CN109402142A

CN109402142A - A kind of method of heterogenous expression FLS2 albumen

Info

Publication number: CN109402142A
Application number: CN201811280260.3A
Authority: CN
Inventors: 汤娇; 孙亚东; 韩志富; 柴继杰; 石巍
Original assignee: Institute of Apicultural Research of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Apicultural Research of Chinese Academy of Agricultural Sciences
Priority date: 2018-10-30
Filing date: 2018-10-30
Publication date: 2019-03-01

Abstract

The present invention provides a kind of methods of heterogenous expression FLS2 albumen.This method comprises: in pFastBac^TMHemolin signal peptide is added before 1 BamH1 restriction enzyme site and obtains pFastBac^TMHem carrier；With BamH1 and Sal1 digestion FLS2 gene, using BamH1 and Xho1 digestion pFastBac^TMHem carrier connects after digestion, constructs heterogenous expression carrier；Heterogenous expression carrier transfection insect cell after cultivating the cell, harvests cell and supernatant, and supernatant obtains the correct FLS2 albumen of conformation through chromatographing after purification, and expression quantity reaches 2.6mg/L.The present invention overcomes the disadvantages that the prior art can not be obtained the FLS2 albumen of correct conformation or be used other eukaryotic expression systems FLS2 expressing quantity low using prokaryotic expression system, improve the expression quantity of the correct FLS2 albumen of conformation, have saved cost.

Description

A kind of method of heterogenous expression FLS2 albumen

Technical field

The present invention relates to gene engineering technology fields, and in particular, to a kind of method of heterogenous expression FLS2 albumen.

Background technique

Plant accepter kinases can be divided into many different receptor protein families according to the difference of extracellular identification structural domain, The most research of middle quantity it is the most deep be full asphalt mixture receptoroid kinases (leucine-rich repeats Receptor kinase, LRR-RK), LRR-RK family is divided into 16 subfamilies.FLS2 albumen belongs to XII family, contains 1173 A amino acid, about 129KDa include N-terminal signal peptide, N-terminal cap LRRNT structure, 28 continuous regular LRRs, membrane-proximal regions, list Secondary transmembrane region TM, kinase domain and a C-terminal tail.There are two cysteines pair of standard in the end N-, C-, is used for cap knot The formation of structure.

FLS2 albumen is the receptor protein kinase in model plant arabidopsis, is located on cell surface, protein receptor kinases Structure be divided into an extracellular identification structural domain, single pass transmembrane area and intracellular kinase domain.Extracellular identification structural domain is responsible for knowledge The signaling molecule of other external source, and then this receptor is activated, cause intracellular kinase domain that phosphorylation occurs, thus by signal by cell It is transferred to outside into the cell, causes a series of intracellular biochemical reactions.FLS2 albumen is the master of plants identification bacterial flagellin Receptor, this receptor will cause plant in the intracorporal missing of plant and decline to the immunity of bacterium, cause plant by bacterial invasion, mistake Expression FLS2 albumen can improve plant to the tolerance of bacterium, obtain disease-resistant new plant.Bacterial flagellin and FLS2 albumen knot The immune response of meeting activated plant after conjunction, helps the invasion of plant resistant germ, external to obtain FLS2 albumen, can be used for screening Novel small-molecule drug filters out the small-molecule drug that can be immunoreacted with activated plant, and when bacterial invasion, plant can be with To antibacterial infringement, development of new anti-bacterial drug promotes the disease-resistant phenotype of plant and improves the yield of plant.

Current research contents, which is concentrated mainly on, probes into the extracellular identification structural domain of this kind of receptor protein of FLS2 is how to know The mechanism being activated after not extracellular signal identifing source.Main means are to obtain fine the three of albumen by X-ray diffraction technology Structure is tieed up, illustrates the above problem on a molecular scale.Due to only one hydrophobic transmembrane region of FLS2 albumen, this is in vitro Recombinating the full-length proteins is a very big obstruction.Since the hydrophobic transmembrane of albumen is firmly to be anchored the albumen on cell membrane Region on cell membrane, transmembrane region is more, and albumen is more stable on cell membrane, if the more memebrane protein of transmembrane region weighs in vitro Cell membrane can be simulated during group using chemical reagent such as detergents, and then successfully obtains the external success table of memebrane protein It reaches, but for the albumen of only one hydrophobic transmembrane, such as FLS2 albumen, the table in vitro of the full-length proteins with transmembrane region Up to extremely unstable in the process, therefore it will lead to albumen and do not express in vitro and either form the incorrect albumen of conformation.Therefore single The extremely disadvantageous stability in albumen on cell membrane in secondary hydrophobic transmembrane, the strategy that can be taken at present are only by FLS2 albumen Extracellular regions carry out amplification in vitro and are building up on expression vector appropriate, then obtain the extracellular domain of its Stable conformation Albumen.

Protein macromolecule carries diversified physiological function in vivo, studies the structure and function of protein Understand physiological regulating control, organism metabolism for the mankind to be of great significance, but generally require to obtain in vitro with correct conformation and The recombinant protein of physiological function just can guarantee smooth development and the implementation success of a series of researchs.Prokaryotic expression system very great Cheng Improve the problems such as recombinant exogenous protein expression quantity is not high and downstream separation difficulty of processing is big to degree.Wherein expressing fusion protein The expression pattern of technology is: prokaryotic promoter → SD sequence → initiation codon → protokaryon structural gene segment → target gene sequence Column → terminator codon are more commonly used expression vectors, are particularly suitable for the expression of micromolecule polypeptide and albumen.However due to FLS2 albumen is macromolecular eukaryon exocytosis albumen, albumen often occurs using prokaryotic expression system heterogenous expression FLS2 albumen It is beyond expression or is formed inclusion body, the correct albumen of conformation cannot be obtained.The prior art is produced using eukaryotic expression system FLS2 albumen, but expression quantity is not high, usually in 0.4mg/L.Such expression quantity is far from satisfying Follow-up Industry to FLS2 The demand of albumen.Therefore, it is badly in need of a kind of FLS2 expressing quantity, the low-cost method of can be improved to make up the prior art It is insufficient.

Summary of the invention

It is an object of the present invention to provide a kind of method of heterogenous expression FLS2 albumen, this method can be improved FLS2 egg White expression quantity, and the conformation of obtained FLS2 albumen is correct, meets expection.

It is a further object to provide a kind of expression vectors of heterogenous expression FLS2 albumen.

The main technical schemes that the present invention uses are as follows: in view of there is no include subregion, this hair for the extracellular code area FLS2 The extracellular domain of the bright FLS2 directly amplified from arabidopsis gene group.Structure domain analysis is carried out to FLS2 gene order, The hydrophobic transmembrane of FLS2 is predicted using signal peptide prediction website (SignalP) and hydrophobic transmembrane prediction website (TMHMM) With signal peptide region.This section of region before hydrophobic transmembrane is extracellular region.In view of FLS2 albumen belongs to secretory protein, The N-terminal signal peptide of itself can lead synthetic peptide chain to carry out later period modification and processing in endomembrane system, and lead Outside the protein secretion to cell membrane processed, after the completion of the function of signal peptide, signal peptide can be cut away in the later period, be become into Ripe secretory protein.By primarily determining that FLS2 transmembrane region is 807-829aa after software prediction.Transmembrane region front end boundary can be with The amino acid of front and back 3-4 does several fragment lengths more, has error to cause albumen mistake to prevent predicted position and practical cutting position It folds.Finally the determining extracellular section length of FLS2 is 1-800aa, and amino acid sequence is as shown in SEQ ID NO.1.

The selection of restriction enzyme be built upon in objective gene sequence can not occur being selected be located at gene two The cleavage sequence of both restriction enzymes of side, otherwise in the digestion experimentation for carrying out the later period, the carrier of being connected into Gene order can be cut by restriction enzyme, to be unable to get successful recombinant plasmid.Based on mentioned above principle, this hair It is bright when screening restriction enzyme site, selected two couples of restriction enzyme BamH1 and Xho1, Bgl2 and Sal1.BamH1 and Bgl2 are mutual For isocaudarner, Xho1 and Sal1 isocaudarner each other.This two groups of isocaudarners carry out digestion to target gene, each in each group of isocaudarner Choose one, two-by-two collocation carry out using.Altogether there are four types of combination: BamH1 and Xho1, BamH1 and Sal1, Bgl2 and Xho1, Bgl2 and Sal1.Simultaneously present invention discover that there is no both restriction enzymes pair of BamH1 and Sal1 in FLS2 gene The restriction enzyme site answered.Therefore this combination of selection BamH1 and Sal1 carries out digestion.The reasonable utilization of aforementioned four kinds of combinations can be most Evade to limits in target gene and restriction enzyme site sequence occur, the reduction later period eliminates the work of restriction enzyme site using point mutation Amount.

Foreign vector is carrier pFastBac^TMAfter Hem is handled using both restriction enzymes of BamH1 and Xho1 It is spare.And the restriction enzyme site at target gene both ends is just in BamH1&Xho1, BamH1&Sal1, Bgl2&Xho1, Bgl2&Sal1 this It is selected in four kinds of combinations, such target fragment could smoothly be connected into the carrier cut.It is not present in FLS2 gene order The restriction enzyme site of both restriction enzymes of BamH1 and Sal1, therefore select digestion of the BamH1 and Sal1 as gene both ends Site, rather than " BamH1 and Xho1 ", " Bgl2 and Xho1 " or " Bgl2 and Sal1 ".When the later period using BamH1 and Sal1 this two When kind restriction enzyme cuts FLS2, FLS2 gene will not be cut off by both enzymes.Then according to codon Base is carried out point mutation by fault-tolerance principle, has both eliminated the restriction enzyme site in this way, while also not will cause the mutation of amino acid. After having selected restriction enzyme site, at the end of (restriction enzyme site) 5 ' and 3 ' again respectively plus suitable protection base.The present invention The exon of FLS2 gene is as shown in SEQ ID NO.2.

In terms of the building of foreign vector, inventor fully considers the selection principle and heterogenous expression carrier signal of restriction endonuclease The signal transfer functions of peptide, the suppression haemocyte that rod-shaped viral source is introduced by the screening of restriction enzyme site and in expression vector are poly- Collect the signal peptide of element Hemolin signal peptide replacement FLS2 albumen itself.Before the signal peptide of FLS2 albumen itself is its sequence N-terminal 24 amino acid.One section of baculoviral is added in the front end connecting on the heterogenous expression carrier that the present invention constructs with target gene N-terminal The hemolin Hemolin signal peptide in source.

Further, the foreign vector is carrier pFastBac^TMHem is in carrier pFastBac^TM1 BamH1 Hemolin signal peptide is added before restriction enzyme site to obtain, the nucleotide sequence of the Hemolin signal peptide such as SEQ ID NO.3 institute Show.

Important function of the signal peptide in protein expression process, it is usually that this kind of vegetable protein of FLS2 is thin in insect Heterogenous expression is carried out in born of the same parents.Whether still can be with due to that can not learn that the signal peptide of vegetable protein itself is transferred in insect cell The function of itself is normally exercised, therefore in a preferred embodiment of the invention, by the rod-shaped disease in insect cell expression system Malicious expression vector pFastBac-^TM1 is transformed, and the carrier being newly transformed is pFastBac^TM-Hem.I.e. in pFastBac-^TM The hemolin in one section of baculoviral source is added on the front end portion connecting on 1 carrier with target gene N-terminal (Hemolinpeptide) signal peptide.Present inventors have unexpectedly found that using Hem signal peptide than being imitated using the N-terminal signal peptide of FLS2 itself Fruit is more preferable, and in addition under the conditions of same Protein expression and purification, the FLS2 expressing quantity under gp67 signal peptide is only Hem The 10% of FLS2 expressing quantity under signal peptide, therefore it is considered herein that Hem signal peptide can be identified by insect system, be sheared simultaneously Guidance passes through the sequence of endoplasmic reticulum as secreting signal peptide.The present invention is added in the C-terminal of target gene convenient for purifying simultaneously His label, using 3 ' -5 ' end primers on add 6 Mstidine codon sequences and termination codon subsequence, make reading frame It reads downwards always until then having read terminator codon to the codon for having read His label.Translation terminates.

Select pFastBac^TMThe carrier that this present invention of-Hem is newly transformed needs the purpose that will be connected into as expression vector The target fragment that native signal peptide before genetic fragment (FLS2 exon genes) removes, therefore is connected into is FLS2-25-800, is gone 24 amino acid of N-terminal are fallen.FLS2 albumen of the invention is to select pFastBac^TM- Hem carrier adds FLS2-25-800 base Because of segment, the correct FLS2 extracellular region protein for folding expression can be obtained, and improve the expression quantity of FLS2.

It is dissected based on overall technology design of the invention with technological invention point, the present invention provides a kind of heterogenous expression FLS2 The method of albumen, comprising steps of

(1) carrier of the hemolin Hemolin signal peptide containing baculoviral source is constructed；

(2) clone obtains FLS2 exon genes, FLS2 exon genes is connected on the carrier of step (1), obtains outer Source expression vector；

(3) heterogenous expression carrier transfection insect cell obtains recombinant baculovirus, and virus infection insect cell, culture should After insect cell, cell and supernatant are harvested, supernatant obtains the correct FLS2 albumen of conformation through chromatographing after purification.

In the above method, the construction method of step (1) described carrier is in pFastBac^TMAdd before 1 BamH1 restriction enzyme site Enter Hemolin signal peptide and obtains pFastBac^TMHem carrier；The nucleotide sequence of the Hemolin signal peptide such as SEQ ID Shown in NO.3.

The amino acid sequence of FLS2 albumen described in the above method of the present invention is as shown in SEQ ID NO.1.

The nucleotide sequence of FLS2 exon genes described in the above method of the present invention is as shown in SEQ ID NO.2.

In heterogenous expression FLS2 protein process provided by the invention, before the FLS2 exon genes of step (2) are connected into carrier Using BamH1 and Sal1 digestion FLS2 exon genes.

Further, in step (2), obtained carrier is constructed using BamH1 and Xho1 digestion step (1), after digestion with The connection of FLS2 exon genes, constructs heterogenous expression carrier.

In the embodiment of the present invention, by optimal screening, the insect cell selection expression quantity in step (3) is more, miscellaneous egg White less Hi5 cell.

The present invention provides the FLS2 albumen that the above method is prepared.

On the other hand, the present invention provides a kind of heterogenous expression carriers for expressing FLS2 albumen, on the carrier with purpose base Because the hemolin Hemolin signal peptide in one section of baculoviral source is added in the front end of N-terminal connection.

Preferably, above-mentioned heterogenous expression carrier is carrier pFastBac^TMHem is in carrier pFastBac^TM1 BamH1 Hemolin signal peptide is added before restriction enzyme site to obtain, the nucleotide sequence of the Hemolin signal peptide such as SEQ ID NO.3 institute Show.

Further, the present invention provides the obtained FLS2 eggs of method, this method of above-mentioned heterogenous expression FLS2 albumen White, above-mentioned heterogenous expression carrier can be with the small-molecule drug of activated plant immune response, development plants antimicrobial medicine, raising in screening Application in plant disease-resistant phenotype or raising plant products.

Based on the above-mentioned technical proposal, the present invention achieve it is following the utility model has the advantages that

(1) the method for the present invention solves can not correctly be expressed always using escherichia coli prokaryotic expression system for a long time The technical problem of FLS2 albumen.Since FLS2 albumen belongs to the vegetable protein of secretion class, needed during protein folding, secretion Want intramolecular disulfide bond be properly formed and late protein surface it is glycosylation modified, but in prokaryotic expression system lack This few glycosylation modified process and the mispairing for being easy to cause disulfide bond.The method of the present invention uses Hi5 or SF21 cell for the first time It is that in-vitro recombination expression is carried out to the full asphalt mixture receptoroid albumen FLS2 in plant Arabidopsis thaliana.

(2) plasmid construction link use isocaudarner combination of two, discovery do not have in FLS2 gene BamH1 and Sal1 this The corresponding restriction enzyme site of two kinds of restriction enzymes, therefore this combination of BamH1 and Sal1 is selected to carry out digestion.Restriction enzyme Enzyme reasonable utilization, which can be evaded to the maximum extent in target gene, there is restriction enzyme site sequence, and the reduction later period is disappeared using point mutation Except the workload of restriction enzyme site, the utilization rate and building efficiency of carrier are greatly improved.

(3) process formed due to different destination protein external source is multifarious, the method for heterogenous expression also each not phase Together, expression vector used, signal peptide, culture medium cultivate the cell line type of albumen, cultivation temperature can influence the table of albumen Up to amount, the present invention is suitable for the signal peptide of cell secreting, expressing, is obtained and be more suitable for FLS2 albumen table by transformation carrier, selection The carrier pFastBac reached^TMHem, the insect cell line that selection expression is high and foreign protein is few, especially Hi5 cell, facilitates outer The successful secretion of source protein and expression improve a possibility that obtaining correct recombinant protein.

(4) present invention can be in gel permeation chromatography using irreducibility (no DTT) detection in a small amount of detection of expression stages The proportionate relationship between the protein molecular and aggregation of correct conformation is just analyzed before, greatly saves cost and time.

Detailed description of the invention

Fig. 1 is the process schematic of Bac-to-Bac baculovirus expression system of the present invention.

Fig. 2 is the pcr amplification product gel electrophoresis figure of FLS2 gene, is gone out using primer amplification shown in SEQ ID NO.4-5 FLS2 gene size be about 2325bp, show genetic fragment between 2000-3000bp in figure.

Fig. 3 is pFastBac^TM1 baculovirus vector map and multiple cloning sites diagram.

Fig. 4 A is pFastBac^TMHem baculovirus vector map, pFastBac^TMHem baculovirus vector is in carrier pFastBac^TMHemolin signal peptide is added before 1 BamH1 restriction enzyme site to obtain, the nucleotides sequence of the Hemolin signal peptide Column are as shown in SEQ ID NO.3；Fig. 4 B is pFastBac^TMThe multiple cloning sites of Hem, restriction enzyme site represent as shown in the figure Actual cleavage site, underscore mark potential terminator codon.The signal peptide of building is translated since ATG, is translated The signal peptide of Hemolin is directly merged with the target gene N-terminal of heterogenous expression.

Fig. 5 is the FLS2 purification result figure of Hi5 cell expression, purifies FLS2 egg using gel permeation chromatography method It is white, upper figure: the gel chromatography of FLS2 albumen as a result, transverse and longitudinal coordinate respectively represents elution volume and ultraviolet absorption value (λ=280), The molecular size range of FLS2 marks in figure；The following figure: upper figure corresponds to the sample collected at elution site and carries out SDS-PAGE It is detected with coomassie brilliant blue staining.

Fig. 6 is the differential expression of FLS2 albumen under different cell lines and unlike signal peptide.Wherein, A figure is unlike signal peptide Lower FLS2 protein expression effect picture.The SDS-PAGE detection of FLS2 albumen and coomassie brilliant blue staining knot under 1.gp67 signal peptide Fruit.The SDS-PAGE detection and coomassie brilliant blue staining result of FLS2 albumen under 2.Hem signal peptide.B figure is under different cell lines FLS2 protein expression effect picture.The SDS-PAGE detection and coomassie brilliant blue staining result of FLS2 albumen under a.Hi5 cell line. The SDS-PAGE detection and coomassie brilliant blue staining result of FLS2 albumen under b.SF21 cell line.

Fig. 7 is the western blot testing result of FLS2 albumen.Respectively control group and experimental group, experimental group is to FLS2 The His label of albumen carries out antibody hybridization experiment, and experimental group protein sample is FLS2 albumen.

Fig. 8 is a small amount of detection of expression of FLS2 (+DTT and-DTT are compared).A small amount of test experiences of the FLS2 of Hi5 cell expression Figure.Eluent carries out SDS-PAGE to cell culture fluid after ni-sepharose purification and coomassie brilliant blue staining, two swimming lanes are pair respectively The reproducibility (+DTT) and irreducibility (- DTT) testing result of FLS2 albumen.

Specific embodiment

Following embodiment should not be construed as limiting the invention for further illustrating the contents of the present invention.Not In the case where spirit of that invention and essence, to modifications or substitutions made by the method for the present invention, step or condition, this is belonged to The range of invention.

If without specializing, the conventional means that technological means used in embodiment is well known to those skilled in the art.

The acquisition of 1 FLS2 gene extron of embodiment

In view of the extracellular code area FLS2 is there is no subregion is included, the present invention is directly amplified from arabidopsis gene group FLS2 extracellular domain.The PCR enzyme of high-fidelity is selected in PCR amplification experiment, to prevent base mutation occurs in amplification procedure, The primer sequence is as follows.

FLS2_25_BamHI_5:CGCGGATCCATGAAGTTACTCTCAAAG (SEQ ID NO.4)

FLS2_800_6His_SalI_3T:

GACGTCGACCTAATGATGATGATGATGATGGTGGCTCGACTTCTGC(SEQ ID NO.5)

Pcr amplification reaction system: 5 μ L 10 × pfu buffers, 2.5 μ L dNTP (2.5mM), 0.1 μM of upstream and downstream primer Each 1 μ L of 0.5 μ L, pfu polymerase, 0.5 μ L of template add distilled water to 50 μ L.Pcr amplification reaction condition is 95 DEG C, 5min；Totally 30 A circulation: 94 DEG C of 30s, 53 DEG C of 30s, extension of time needed for 72 DEG C of 600bp/min are calculated；72℃10min.Illustrate according to kit Book operation recycling pcr amplification product (see Fig. 2).

Structure domain analysis is carried out to FLS2 gene order, using signal peptide prediction website (SignalP) and hydrophobic transmembrane Prediction website (TMHMM) predicts the hydrophobic transmembrane and signal peptide region of FLS2.This section of region before hydrophobic transmembrane As extracellular region.In view of FLS2 albumen belongs to secretory protein, the N-terminal signal peptide of itself can lead synthetic peptide chain to exist Later period modification and processing are carried out in endomembrane system, and is led outside the protein secretion to cell membrane processed, when the function of signal peptide After the completion of energy, signal peptide can be cut away in the later period, become mature secretory protein.By primarily determining FLS2 after software prediction Transmembrane region is 807-829aa.Transmembrane region front end boundary can do several fragment lengths the amino acid of front and back 3-4 more, to prevent pre- Location is set has error to cause protein misfolding with practical cutting position.Finally the determining extracellular section length of FLS2 is 1-800aa, Its amino acid sequence is as shown in SEQ ID NO.1, and nucleotide sequence is as shown in SEQ ID NO.2.

2 heterogenous expression carrier pFastBac of embodiment^TMThe building of Hem

Signal peptide plays a significant role in protein expression process, by this kind of vegetable protein of FLS2 in insect cell During carrying out heterogenous expression, whether still may be used due to that can not learn that the signal peptide of vegetable protein itself is transferred in insect cell Normally to exercise itself function, therefore the present embodiment is by the rhabdovirus expression vector in insect cell expression system pFastBac^TM1 is transformed (see Fig. 4 A) (see Fig. 3), and the carrier being newly transformed is pFastBac^TM-Hem.Exist pFastBac^TMThe suppression haemocyte that one section of baculoviral source is added on the front end portion connecting on 1 carrier with target gene N-terminal is poly- Collect plain (Hemolinpeptide) signal peptide (see Fig. 4 B), nucleotide sequence is as shown in SEQ ID NO.3.

Experimental result is shown later stage experssion after purification, and the FLS2 expressing quantity of Hem signal peptide is probably in 2.6mg/L.Together Under the conditions of the Protein expression and purification of sample, the FLS2 expressing quantity under gp67 signal peptide is only FLS2 albumen under Hem signal peptide The 10% of expression quantity.

Present inventors have unexpectedly found that using gp67 (signal peptide of baculoviral surface glycoprotein) signal using Hem signal peptide ratio Peptide effect more preferably (see Fig. 6) can will be identified, shear and be guided the sequence for passing through endoplasmic reticulum as secretion letter by insect system Number peptide.The present invention adds the His label convenient for purifying in the C-terminal of target gene simultaneously, adds using on 3 ' -5 ' end primers 6 Mstidine codon sequences and termination codon subsequence read reading frame downwards always until to His label has been read Then codon has read terminator codon.Translation terminates.

Select pFastBac^TMAs expression vector, the later period connect the carrier that this present invention of Hem is newly transformed with target gene When, purpose that the native signal peptide before the target gene fragment (FLS2 exon genes) for needing to be connected into removes, therefore is connected into Segment is FLS2-25-800, eliminates 24 amino acid of N-terminal.

3 FLS2 gene extron of embodiment and heterogenous expression carrier pFastBac^TMThe system of Hem connection and recombination bacmid It is standby

The selection of restriction enzyme be built upon in objective gene sequence can not occur being selected be located at gene two The cleavage sequence of both restriction enzymes of side, otherwise in the digestion experimentation for carrying out the later period, the carrier of being connected into Gene order can be cut by restriction enzyme, to be unable to get successful recombinant plasmid.Based on mentioned above principle, this reality Example is applied when screening restriction enzyme site, has selected two couples of restriction enzyme BamH1 and Xho1, Bgl2 and Sal1.BamH1 and Bgl2 Isocaudarner each other, Xho1 and Sal1 isocaudarner each other.

This two groups of isocaudarners carry out digestion to the target gene that embodiment 1 obtains, and respectively choose one in each group of isocaudarner, Two-by-two collocation carry out using.Altogether there are four types of combination: BamH1 and Xho1, BamH1 and Sal1, Bgl2 and Xho1, Bgl2 and Sal1。

Present invention discover that not having BamH1 and Sal1 in the FLS2 gene that embodiment 1 obtains, both are restricted interior simultaneously The corresponding restriction enzyme site of enzyme cutting.Therefore this combination of selection BamH1 and Sal1 carries out digestion.The reasonable utilization of aforementioned four kinds of combinations It can evade to the maximum extent in target gene and restriction enzyme site sequence occur, reduce the later period and restriction enzyme site is eliminated using point mutation Workload.

Foreign vector is that obtained carrier pFastBac is transformed in embodiment 2^TMHem is using both limitations of BamH1 and Xho1 Property restriction endonuclease is spare after being handled.And the restriction enzyme site at target gene both ends selects BamH1 and Sal1, such target fragment is The carrier cut can be smoothly connected into.When later period cuts FLS2 using both restriction enzymes of BamH1 and Sal1, FLS2 gene will not be cut off by both enzymes.If there is no the restriction enzymes at target gene both ends in target gene Restriction enzyme site, there is no need to do point mutation again；If selected restriction enzyme combination is in purpose inside four combinations Occur their restriction enzyme site in the sequence of gene, then needs to carry out point mutation experiment again.Restriction enzyme site is not present in FLS2 gene BamH1 and Sal1, so not needing to do point mutation again in this example.After having selected restriction enzyme site, in (restriction enzyme site) 5 ' With 3 ' ends again respectively plus suitable protection base.After selecting above-mentioned restriction enzyme site, to foreign vector and FLS2 gene Enzymatic cleavage methods are all made of this field routine techniques, obtain FLS2 gene and carrier pFastBac^TMThe connection product of Hem.

FLS2 albumen of the invention is to select pFastBac^TMHem carrier adds FLS2-25-800 genetic fragment, can obtain The FLS2 extracellular region protein for correctly folding expression is obtained, and improves the expression quantity of FLS2.

The competent cell BL21 (DE3) or DH5 α for preparing or buying are taken out from -80 DEG C of refrigerators, will prepare conversion Connection product is added in 100ul or 25ul competent cell (depending on the concentration of competent cell and efficiency), on ice It places 15 minutes, then warm bath 90 seconds in 42 DEG C of water-baths, immediately takes out and be put in 5 minutes on ice, 600 μ l LB liquid are added Culture medium, draws culture solution and is evenly coated in the LB with ammonia benzyl antibiotic at 37 DEG C of 180 revs/min of oscillations recovery 1 hours of culture On plate, 37 DEG C of incubators are incubated overnight.The a certain number of monoclonal colonies of picking are managed in the EP equipped with 1ml corresponding resistant culture medium In, 37 DEG C of 220 revs/min of oscillations recovery 10-12 hours of culture take 1ul bacterium solution to do template and carry out PCR identification, or extract Plasmid carries out digestion identification, is identified as positive monoclonal and sequencing company is sent to be sequenced, and correctly clone is sequenced, saves plasmid It is stand-by in -20 DEG C of refrigerators.

The upper correct plasmid of pacing sequence is transformed into competent cell DH10Bac, to when recovery culture, is recombinated for guarantee Sufficiently, 5-6 hour of recovery is needed, takes 30ul culture medium later, is evenly coated in three kinds of antibiotic with the glass bar after sterilizing On (kanamycins, gentamicin, tetracycline) plate, it is put in 37 DEG C of incubators and is protected from light 40-48 hour of culture.It is 40-48 small The spot of blue or white can be clearly seen in Shi Hou, in picking white dot Yu Sankang culture medium, after 37 DEG C of cultures, take 1ul Bacterium solution does template, carries out PCR identification, primer (SEQ ID NO.4 or 5) of the primer one end from gene magnification, other end is The upper intrinsic M13 aligning primer of Bacmid, the correct positive colony of clip size are the bacmid of recombination.After identification is positive, root Viral cosmid Bacmid is extracted according to kit specification, takes 1-2 μ l recombination bacmid to carry out agarose gel electrophoresis after extraction, really Whether the content for recognizing the recombination bacmid of extraction is enough, and recombinant baculovirus clay is put in 4 DEG C and saves backup.

The expression of 4 FLS2 albumen of embodiment

1, viral coating

Followed by the production of virus, viral production is made of insect cell, therefore is ready to first Positioned at the insect cell of suitable growth phase and suitable concentration.It uses two kinds of insect cells altogether in this experiment, is SF21 respectively With Hi5 insect cell (being shown in Table 1).

1 cell strain list of table

SF21 cell can be used for the production and culture expression of virus；Hi5 insect cell is served only for culture expression.Insect is thin Born of the same parents use suspension training method, are logarithmic growth.The manufacturing process of virus is called transfection, and all operations are ultra-clean in iuntercellular It is carried out in platform, the specific steps are as follows:

(1) it prepares solution A: taking a new 1.5mL sterile centrifugation tube, bar made from 5-7 μ l embodiment 3 is added in pipe Shape viral cosmid (FLS2 recombinates Bacmid) adds the SF900II culture of the 100 non-added with antibiotic of μ l (streptomysin and penicillin) Base (is purchased from GIBCO company, the present embodiment cell culture medium all refers to SF900II culture medium), and gently pressure-vaccum mixes.

(2) it prepares solution B: taking a new 1.5mL sterile centrifugation tube, 5-7 μ l transfection reagent is added in pipe (cellfectin is purchased from Invitrogen), adds the SF900II culture medium of the 100 non-added with antibiotic of μ l, gently pressure-vaccum is mixed It is even.If the number for transfecting Bacmid is more, a Mix solution for standby can be configured.Mix solution composition include transfection reagent and The SF900II culture medium of nonreactive, the Mix solution of solution B proportionally amplify each ingredient of solution B；Such as in single experiment Experimenter needs to do the transfection of 5 kinds of different baculoviral clays in operation, can prepare the Mix solution of 5 doses solution Bs, mesh Be guarantee that every part of solution A with baculoviral clay can mix with identical solution B is completed, reduction manual operation Error.

(3) solution B is added in solution A, gently pressure-vaccum mixes, and is named as solution C.Solution C is put into 28 DEG C of incubators Stand 30 minutes.

(4) the Sf21 cell in good condition in logarithmic growth phase, cell concentration 1.5~2.5 × 10 are chosen⁶A cell/ Milliliter is laid on cell 6 orifice plates, and each hole total number of cells control is 1~1.5 × 10⁶It is a, and finally by the culture medium in cell hole Volume polishing to 2mL volume, the light rolling culture plate in front and back or left and right is uniformly distributed in cell in hole.Culture plate is put into 28 DEG C incubator stands 10 minutes or so, keeps cell sufficiently adherent.

(5) after cell is completely adherent, original culture medium is sucked, 1-1.5mL nonreactive culture medium is added in each hole, gently Shake six orifice plates, abundant rinse cell.The purpose of this step is the antibiotic removed in original culture medium, because antibiotic can shadow Ring transfection efficiency.The rinse culture medium in six orifice plates is sucked, it is stand-by to add 1mL nonreactive culture medium.

(6) solution C is gently added in the cell of six orifice plates after pressure-vaccum mixes, light six orifice plates that shake make its uniform fold.

(7) six orifice plates are placed in 28 DEG C of incubators, stand 5 hours.

(8) liquid is changed.Culture medium containing transfection reagent and clay is siphoned away, each hole be added 2-3mL contain penicillin and The SF900II culture medium of streptomycin resistance.Continue stationary culture 3-4 days in 28 DEG C of incubators.

(9) observation transfection phenomenon, and first generation virus is collected, culture solution is drawn in 15mL centrifuge tube, 2000 revs/min of centrifugations 5 minutes, supernatant was to recombinate FLS2 baculoviral, is named as P1, is kept in dark place in 4 DEG C.It is whether obvious for observation transfection phenomenon, Control group experiment can be done, is conducive to compare.The too long meeting cell cracking of incubation time after virus transfection, content release influence virus State, the time of stationary culture was preferably not more than 5 days.P1 virus, amount is less and titre is low, is not used to great expression purpose egg It is white, it is therefore desirable to expand P2 (second generation) and P3 (second generation) virus.Under normal conditions, only the third generation is arrived in amplification to virus, because The ability for continuing the expressing viral foreign protein of amplification can be declined.P2 virus detects in a small amount for destination protein, determines table After reaching, amplification P3 virus evaluates albumen behavior etc. for the large-scale purification of destination protein.

The process schematic for the Bac-to-Bac baculovirus expression system that the present invention uses is shown in Fig. 1.

2, the expression of albumen

The expression of a small amount of testing goal albumen of 2.1 insect cells

Before mass propgation purifying protein, first need whether to express and protein expression using detecting albumen in a small amount Amount number；General to carry out protein expression test with P2 or P3 virus, the cell of test is the culture that suspends, the type Sf21 of cell With Hi5 cell it can be selected that Hi5 cell is more suitable for the expression of secretory protein.The method and experiment condition of test it is following (by Last comparison result is that the effect of Hi5 cell expression is more preferable (see Fig. 6) in this research, therefore here with the table of Hi5 cell For reaching):

(1) cell density: Hi5 cell is more stringent for density requirements, preferably in 1.6-2.0 × 10⁶Between a/mL. Ensure that cell state is good and is in logarithmic growth phase.

(2) after cell grows to suitable density, each glass culture bottle dispenses 25-30mL cell, adds in every bottle of cell Enter P2 or P3 virus.If not surveying virus titer, the virus quantity being added need to do gradient test, different albumen or difference The viral situation of batch may be different.Starting can be according to virus: cell volume is 1:50 addition.

(3) temperature and incubation time cultivated: Hi5 cell is cultivated before virus does not infect in 28 DEG C of suspensions, and 120 revs/min； It will be placed on 22 DEG C of suspensions in cell after infecting after virus infection is added to cultivate, 120 revs/min；Time of infection 48 hours.48 is small When after use 4000 revs/min, be centrifuged 10 minutes separation supernatant cells.It if expressing secretory protein, is secreted into culture medium , then cell precipitation is abandoned after being centrifuged, takes supernatant；It is anti-then take precipitating.Secreting, expressing albumen, supernatant directly pour into 200 μ l affinity columns beads；The wash buffer of 2 2ml is added, finally affinity column is flowed through with 300ul elution buffer, flows through Elution buffer is retained, in addition loading buffer loading, is detected with SDS-PAGE.

Secretory protein this for FLS2 can use a small strategy in SDS-PAGE detection, can be quickly and easily What kind of the truly expressed amount for understanding the secretory protein of correct conformation is.The albumen used in conventional SDS-PAGE experiment It is, in order to open the disulfide bond in protein, to be easier experimenter containing DTT in sample loading buffer component Observe the molecular size range of protein sample.But for secretory protein this for FLS2, during heterogenous expression often It, can be real without using gel permeation chromatography using the loading buffer without containing DTT with the appearance of protein masses The FLS2 albumen that external source acquisition can be offered an explanation before testing is the protein masses of the correct albumen of conformation or abnormal conformation.On Remove in the formula of the loading buffer used when sample DTT (dithiothreitol dithio), the effect of dithiothreitol dithio is to beat Open the disulfide bond formed in protein.Since secretion albuminoid is there is many disulfide bond, disulfide bond is easy to happen wrong pairing Change to form aggregation so as to cause protein conformation, detecting albumen meeting mistake by SDS-PAGE again after DTT is added will be some The albumen that disulfide bond mispairing is formed is considered as the albumen of correct conformation, therefore it is big to remove molecular weight on the SDS-PAGE after DTT The depth of protein band is only the expression quantity of correct conformational protein on small correct position, by the comparison of right+DTT and-DTT, It will be seen that ratio of the correct conformational protein in Tot Prot.The present embodiment adds DTT by comparing and DDT is not added to carry out SDS- The method of PAGE result qualitatively judges which band is the correct FLS2 albumen of conformation in PAGE glue, then according to this The width and depth difference of band probably measure the expression quantity of the FLS2 albumen of correct conformation, because the albumen eluted can wrap Containing the correct FLS2 albumen of conformation, the aggregation of abnormal conformation and some foreign proteins have many bands on glue, first want it is qualitative which Band is the correct albumen of conformation, is then probably quantified further according to width and the depth, and the numerical value of practical expression quantity needs to join Examine the depth and width of the protein band of-DTT (see Fig. 8).

Pass through the molecular weight of albumen in the elution site and SDS-PAGE result of albumen in gel permeation chromatography experimental result Size judges that the conformation of expressed albumen is correctly that, such as Fig. 5, FLS2 elution site has been indicated in gel chromatography result, out Between 61-68ml, the upper molecular weight of albumen of SDS-PAGE is 117kDa for peak position, be consistent with the actual molecular weight of FLS2 due to FLS2 albumen carries out hybrid experiment with His label, using the antibody of His label, 117kDa position detection to egg White, illustrating that the present invention obtains albumen is the FLS2 albumen with His label.The testing result of Western blot is shown in Fig. 7.

The cell line that whether determining albumen is expressed and optimized according to testing result is (in SF21 cell and Hi5 cell two Selection expression quantity is more in kind cell line, as a result the less Hi5 cell line of foreign protein is shown in Fig. 6 B).

The mass propgation of 2.2 albumen and purifying

According to the optimization situation that a small amount of testing goal albumen are last, expression system is expanded to 500~600mL, for detecting The albumen behavior of destination protein and protein content, finally expansion culture to 2~3L carries out mass propgation again, to obtain the egg of sufficient amount It is white for used in later experiments.Used culture medium is the SF900 II of GIBCO company without blood when mass propgation and when a small amount of detections Clear culture medium (1 ×) 1000ml, is first added 5ml penicillin streptomycin mixed liquor (GIBCO company) when using, to prevent from making Cell contamination is caused when being passed on culture medium.When cultivating cell, discovery can not add fetal calf serum into cell culture medium (FBS), the normal growth and heterogenous expression function of insect cell be will not influence.Since albumen FLS2 is secretion table in this research The albumen reached.In the C-terminal of target gene, add 6 × His purification tag, therefore purifies mesh with Ni-NTA His label binding medium Albumen.The extraction process of secretory protein is following (extraction process is carried out 4 DEG C of cold houses):

(1) 4000 revs/min of large capacity centrifuge are used, after being centrifuged 10 minutes harvest supernatants, supernatant is added to the Ni- regenerated In NTA affinity column, supernatant is made to slow transit through affinity media by gravity.To guarantee joint efficiency, every 100mL culture medium is used 1 Ni-NTA affinity column, and twice of loading.Every 2~3mL of Ni-NTA affinity column column material.

(2) contain the Ni-NTA wash buffer rinse affinity media of 15mM imidazoles with 10mL.

(3) step (2) are repeated twice, washes away foreign protein as much as possible.

(4) with the albumen combined on the Ni-NTA elution buffer elution media of 5mL twice.Protein eluate gives over into one Step is purified and is sampled, and is labeled as Elution (E).

The destination protein being then further purified using the method for gel permeation chromatography, using the ACTA of GE company The automatic loading elution system of Purifer, the loading volume that loading loop is carried in system is 2ml, it is necessary first to protein concentration pipe Elution is concentrated within loading volume 2ml.(10kD, the 30kD and 50kD) type for being suitable for using protein isolate amount, such as Destination protein is 100kD, and 10kD, 30kD is finally used relatively to be suitble to；Concentration will affect using the lesser concentration tube of molecular weight Speed will lead to the loss of part destination protein if excessive, using 4 DEG C of centrifuges of low temperature, 3200-4000 turns/min carries out dense Contracting.

After sample is added in loading loop, loading and elution process, gel can be carried out automatically by setting program Filtration chromatography is separated according to the difference of the molecular weight of protein molecule, different chromatography column volume and different size column Material can generate different separating effects, in the common two kinds of specification (Hiload in laboratory^TM16/600Superdex^TM200pg and Superdex^TM200 10/300GL) chromatographic column in, Superdex^TM200 10/300GL are suitable for separating the egg of 20~600kD It is white；Hiload200 is suitable for largely separating and preparing the albumen that molecular weight is about 20~600kD, in separation 60-120kD size Protein when, Hiload200 is compared with Superdex^TM200 10/300GL effects are more preferable；It is shown by experimental result, FLS2 is extracellular Area's albumen is more suitable for being isolated and purified using Hiload200 (see Fig. 5).

Upper figure Hiload200 tomographic results can see the parabola that the elution peak shape of FLS2 albumen is standard in Fig. 5, Peak point is single, and peak point two sides are symmetrical, illustrates that FLS2 protein ingredient is single, purity is high；The following figure is the elution site to upper figure The SDS-PAGE testing result of FLS2 protein sample, the albumen in all swimming lanes is all single FLS2 albumen, have no it is any its Its foreign protein, and the protein concentration of final purification reaches 2.6mg/L, purity 95%.

Although above having used general explanation, specific embodiment and test, the present invention is made to retouch in detail It states, but on the basis of the present invention, it can be made some modifications or improvements, this is apparent to those skilled in the art 's.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, belong to claimed Range.

Sequence table

<110>China Agriculture Industitute Bee Research Center

<120>a kind of method of heterogenous expression FLS2 albumen

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 800

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 1

Met Lys Leu Leu Ser Lys Thr Phe Leu Ile Leu Thr Leu Thr Phe Phe

1 5 10 15

Phe Phe Gly Ile Ala Leu Ala Lys Gln Ser Phe Glu Pro Glu Ile Glu

20 25 30

Ala Leu Lys Ser Phe Lys Asn Gly Ile Ser Asn Asp Pro Leu Gly Val

35 40 45

Leu Ser Asp Trp Thr Ile Ile Gly Ser Leu Arg His Cys Asn Trp Thr

50 55 60

Gly Ile Thr Cys Asp Ser Thr Gly His Val Val Ser Val Ser Leu Leu

65 70 75 80

Glu Lys Gln Leu Glu Gly Val Leu Ser Pro Ala Ile Ala Asn Leu Thr

85 90 95

Tyr Leu Gln Val Leu Asp Leu Thr Ser Asn Ser Phe Thr Gly Lys Ile

100 105 110

Pro Ala Glu Ile Gly Lys Leu Thr Glu Leu Asn Gln Leu Ile Leu Tyr

115 120 125

Leu Asn Tyr Phe Ser Gly Ser Ile Pro Ser Gly Ile Trp Glu Leu Lys

130 135 140

Asn Ile Phe Tyr Leu Asp Leu Arg Asn Asn Leu Leu Ser Gly Asp Val

145 150 155 160

Pro Glu Glu Ile Cys Lys Thr Ser Ser Leu Val Leu Ile Gly Phe Asp

165 170 175

Tyr Asn Asn Leu Thr Gly Lys Ile Pro Glu Cys Leu Gly Asp Leu Val

180 185 190

His Leu Gln Met Phe Val Ala Ala Gly Asn His Leu Thr Gly Ser Ile

195 200 205

Pro Val Ser Ile Gly Thr Leu Ala Asn Leu Thr Asp Leu Asp Leu Ser

210 215 220

Gly Asn Gln Leu Thr Gly Lys Ile Pro Arg Asp Phe Gly Asn Leu Leu

225 230 235 240

Asn Leu Gln Ser Leu Val Leu Thr Glu Asn Leu Leu Glu Gly Asp Ile

245 250 255

Pro Ala Glu Ile Gly Asn Cys Ser Ser Leu Val Gln Leu Glu Leu Tyr

260 265 270

Asp Asn Gln Leu Thr Gly Lys Ile Pro Ala Glu Leu Gly Asn Leu Val

275 280 285

Gln Leu Gln Ala Leu Arg Ile Tyr Lys Asn Lys Leu Thr Ser Ser Ile

290 295 300

Pro Ser Ser Leu Phe Arg Leu Thr Gln Leu Thr His Leu Gly Leu Ser

305 310 315 320

Glu Asn His Leu Val Gly Pro Ile Ser Glu Glu Ile Gly Phe Leu Glu

325 330 335

Ser Leu Glu Val Leu Thr Leu His Ser Asn Asn Phe Thr Gly Glu Phe

340 345 350

Pro Gln Ser Ile Thr Asn Leu Arg Asn Leu Thr Val Leu Thr Val Gly

355 360 365

Phe Asn Asn Ile Ser Gly Glu Leu Pro Ala Asp Leu Gly Leu Leu Thr

370 375 380

Asn Leu Arg Asn Leu Ser Ala His Asp Asn Leu Leu Thr Gly Pro Ile

385 390 395 400

Pro Ser Ser Ile Ser Asn Cys Thr Gly Leu Lys Leu Leu Asp Leu Ser

405 410 415

His Asn Gln Met Thr Gly Glu Ile Pro Arg Gly Phe Gly Arg Met Asn

420 425 430

Leu Thr Phe Ile Ser Ile Gly Arg Asn His Phe Thr Gly Glu Ile Pro

435 440 445

Asp Asp Ile Phe Asn Cys Ser Asn Leu Glu Thr Leu Ser Val Ala Asp

450 455 460

Asn Asn Leu Thr Gly Thr Leu Lys Pro Leu Ile Gly Lys Leu Gln Lys

465 470 475 480

Leu Arg Ile Leu Gln Val Ser Tyr Asn Ser Leu Thr Gly Pro Ile Pro

485 490 495

Arg Glu Ile Gly Asn Leu Lys Asp Leu Asn Ile Leu Tyr Leu His Ser

500 505 510

Asn Gly Phe Thr Gly Arg Ile Pro Arg Glu Met Ser Asn Leu Thr Leu

515 520 525

Leu Gln Gly Leu Arg Met Tyr Ser Asn Asp Leu Glu Gly Pro Ile Pro

530 535 540

Glu Glu Met Phe Asp Met Lys Leu Leu Ser Val Leu Asp Leu Ser Asn

545 550 555 560

Asn Lys Phe Ser Gly Gln Ile Pro Ala Leu Phe Ser Lys Leu Glu Ser

565 570 575

Leu Thr Tyr Leu Ser Leu Gln Gly Asn Lys Phe Asn Gly Ser Ile Pro

580 585 590

Ala Ser Leu Lys Ser Leu Ser Leu Leu Asn Thr Phe Asp Ile Ser Asp

595 600 605

Asn Leu Leu Thr Gly Thr Ile Pro Gly Glu Leu Leu Ala Ser Leu Lys

610 615 620

Asn Met Gln Leu Tyr Leu Asn Phe Ser Asn Asn Leu Leu Thr Gly Thr

625 630 635 640

Ile Pro Lys Glu Leu Gly Lys Leu Glu Met Val Gln Glu Ile Asp Leu

645 650 655

Ser Asn Asn Leu Phe Ser Gly Ser Ile Pro Arg Ser Leu Gln Ala Cys

660 665 670

Lys Asn Val Phe Thr Leu Asp Phe Ser Gln Asn Asn Leu Ser Gly His

675 680 685

Ile Pro Asp Glu Val Phe Gln Gly Met Asp Met Ile Ile Ser Leu Asn

690 695 700

Leu Ser Arg Asn Ser Phe Ser Gly Glu Ile Pro Gln Ser Phe Gly Asn

705 710 715 720

Met Thr His Leu Val Ser Leu Asp Leu Ser Ser Asn Asn Leu Thr Gly

725 730 735

Glu Ile Pro Glu Ser Leu Ala Asn Leu Ser Thr Leu Lys His Leu Lys

740 745 750

Leu Ala Ser Asn Asn Leu Lys Gly His Val Pro Glu Ser Gly Val Phe

755 760 765

Lys Asn Ile Asn Ala Ser Asp Leu Met Gly Asn Thr Asp Leu Cys Gly

770 775 780

Ser Lys Lys Pro Leu Lys Pro Cys Thr Ile Lys Gln Lys Ser Ser His

785 790 795 800

<210> 2

<211> 2328

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

cagagctttg aaccagagat cgaagctttg aaatccttca agaatggtat ttccaacgac 60

cctttaggag tattatcaga ttggaccatc atcggttcgt tacgacactg taattggacc 120

ggaatcacct gcgatagtac cggacatgta gtctcggttt ccttgctgga gaagcaactt 180

gaaggtgttc tgtctccagc catagcgaat ctcacctatc tccaggttct tgatctcact 240

tcaaatagtt ttaccggcaa aataccggct gaaataggaa agttaaccga gcttaaccag 300

cttattctgt acctaaacta tttctctggt tcgattcctt ctggaatctg ggagcttaag 360

aatattttct atcttgatct tagaaataat ttgttgtccg gtgatgttcc tgaggaaatc 420

tgcaaaacca gttctttggt attgattggg tttgattaca acaacttaac cgggaaaata 480

ccagaatgct taggagattt ggttcatctc caaatgtttg tagcagctgg taaccattta 540

actggttcga ttccggtatc aattggtact ctggctaatt taacggattt agacctgagt 600

ggtaaccagt taaccggaaa aataccgaga gattttggaa atctcttgaa cttacagtct 660

ctcgttttaa ctgaaaactt gttggaagga gatataccag ctgagatcgg aaactgctcg 720

agcttggtcc aacttgagct ttacgataac cagttaaccg ggaaaatacc agctgaatta 780

gggaatttgg ttcagctgca agcactccgg atatacaaga acaaacttac ttcttcaatt 840

ccatcttcat tgttccggtt aactcagtta acccatttgg ggttatcaga aaaccatttg 900

gttggaccga tatcagaaga aatcggtttt cttgagtcac ttgaagtcct cacacttcat 960

tccaacaact tcacaggaga gtttccacag tccatcacaa acttgaggaa cttgacagtc 1020

ctaacggtgg ggttcaataa tatttccggt gagctcccgg cggatctagg gcttcttaca 1080

aaccttcgga acctttcagc gcacgacaat cttcttaccg gaccaatacc ttccagcata 1140

agtaactgca ccggtcttaa actcctggac ctgtctcaca accaaatgac tggcgagatc 1200

ccgcggggtt tcggaaggat gaatcttacg ttcatttcta ttgggaggaa tcatttcacc 1260

ggtgaaattc cagatgatat cttcaactgt tcaaacttgg aaactcttag tgtggcagat 1320

aacaacttaa caggaactct caagccatta attgggaagc ttcaaaaact caggattttg 1380

caagtttcat ataactctct cactggaccg attcctcgag aaatcgggaa tctgaaagat 1440

ttgaatatct tgtaccttca ctctaatggt ttcacaggga gaatcccgag agagatgtcg 1500

aatctcactc tcctccaggg gctaaggatg tattcaaatg atcttgaagg tccaattcct 1560

gaagaaatgt ttgatatgaa gctactctca gttcttgatc tttccaacaa caaattctca 1620

ggtcaaattc ctgccttgtt ctccaagctt gaatcgctta cctacttgag tcttcaagga 1680

aacaaattca acgggtctat ccctgcaagc cttaagtcgc tttcgcttct caacacattc 1740

gatatctccg acaatcttct cactggaacc atccctggag agctgttagc ttctttgaaa 1800

aacatgcagc tttacctcaa cttctcaaac aacttgttga ctggaaccat cccaaaggag 1860

cttggaaagc ttgaaatggt tcaagaaatc gacctttcaa acaatctctt ttctgggtct 1920

attccaagat ctttacaggc ctgcaaaaat gtgttcacac tggatttttc gcagaacaat 1980

ctctcgggtc atataccaga tgaagtcttc caaggcatgg atatgatcat aagcttgaac 2040

ctttcaagga acagtttctc tggagaaatc cctcagagct tcgggaacat gacgcatttg 2100

gtctccttgg atctctctag taacaatctc actggtgaaa ttccagagag tctcgccaat 2160

ctttcgactc tgaaacatct caaactagct tcaaacaacc tcaaaggcca tgttcctgaa 2220

tccggggtgt tcaaaaacat caacgcctct gatctaatgg gaaacacaga tctctgtggt 2280

agcaagaagc ctctcaagcc atgtacgatc aagcagaagt cgagccac 2328

<210> 3

<211> 60

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

atggcgttca agagtatagc agttttaagc gcctgcataa ttgtgggttc agcgcttccg 60

<210> 4

<211> 27

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

cgcggatcca tgaagttact ctcaaag 27

<210> 5

<211> 46

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

gacgtcgacc taatgatgat gatgatgatg gtggctcgac ttctgc 46

Claims

1. a kind of method of heterogenous expression FLS2 albumen, which is characterized in that comprising steps of

(2) clone obtains FLS2 exon genes, FLS2 exon genes is connected on the carrier of step (1), obtains external source table Up to carrier；

(3) heterogenous expression carrier transfection insect cell, obtains recombinant baculovirus, and virus infection insect cell cultivates the insect After cell, cell and supernatant are harvested, supernatant obtains the correct FLS2 albumen of conformation through chromatographing after purification.

2. the method according to claim 1, wherein the construction method of step (1) described carrier be pFastBac^TMHemolin signal peptide is added before 1 BamH1 restriction enzyme site and obtains pFastBac^TMHem carrier；The Hemolin The nucleotide sequence of signal peptide is as shown in SEQ ID NO.3.

3. the method according to claim 1, wherein the amino acid sequence of FLS2 albumen such as SEQ ID NO.1 institute Show.

4. the method according to claim 1, wherein the nucleotide sequence of FLS2 exon genes such as SEQ ID Shown in NO.2.

5. method according to claim 1 to 4, which is characterized in that the FLS2 exon genes of step (2) are connected into load BamH1 and Sal1 digestion FLS2 exon genes are used before body.

6. method according to claim 1 to 4, which is characterized in that in step (2), using BamH1 and Xho1 digestion Step (1) constructs obtained carrier, connect after digestion with FLS2 exon genes, constructs heterogenous expression carrier.

7. method according to claim 1 to 4, which is characterized in that the insect cell is Hi5 cell.

8. the FLS2 albumen that any the method for claim 1-7 is prepared.

9. a kind of heterogenous expression carrier for expressing FLS2 albumen, which is characterized in that before being connect on the carrier with target gene N-terminal The hemolin Hemolin signal peptide in one section of baculoviral source is added in end；Preferably carrier pFastBac^TMHem is In carrier pFastBac^TMHemolin signal peptide is added before 1 BamH1 restriction enzyme site to obtain, the core of the Hemolin signal peptide Nucleotide sequence is as shown in SEQ ID NO.3.

10. method as claimed in claim 1 to 7 or FLS2 albumen according to any one of claims 8 are as claimed in claim 9 outer Source expression vector can be with the small-molecule drug of activated plant immune response or development plants antimicrobial medicine or raising Genes For Plant Tolerance in screening Application in sick phenotype or raising plant products.