wheel cells fusion.With the supernatant of indirect ELISA method screening fused cell, picks out and be positive to target protein Ephrin-A1 Supernatant.Positive female clone cell is gone into 24 orifice plates and expands culture.Each clone collection 2ml supernatant for expanding culture, is used for Indirect ELISA detection and FACS detection.All specific positive clone cells are frozen, are lost to avoid clone.

4.3 subclones, expand culture and cryo-conservation: positive female clone are subcloned using limiting dilution assay, with Ensure that these positive female clones are respectively from single female clone cell.3 wheel subclones are carried out, the success rate being generally subcloned exists 80%.Subclone screening is carried out with indirect ELISA method.It is each mother Immune Clone Selection 2 it is stable son clone carry out amplification and it is low Temperature saves.

4.4 antibody producings: antibody producing is carried out to monoclonal cell, every plant of cell obtains 1~5mg amount of antibody.Using anti- Antibody purification is stored in phosphate buffer (PBS) by former affinity purification method antibody purification with dialysis process.

5.EphrinA1 antibody function blocking experiment

Using the EphrinA1 antibody prepared, be applied in the gastric carcinoma cell lines normally cultivated, make antibody with EphrinA1 antigen binding prevents the EphrinA1 of cell membrane surface from functioning, and detects the shadow to cell invasion transfer ability It rings.

Experimental result

We are prepared for the polyclonal and monoclonal antibody of EphrinA1 by Antibody preparation means, are detected by ELISA Confirm that the potency of polyclonal antibody is higher (table 1), monoclonal antibody serum titer after mouse immune detects (table 2), hybridoma Cell prepares the antibody titer detection (table 5) of titer of ascites detection (table 3), purifying, as a result qualified.By ascites and It is IgG1 that cell conditioned medium, which detects monoclonal antibody hypotype, and light chain is k chain (table 4).Western blot experiment also confirms that antibody can identify EphrinA1 albumen (Fig. 7 .1).The EphrinA1 antibody that will be prepared, is applied in stomach cancer cell, can inhibit stomach cancer cell (Fig. 7 .2,1A7 and 2D7 respectively indicate two plants of hybridoma names screened for invasive ability and across endothelial cell migration ability Claim, and prepare the ascites generated by this two plants of cells and finally purify obtained Antibody Designation).As a result illustrate EphrinA1 antibody EphrinA1 albumen can be effectively identified and be combined, blocks the function of EphrinA1, and then inhibit the invasion and transfer of stomach cancer cell Ability is likely to become the important means for the treatment of gastric cancer.

The polyclonal antibody bioactivity that table 1 purifies

2 mouse last time Post-immunisation serum bioactivity of table

3 mouse ascites bioactivity of table: the titer of ascites of two monoclonal antibodies is qualified

The detection of 4 mouse ascites hypotype of table: monoclonal antibody hypotype is IgG1, and light chain is k chain

The antibody titer detection that table 5 purifies

Embodiment 7, EphrinA1 abnormal expression and related to the poor prognosis of patient in kinds of tumors

Our research discovery EphrinA1 of front overexpression and the prognosis for causing patient's appearance poor in gastric cancer, The high expression of EphrinA1 can remarkably promote invasion and the transfer ability of stomach cancer cell.In order to further prove EphrinA1 conduct The popularity and validity of anti-tumor target, we analyze the expression and prognosis situation of EphrinA1 in other cancers.

The website GEPIA includes the data of TCGA and GTEx database, including tumour/normal tissue differential expression point A variety of analysis modules such as analysis, survival analysis, correlation analysis and the Dimension Reduction Analysis of analysis, various cancers type or pathologic stage (network address: http://gepia.cancer-pku.cn/).We are in GEPIA web analytics EphrinA1 in various cancers Expression and correlation with patient's prognosis.

Experimental result:

GEPIA web analytics EphrinA1 expression find, EphrinA1 Cervix Squamous Cell cancer (CESC), Gallbladder cancer (CHOL), the cancer of the esophagus (ESCA), colon cancer (COAD), liver cancer (LIHC), oophoroma (OV), the low differentiation glioma of brain (LGG), significantly high expression in the cancers such as carcinoma of endometrium (UCEC) (Fig. 8 .1, ordinate are the value of log2 (TPM+1)).Analysis The correlation of the expression of EphrinA1 and patient's prognosis is found in Cervix Squamous Cell cancer (CESC), the cancer of the esophagus (ESCA), ovary High expression will lead to patient's prognosis mala (Fig. 8 .2) in the cancers such as the low differentiation glioma (LGG) of cancer (OV), brain.As a result illustrate EphrinA1 unconventionality expression in kinds of tumors, and it is closely related with the prognosis situation of patient, it can be used as tumor prognosis Marker and anti-tumor drug target spot.

Claims (6)

1.EphrinA1 albumen is preparing the application in the drug for inhibiting tumor cell invasion and/or transfer.

2. application according to claim 1, which is characterized in that the drug targeting EphrinA1 albumen, inhibit, strike it is low or Knock out the expression of EphrinA1.

3. application according to claim 2, which is characterized in that the drug includes at least one in following effective component Kind: the Nano medication of EphrinA1 is targeted, the CRISPR gene editing plasmid of EphrinA1 is targeted, targets EphrinA1's SiRNA targets the shRNA of EphrinA1, targets the LNA of EphrinA1, targets the ASO of the chemical modification of EphrinA1, blocks The micromolecular inhibitor of EphrinA1 function, the polyclonal antibody of EphrinA1, the monoclonal antibody of EphrinA1, EphrinA1 Humanized antibody, the nano antibody of EphrinA1, bispecific antibody targets the antibody drug of EphrinA1.

4. application according to claim 3, which is characterized in that monoclonal antibody includes rabbit source, source of mouse, dog source, monkey source, camel Source, Ji Yuan, shark source etc., polyclonal antibody include Ji Yuan, rabbit source, Yang Yuan, hunchbacked source etc..

5. application according to claim 2, which is characterized in that strike low, knockout EphrinA1 albumen by the following means: SiRNA, shRNA, gene editing；Wherein gene editing technology includes DNA homologous recombination, TALEN-TALEA targeted gene disruption Technology, Cre/Loxp system, FLP-frt system, the inductivities Cre/Loxp system such as tetracycline/interferon, CRISPR/Cas9 base Because of editing technique.

6. application according to claim 1, which is characterized in that tumour includes nasal cavity and nasal sinus malignant tumour, nasopharyngeal carcinoma, mouth Chamber cancer, laryngocarcinoma, salivary tumor transformation, intracranial tumors, thyroid cancer, tongue cancer, lung cancer, the cancer of the esophagus, cardia cancer, breast cancer, mediastinum tumor, Gastric cancer, colorectal cancer, the carcinoma of the rectum, liver cancer, cancer of pancreas and peri-ampullar carcinoma, intestinal malignant tumor, kidney, prostate cancer, bladder cancer, Cervix cancer, oophoroma, malignant melanoma of skin, lymthoma etc..