CN109355381A - For predicting the biomarker and method of PD1/L1 inhibitor curative effect - Google Patents
For predicting the biomarker and method of PD1/L1 inhibitor curative effect Download PDFInfo
- Publication number
- CN109355381A CN109355381A CN201811076262.0A CN201811076262A CN109355381A CN 109355381 A CN109355381 A CN 109355381A CN 201811076262 A CN201811076262 A CN 201811076262A CN 109355381 A CN109355381 A CN 109355381A
- Authority
- CN
- China
- Prior art keywords
- methylation
- value
- biomarker
- curative effect
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of methods for predicting the biomarker of PD1/L1 inhibitor curative effect, and the method includes (1) obtains methylation sites relevant to PD1/L1 inhibitor clinical efficacy；(2) the methylation Beta value for being directed to the methylation sites is obtained；(3) linear equation between the methylation sites Beta value and ORR is constructed using Lasso method；(4) the corresponding methylation sites of probe that methylate in the linear equation are the biomarker.The methylation sites relevant to PD1/L1 inhibitor clinical efficacy and corresponding methylation probe are preferably the methylation sites listed in table 2 and corresponding methylation probe.The invention also discloses for predicting that patient constructs prediction PD1/L1 inhibitor clinical efficacy model if appropriate for the methylation sites for receiving PD1/L1 immunotherapy, and with these methylation sites.The invention also discloses the kits and model equation that detect the methylation sites, present invention discover that biomarker relevant to PD1/L1 curative effect it is existing compared to market more accurate and reliable, and it detects simply, save the cost has a good application prospect.
Description
Technical field
The invention belongs to field of biotechnology, particularly relate to for predicting PD1/L1 inhibitor curative effect
Biomarker and method.
Background technique
Immunotherapy of tumors is one of the hot spot of tumor area research, it and traditional chemotherapy and drug targeting treatment are not
Together, mainly by overcoming the immunosupress of patient's body, the immunocyte of patient itself is reactivated to kill tumour, with
PD1/L1 inhibitor is that the immunotherapy of representative has been achieved for immense success.On June 15th, 2018, national drug supervision and management
Outstanding monoclonal antibody injection (English name: Nivolumab Injection) the import application for registration of military benefit is received in office's approval, for treating epidermis
Growth factor receptors (EGFR) gene mutation feminine gender and anaplastic lymphoma kinase (ALK) are negative, previously received platinum containing regimens
Progression of disease or not tolerable Locally Advanced or Metastatic Nsclc (NSCLC) adult patient after chemotherapy, this is to solution
Certainly the accessibility of China's tumor patient clinical application has positive effect.
But this immunotherapy is not particularly suited for everyone, only small number of patients can just benefit from it.In addition, immune
Therapy somewhat expensive, it is achieved that accurate immunization therapy, selective advantage, which benefits crowd, just seems most important.It closes currently on the market
In the biomarker (Biomarker) of immunotherapy mainly have Tumor mutations load (TMB), PD-L1 albumen expression, micro- defend
Star unstable (MSI) etc..On December 21st, 2017, Yarchoan et al. has delivered assessment tumour on New England's magazine
Mutational load (Tumor Mutation Burden, TMB) and objective remission rate (Objective Response Rate, ORR)
Between relationship research, discovery 55% different type tumour objective remission rate's difference can explain that TMB is higher, cancer with TMB
The objective remission rate of disease is higher, which has pushed application (Yarchoan, M., Hopkins, A., & of the TMB in immunotherapy
Jaffee,E.M.(2017).Tumor Mutational Burden and Response Rate to PD-1
Inhibition.The New England Journal of Medicine,377(25),2500-2501.)。
However, biomarker all existing defects of immunotherapy are controlled by taking TMB as an example although can predict to be immunized at present
The curative effect for the treatment of, but TMB detection is carried out using different platforms in clinical trial, the cost of detection and analysis is relatively high, and high
The cut-off value of TMB is also different.So find wide spectrum, accurate biomarker be immunotherapy the task of top priority.
DNA methylation is one of the hallmark events during tumor development extremely, and abnormal methylation abnormal " can be held
Open " or " closing " some genes function.Research shows that immune t-cell thoroughly exhaust it is related with DNA methylation process, therefore,
By analyzing DNA methylation data, it can be found that new biomarker relevant to immunotherapy.
Summary of the invention
DNA methylation data and corresponding cancer PD1/L1 objective remission rate number of the present inventor by analysis cancer patient
According to, it was found that for identify patient if appropriate for the methylation sites for receiving PD1/L1 immunotherapy, and with these methylate position
Point constructs prediction PD1/L1 inhibitor clinical efficacy model.
On the one hand, the present invention provides a kind of method for predicting the biomarker of PD1/L1 inhibitor curative effect,
The method includes,
(1) methylation sites relevant to PD1/L1 inhibitor clinical efficacy are obtained；
(2) the methylation Beta value for being directed to the methylation sites is obtained；
(3) linear equation between the methylation sites Beta value and ORR is constructed using Lasso method；
(4) the corresponding methylation sites of methylation probe involved in the linear equation are the biomarker.
In one embodiment, the methylation sites relevant to PD1/L1 inhibitor clinical efficacy and corresponding methyl
Changing probe is the methylation sites listed in table 2 and corresponding methylation probe.
In second aspect, the present invention also provides the biomarkers using first aspect present invention identification；The biology
Marker includes the site CpG chosen from the followings group:
1:31155158、1:55317188、1:236017325、3:141120919、5:156536107、8:97158052、
11:46299066 and 22:28073997；
6:31322298、6:30458998、6:41302149、9:91762376、3:172241975、10:123329113
And 2:236579007；
6:31322298、6:30458998、6:30459255、6:30460798、6:41302149、2:98330020、3:
172241975,10:123329113 and 2:236579007；
6:30459255、6:30460244、6:30460798、8:145018075、1:42384365、1:47900320、
11:46298946,11:46299066,11:46299168,1:969257,1:976172 and 1:976227；
6:30458998、6:30459255、6:30459317、8:145018010、8:145018075、1:42384056、
1:42384310、1:42384365、1:47900320、11:46298946、11:46299066、11:46299168、11:
46299204,1:969257 and 1:976172.
In the third aspect, the present invention provides a kind of for detecting the reagent of the biomarker of second aspect of the present invention
Box, the kit include:
(1) cover the probe sequence of biomarker of the invention, wherein the C in the site CpG of the biomarker
It remains unchanged or is replaced by T；Or
(2) primer pair of DNA methylation marker of the invention is detected, the primer pair amplifies contain the DNA methyl
One section of sequence for changing marker, wherein the C in the site CpG of the biomarker is remained unchanged or replaced by T.
In one embodiment, the probe sequence is SEQ ID NO.1-8.
In fourth aspect, the present invention provides a kind of method for identifying PD1/L1 inhibitor curative effect, the method packets
One chosen from the followings is included,
(1) it obtains and is selected from the site CpG 1:31155158,1:55317188,1:236017325,3 in individual:
141120919, the value of the methylation of 5:156536107,8:97158052,11:46299066 and 22:28073997；In advance
Survey curative effect y:
Y=-Ba×xa-Bb×xb-Bc×xc+Bd×xd-Be×xe-Bf×xf+Bg×xg-Bh×xh+A
Wherein, A indicates about 0.793, Ba-BhRespectively indicate about 0.0526, about 0.0269, about 0.711, about 0.263, about
0.00086, about 0.012, about 1.058, about 0.0603, xa-xhRespectively indicate the site CpG 1:31155158,1:55317188,1:
236017325, the methylation of 3:141120919,5:156536107,8:97158052,11:46299066 and 22:28073997
The value of degree；
(2) it obtains and is selected from the site CpG 1:31155158,1:55317188,1:236017325,3 in individual:
141120919, the value of the methylation of 5:156536107,8:97158052,11:46299066 and 22:28073997；In advance
Survey curative effect y:
Y=-Ba×xa-Bb×xb-Bc×xc-Bd×xd-Be×xe-Bf×xf+Bg×xg+A
Wherein, A indicates about 1.41, Ba-BgRespectively indicate about 0.472, about 0.3373, about 0.08073, about 0.10919, about
0.221, about 0.5256, about 0.033, xa-xgRespectively indicate the site CpG 1:31155158,1:55317188,1:236017325,
The value of the methylation of 3:141120919,5:156536107,8:97158052,11:46299066 and 22:28073997；
(3) obtain individual in selected from the site CpG 6:31322298,6:30458998,6:30459255,6:30460798,
The value of the methylation of 6:41302149,2:98330020,3:172241975,10:123329113 and 2:236579007；
Predict curative effect y:
Y=-Ba×xa-Bb×xb+Bc×xc+Bd×xd-Be×xe+Bf×xf-Bg×xg-Bh×xh+Bi×xi+A
Wherein, A indicates about 1.32, Ba-BiRespectively indicate about 0.707, about 0.519, about 0.282, about 0.249, about 0.145,
About 0.047, about 0.329, about 0.105, xa-xiRespectively indicate the site CpG 6:31322298,6:30458998,6:30459255,
The methyl of 6:30460798,6:41302149,2:98330020,3:172241975,10:123329113 and 2:236579007
The value of change degree；
(4) obtain individual in selected from the site CpG 6:30459255,6:30460244,6:30460798,8:145018075,
1:42384365,1:47900320,11:46298946,11:46299066,11:46299168,1:969257,1:976172 and
The value of the methylation of 1:976227；Predict curative effect y:
Y=Ba×xa+Bb×xb+Bc×xc-Bd×xd+Be×xe-Bf×xf-Bg×xg+Bh×xh-Bi×xi-Bj×xj+Bk
×xk+Bl×xl-A
Wherein, A indicates about 0.628, Ba-BlRespectively indicate about 0.215, about 0.314, about 0.115, about 0.926, about
0.306, about 0.183, about 0.059, about 3.483, about 0.263, about 0.0285, about 0.2317, about 0.267, xa-xlIt respectively indicates
The site CpG 6:30459255,6:30460244,6:30460798,8:145018075,1:42384365,1:47900320,11:
46298946, the value of the methylation of 11:46299066,11:46299168,1:969257,1:976172 and 1:976227；
(5) obtain individual in selected from the site CpG 6:30458998,6:30459255,6:30459317,8:145018010,
8:145018075,1:42384056,1:42384310,1:42384365,1:47900320,11:46298946,11:
46299066, the value of the methylation of 11:46299168,11:46299204,1:969257 and 1:976172；Predict curative effect
Y:
Y=-Ba×xa+Bb×xb+Bc×xc-Bd×xd-Be×xe+Bf×xf+Bg×xg+Bh×xh-Bi×xi-Bj×xj+Bk
×xk-Bl×xl+Bm×xm-Bn×xn+Bo×xo+Bp×xp-A
Wherein, A indicates about 1.04, Ba-BpRespectively indicate about 0.172, about 1.24, about 0.162, about 4.903, about 0.524,
About 0.582, about 0.0668, about 0.497, about 0.198, about 0.284, about 5.695, about 0.612, about 0.0759, about 0.0865, about
0.379, about 0.366, xa-xpRespectively indicate the site CpG 6:30458998,6:30459255,6:30459317,8:
145018010,8:145018075,1:42384056,1:42384310,1:42384365,1:47900320,11:
46298946, the methylation of 11:46299066,11:46299168,11:46299204,1:969257 and 1:976172
Value.
At the 5th aspect, the present invention also provides gene relevant to PD1/L1 inhibitor curative effect, such as DHCR24,
LYST, MIR1537, ZBTB38, HAVCR2, GDF6 and CREB3L1, the curative effect of the methylation levels of these genes with immunotherapy
It is closely bound up.Preferably, make in conjunction with these genes and the sequence of the site CpG 1:31155158 and the site CpG 22:28073997
With.
Present invention finds for identifying patient if appropriate for the methylation sites for receiving PD1/L1 immunotherapy, and with this
A little methylation sites construct prediction PD1/L1 inhibitor clinical efficacy model, this method have it is easy to detect, it is low in cost, high
The characteristics of flux, is suitble to promote.
Detailed description of the invention
By the following drawings, the present invention will be described:
Fig. 1 is experimental program flow chart of the invention.
Fig. 2 is the comparison of TMB model prediction ability in methylation model and document of the invention.
Fig. 3 is the ORR value of methylation model prediction of the invention compared with true ORR value.
Fig. 4 is the further comparison of TMB model prediction ability in methylation model and document of the invention.
Fig. 5 is the comparison of the TMB model prediction ability of methylation model and the building of TCGA data of the invention.
Specific embodiment
The invention discloses one kind based on methylation data authentication biology mark relevant to PD1/L1 inhibitor clinical efficacy
The method for remembering object utilizes the DNA methylation data and corresponding cancer PD1/L1 objective remission rate's data of cancer patient, it was found that use
In judging that patient constructs prediction if appropriate for the methylation sites for receiving PD1/L1 immunotherapy, and with these methylation sites
The model of the objective remission rate of PD1/L1 immunotherapy.Present invention discover that compared with the relevant biomarker of PD1/L1 curative effect
It is existing more accurate and reliable in market, and detection is simple, save the cost, has a good application prospect.
It is not intended to rigidly adhere in any theory, but it has been recognised by the inventors that the methylation in site affects immunotherapy related gene
Expression, therefore the active degree in these sites determines cancer patient if appropriate for receiving immunotherapy.Inventor passes through reality
Test data confirm that this point.
In the present invention, the site CpG with its genome coordinate representation.
In the present invention, Beta value is to measure the value (0-1) of site methylation, and Beta value is bigger, methylation
It is higher.The value of site methylation is the ratio of the measurement methylation in the site in vivo.For example, Beta value 0.75 is this
The site CpG 75% methylates.In the art, methylation is judged according to mass spectrum peak figure.For example, methylation can
To measure as follows: 1) extract DNA sample, 2) sulphite processing carried out to the DNA sample, 3) with of the invention
The sample of the processing of sulphite described in primer pair amplifies, obtains amplified production, and 4) amplified production is digested (such as adopt
With SAP enzyme), 5) to the postdigestive amplified production carry out transcription and digestion, 6) using mass spectrometry method to the transcription and enzyme
It cuts product to be detected, obtains the methylation status of DNA methylation marker of the invention in sample sequence.Preferably, in step
5) rapid include purification step afterwards, purify to the transcription and digestion products.Preferably, the mass spectrometry method is flight mass spectrum
Method, such as from Sequenom company.In the present invention, due to the CpG of methylation after sulphite is handled C will become
U, so being remained unchanged using the C in the site CpG wherein of the invention or by the hybridisation events of the T two kinds of probe sequences replaced
It can be concluded that the methylation status in the site CpG.
In the present invention, about refer to up and down the 10% of basic value, for example, about 0.793 refers to and sums it up on the basis of 0.793
Subtract 0.0793.
In the present invention, Gene Name is all made of the name of the official in NCBI-Gene (Official Symbol).
Cg17484237 is probe number, its corresponding methylation value can be obtained from database, or carry out relevant calculating,
The coordinate id in the corresponding site CpG is the position in probe in genome.The meaning of other probes number follows same rule
(seeing below literary table 2).Access id is number (see below literary table 3) of the access in KEGG database.
It is listed below each probe in model described in this patent Part III and numbers the corresponding site CpG in the genome
Position (chromosome number: position) and probe sequence:
cg03749154(SEQ ID NO.1)1:31155158
AGCTCACTCTAATTAATATCTGCAGTATCTCATCTAGGAGGTGGGTTTCG
cg16051114(SEQ ID NO.2)1:55317188
CGGAGTGCCCTGTGTTCCTGGAGAAGGCATTCCAGGGTTGAATCTTGTCC
cg04144714(SEQ ID NO.3)1:236017325
CGGGGAGATGATTTACCTGGATGAACCTTCATAGTTCCTTTAAATGCCGT
cg20395773(SEQ ID NO.4)3:141120919
TGACAGTCACCAGGCTCTGTGGCCCAGAGTCCTAACTGCGTTGTCCTTCG
cg17484237(SEQ ID NO.5)5:156536107
CTGGGTACTTCTTCCAACTGTCTACTCCACAATCACATGAGCAGTAGCCG
cg15006881(SEQ ID NO.6)8:97158052
GGGAAACGCGGCCCAGGCTTGAGACCACAAAGGGCACATTAGTGGTTACG
cg24644201(SEQ ID NO.7)11:46299066
GTGGCTCGAGGAATCCTCTCTCCTTTTTTAAAGAGACATCTGCAACTTCG
cg13038847(SEQ ID NO.8)22:28073997
GGGTAATCTGTGAGTAAATCACTGTAAACCAGCAGGCAAGTGTTTGCACG。
Design of primers of the invention can be carried out by conventional method in this field, for a methylation sites, such as often
Advise primer-design software design primer before and after it.For example, design of primers principle: length 15-30bp, effective length [Ln=2
(G+C)+(A+T)] 38 are generally no greater than, otherwise the most suitable elongating temperature of PCR can be more than the best use temperature (74 of Taq enzyme
Degree), to reduce the specificity of product；For G/C content between 45% one 55%, the renaturation temperature in PCR amplification is usually lower
The Tm value of Tm value primer subtracts 5-10 degrees Celsius；When primer length is less than 20, Tm is constantly equal to 4 × (G+C)+2 × (A+T)；Alkali
The continuous single base for occurring 4 or more should be avoided in the randomness of base distribution, especially should not occur more than 3 at its 3 ' end
Continuous G or C, otherwise can make primer G+C enriched sequence area's mistake cause；Primer itself cannot contain self-complementary sequences,
Otherwise it will form hair clip sample secondary structure；Should not there are complementation or the homologous base more than 4 between two primers, not so will form
The complementary overhangs at 3 ' ends should be avoided in primer dimer especially.
The present invention identifies biomarker relevant to PD1/L1 inhibitor clinical efficacy from DNA methylation data,
Experimental program is as shown in fig. 1.
One, the collection of data
Cancer types in TCGA database are corresponded into the cancer types that Yarchoan et al. is mentioned in the literature,
Inventor obtains the intersection of 18 kinds of cancer types.The 450K methylation chip data of 18 kinds of cancer patients is downloaded in TCGA, and
Collect objective remission rate's (table 1) of the PD1/L1 inhibitor of corresponding cancer.
The statistics of ORR value in 1 TCGA cancer sample size of table and document
Two, it screens and the significant relevant methylation sites of PD1/L1 inhibitor clinical efficacy
For each cancer, average Beta value of each probe (~48 ten thousand) in all tumor samples is calculated, then
In 18 kinds of cancers calculate probe average Beta value and ORR value between correlation, with spearman abs (rho) >=
0.7&P≤0.01 is screening conditions, obtains 269 probes relevant to PD-1/PD-L1 inhibitor significant curative effect, corresponding altogether
191 genes, corresponding methylation sites are shown in table 2.
Table 2 and the significant relevant site of PD1/L1 inhibitor clinical efficacy
For the reliability of preliminary identification result, KEGG access enrichment analysis (table 3) is carried out to said gene.These genes
Can with significant enrichment some and immune-related dredging collateral: allograft rejection (Allograft rejection), transplanting
(Antigen processing and is offered in the anti-host disease of object (Graft-versus-host disease), antigen processing
Presentation) etc., illustrate that the probe that the above method screens is relevant to immunotherapy on biological significance.
The enrichment analysis of 3 gene pathway of table
Then, inventor has counted gene pairs and has answered the quantity of probe, and checks number of probes in the gene function of several former
(table 4).The corresponding number of probes of gene is more, which may be more related to immunotherapeutic, becomes PD-1/PD-L1 inhibitor
A possibility that clinical efficacy relevant biomarker, is bigger.By taking HLA-E gene as an example, it NK it is cell-mediated naturally exempt from
Epidemic disease, CD8+T cell-mediated acquired immunity kind play a significant role.2016 are published in Clinical Cancer Research
On a paper disclose in intrahepatic cholangiocarcinoma, HLA class antigen presentation can be used to select to be suitble to receive PD1/L1 immune
The patient of therapy, this be to the strong support of this result of study reliability (Sabbatino, F., Villani, V., Yearley,
J.H.,Deshpande,V.,Cai,L.,Konstantinidis,I.T.,...&Ferrone,C.R.(2016).PD-L1 and
HLA Class I Antigen Expression and Clinical Course of the Disease in
Intrahepatic Cholangiocarcinoma.Clinical Cancer Research,22(2),470-478.)。
The forward gene function information of the corresponding number of probes of table 4
Three, based on methylation sites building prediction PD1/L1 inhibitor clinical efficacy model
In order to quantify the ability of methylation sites prediction PD1/L1 immunotherapy curative effect (ORR), identified according to above-mentioned steps
Out to the significant relevant probe of PD1/L1 inhibitor clinical efficacy, using Lasso method construct methylation probe and ORR between
Linear equation.Wherein, methylation probe value is predictive variable, and ORR value is response variable.
Lasso algorithm is to be put forward for the first time by Robert Tibshirani in 1996, and this method is a kind of Shrinkage estimation.
Its basic thought is to make residual sum of squares (RSS) minimum in the case where the sum of absolute value of regression coefficient is less than the constraint condition of a constant,
To compressing some coefficients, the regression coefficient for setting certain independents variable is 0, achievees the purpose that compression variable, to obtain to solve
The model released.
For general linear regression model (LRM):
Y=A+B1x1+B2x2+…+BPxp+∈
The lasso of constant term and regression coefficient estimation are as follows:
In this research, the input variable of model is y and x, model it needs to be determined that output variable be regression coefficient B and constant
Item A.Wherein, y represents the objective remission rate that 18 kinds of cancers use PD1/L1 immunotherapy, i.e. ORR value, inputs as 18 rows × 1 column
The matrix of size, every a line represent a kind of ORR value of cancer；X represent in the 18 kinds of cancers identified in step 2 with PD1/L1
The Beta value of significant relevant 269 probes of inhibitor clinical efficacy, input are that size is that 18 rows × 269 column matrix (is shown in Table
5), every a line is corresponded with 18 kinds of cancers in y vector, and each column indicate one and the significant phase of PD1/L1 inhibitor clinical efficacy
The Beta value of the probe of pass；B is regression coefficient, and A is constant term, be model it needs to be determined that amount；∈ is error term, closer to
Zero then illustrates that the prediction effect of model is more accurate；λ is a non-negative adjustment parameter, can control the degree of compression.λ value
The cross-validation method (cross validated, CV) that can use Efron and Tibshirani in proposition in 1993 is determined to estimate
Meter.In our current research, equation model is carried out using the lasso function in MATLAB, CV is set as the operation order of 10, MATLAB
Are as follows: lasso (x, y, ' CV ', 10).
It is true according to the output variable mean square error (Mean Square Error, MSE) of MATLAB after running mentioned order
Determine the value of regression coefficient B Yu constant term A.When mean square error minimum (MSE=0.0042), there is the coefficient B of 8 methylation probes
Nonzero value, respectively cg03749154 (CpG site 1:31155158), cg16051114 (site CpG 1:55317188, it is right
Answer gene are as follows: DHCR24), cg04144714 (site CpG 1:236017325, corresponding gene are as follows: LYST and MIR1537),
Cg20395773 (site CpG 3:141120919, corresponding gene are as follows: ZBTB38), cg17484237 (site CpG 5:
156536107, corresponding gene are as follows: HAVCR2), cg15006881 (site CpG 8:97158052, corresponding gene are as follows: GDF6),
Cg24644201 (site CpG 11:46299066, corresponding gene are as follows: CREB3L1) and cg13038847 (site CpG 22:
28073997) equation, obtained according to the regression coefficient B of different probe and constant term A are as follows:
ORR=-0.0526 × xa-0.0269×xb-0.711×xc+0.263×xd-0.00086×xe-0.012×xf+
1.058×xg-0.0603×xh+0.793
Wherein, xa-xhRespectively indicate cg03749154, cg16051114, cg04144714, cg20395773,
The Beta value of cg17484237, cg15006881, cg24644201 and cg13038847.
So far, predict that the model construction of PD1/L1 inhibitor clinical efficacy is completed.As long as by the Beta value of above-mentioned 8 probes
It brings equation into, the objective effective percentage that this cancer uses PD1/L1 inhibitor can be predicted.
The format of the modeling of table 5 input data y and x variable
Four, the assessment of model is compared with
For the predictive ability of evaluation model, this research is pre- using leaving-one method (Leave one out, LOO) progress model
Survey the assessment of performance." leaving-one method " crosscheck refers to that 1 sample for rejecting total sample from modeling sample every time does test set,
Training set modeling is done with remaining sample, to predict the process of test set, total number of samples is recycled, a cross validation can be obtained
Predicted value afterwards, for the quality of evaluation model performance.In this model, when constructing equation every time, retain a kind of cancer conduct
Test, therefore available 18 models can be calculated the ORR value of 18 cancers according to this 18 models, and in document
The model of the TMB prediction of Yarchoan et al. building is compared, and the appraisal procedure that inventor uses is ROC curve.ROC
(Receive Operating Characteristic) curve is that (cut off value is determined according to a series of two different mode classifications
Determine threshold), with true positive rate (sensitivity) for ordinate, false positive rate (1- specificity) is the curve that abscissa is drawn.AUC
(Area under curve of roc) indicates area under ROC curve, and the value of AUC is bigger, illustrates that category of model performance is better.
Two classifying and dividings are carried out to PD1/L1 curative effect with the intermediate value of 18 kinds of true ORR of cancer, wherein being classified as 1 greater than intermediate value
Class is classified as 0 class less than intermediate value, then compares the prediction result of TMB model in methylation model and document.It can from Fig. 2
Out, compared to the prediction result of TMB in document, the ORR value with the model prediction of methylation probe building is more accurate.
The result of cross validation confirms the reliability of model, therefore inventor uses the side constructed before with all data
Journey predicts ORR value, and the gap (Fig. 3) between comparison prediction result and true value.From figure 3, it can be seen that in addition to cancer of pancreas,
Melanoma and clear-cell carcinoma, the result for the model prediction that methylates is all very accurate, and absolute error all controls within 0.05, this
Outside, the spearman correlation of the ORR value of 18 kinds of cancers of prediction equation and true ORR value is 0.93.In order to better illustrate
With the performance of methylation probe prediction ORR value, inventor uses 1 probe, 2 probe building equations again, predicts with TMB
The model of ORR value is compared.It to be got well it can be seen from ROC curve with the accuracy of the prediction equation of methylation probe building
In with TMB predict as a result, and with probe prediction as a result, being just better than TMB (Fig. 4).
Since the TMB sample and present invention modeling methylation data sample used that model used in document do not have very well
Corresponding relationship, in order to guarantee the consistency of data source, inventor has downloaded the MAF file of 18 kinds of cancers and has been counted from TCGA
Its TMB is calculated, and again using ORR value as relevant variable, equation is constructed in the way of document, and then can more accurately evaluate
The superiority and inferiority of two kinds of data models.The equation of the TMB and ORR that recalculate are as follows: ORR=0.0384*ln (TMB)+0.0934.Methyl
The AUC of change model is that the AUC of 0.92, TMB model is 0.68, it follows that the present invention is based on the PD1/ of methylation data building
The predictive equation of L1 immunotherapy curative effect is accurate, and is better than TMB model (Fig. 5).
Five, the robustness verifying of model
In order to verify the robustness of model, inventor has downloaded prostate cancer and non-small thin from TCGA and GEO database
Then the 450K methylation data of born of the same parents' lung cancer bring the average probe value of its tumor sample in equation into as independent data sets,
The ORR value predicted.As can be seen from Table 6, it is concentrated in two independent datas, the result for the model prediction that methylates is also very quasi-
Really.
The verifying of the methylation of table 6 model in a separate data set
Five, the methylation model of ORR value is more predicted
In order to find more to predict the methylation model of ORR, inventor is to the probe collection in immune pathway, and enrichment
The corresponding probe collection of the more gene of probe establishes lasso model respectively, predicts ORR.Relevant immune pathway are as follows: natural
Kill cell-mediated cytotoxicity, allograft rejection, graft versus host disease(GVH disease), antigen processing offer, phagosome, from
Body autoimmune thyroid disease, endocytosis.It is enriched with the gene of probe relatively more (number of probes is greater than 3) are as follows: HLA-E, PLEC,
HIVEP3、FOXD2-AS1、FOXD2、CREB3L1、AGRN。
For the probe being immunized in related pathways, the present inventor establishes two lasso models.
Equation 1 are as follows:
The equation that regression coefficient B and constant term A are obtained are as follows:
ORR=-0.47209 × xa-0.33734×xb-0.08073×xc-0.10919×xd-0.22108×xe-
0.52563×xf+0.033014×xg+1.4102
Wherein, xa-xgRespectively indicate cg15340334 (6:31322298；Corresponding gene are as follows: GDF6), cg25786265 (6:
30458998；Corresponding gene are as follows: HLA-E), cg25663770 (6:41302149；Corresponding gene are as follows: NCR2), cg13614383
(9:91762376；Corresponding gene are as follows: SHC3), cg22572614 (3:172241975；Corresponding gene are as follows: TNFSF10),
Cg16499947 (10:123329113；Corresponding gene are as follows: FGFR2), cg27076454 (2:236579007；Corresponding gene are as follows:
AGAP1 Beta value).The spearman correlation of the ORR value of 18 kinds of cancers of prediction equation and true ORR value is 0.95, is said
The bright model prediction it is very accurate.
Equation 2 are as follows:
The equation that regression coefficient B and constant term A are obtained are as follows:
ORR=-0.70668 × xa-0.51916×xb+0.282115×xc+0.249494×xd-0.14527×xe+
0.047318×xf-0.32871×xg-0.62127×xh+0.104683×xi+1.3217
Wherein, xa-xiRespectively indicate cg15340334 (6:31322298；Corresponding gene are as follows: HLA-B), cg25786265
(6:30458998；Corresponding gene are as follows: HLA-E), cg02188225 (6:30459255；Corresponding gene are as follows: HLA-E),
Cg11019014 (6:30460798；Corresponding gene are as follows: HLA-E), cg25663770 (6:41302149；Corresponding gene are as follows:
NCR2), cg12332902 (2:98330020；Corresponding gene are as follows: ZAP70), cg22572614 (3:172241975；Corresponding gene
Are as follows: TNFSF10), cg16499947 (10:123329113；Corresponding gene are as follows: FGFR2), cg27076454 (2:236579007；
Corresponding gene are as follows: AGAP1) Beta value.The ORR value of 18 kinds of cancers of prediction equation is related to the spearman of true ORR value
Property be 0.99, illustrate the very accurate of the model prediction.
The two corresponding probe sequences of model middle probe:
Probe collection corresponding for the enrichment more gene of probe, this patent also establish two lasso models.
Equation 1 are as follows:
ORR=0.214688 × xa+0.31447×xb+0.115163×xc-0.92569×xd+0.306455×xe-
0.18316×xf-0.05886×xg+3.48276×xh-0.26271×xi-0.02852×xj+0.23169×xk+
0.267466×xl-0.628
Wherein, xa-xlRespectively indicate cg02188225 (6:30459255；Corresponding gene are as follows: HLA-E), cg20105257
(6:30460244；Corresponding gene are as follows: HLA-E), cg11019014 (6:30460798；Corresponding gene are as follows: HLA-E),
Cg21550172 (8:145018075；Corresponding gene are as follows: PLEC), cg25607920 (1:42384365；Corresponding gene are as follows:
HIVEP3), cg03440588 (1:47900320；Corresponding gene are as follows: FOXD2), cg12256550 (11:46298946；Corresponding base
Cause are as follows: CREB3L1), cg24644201 (11:46299066, corresponding gene are as follows: CREB3L1), cg20981182 (11:
46299168；Corresponding gene are as follows: CREB3L1), cg09248054 (1:969257；Corresponding gene are as follows: AGRN), cg23625715
(1:976172；Corresponding gene are as follows: AGRN), cg26222311 (1:976227；Corresponding gene are as follows: AGRN) Beta value.Equation
The spearman correlation of the ORR value of 18 kinds of cancers of prediction and true ORR value is 0.90, illustrates that the ratio of model prediction is calibrated
Really.
Equation 2 are as follows:
ORR=-0.17245 × xa+1.240157×xb+0.162432×xc-4.90301×xd-0.52385×xe+
0.581755×xf+0.066752×xg+0.497098×xh-0.19837×xi-0.28404×xj+5.695274×xk-
0.61164×xl+0.075923×xm-0.08652×xn+0.378791×xo+0.365833×xp-1.0409
Wherein, xa-xpRespectively indicate cg25786265 (6:30458998；Corresponding gene are as follows: HLA-E), cg02188225
(6:30459255；Corresponding gene are as follows: HLA-E), cg04907849 (6:30459317；Corresponding gene are as follows: HLA-E),
Cg20154947 (8:145018010；Corresponding gene are as follows: PLEC), cg21550172 (8:145018075；Corresponding gene are as follows:
PLEC), cg16685388 (1:42384056；Corresponding gene are as follows: HIVEP3), cg23762517 (1:42384310；Corresponding gene
Are as follows: HIVEP3), cg25607920 (1:42384365；Corresponding gene are as follows: HIVEP3), cg03440588 (1:47900320；It is right
Answer gene are as follows: FOXD2), cg12256550 (11:46298946；Corresponding gene are as follows: CREB3L1), cg24644201 (11:
46299066, corresponding gene are as follows: CREB3L1), cg20981182 (11:46299168；Corresponding gene are as follows: CREB3L1),
cg25626312(11:46299204；Corresponding gene are as follows: CREB3L1), cg09248054 (1:969257；Corresponding gene are as follows:
AGRN),cg23625715(1:976172；Corresponding gene are as follows: AGRN), cg26222311 (1:976227；Corresponding gene are as follows:
AGRN Beta value).The spearman correlation of the ORR value of 18 kinds of cancers of prediction equation and true ORR value is 0.95, explanation
The model prediction it is very accurate.
The two corresponding probe sequences of model middle probe:
Sequence table
<110>Shenzhen's space science and technology Southern Res Inst
<120>for predicting the biomarker and method of PD1/L1 inhibitor curative effect
<130> CF180466S
<160> 33
<170> SIPOSequenceListing 1.0
<210> 1
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 1
agctcactct aattaatatc tgcagtatct catctaggag gtgggtttcg 50
<210> 2
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 2
cggagtgccc tgtgttcctg gagaaggcat tccagggttg aatcttgtcc 50
<210> 3
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 3
cggggagatg atttacctgg atgaaccttc atagttcctt taaatgccgt 50
<210> 4
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 4
tgacagtcac caggctctgt ggcccagagt cctaactgcg ttgtccttcg 50
<210> 5
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 5
ctgggtactt cttccaactg tctactccac aatcacatga gcagtagccg 50
<210> 6
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 6
gggaaacgcg gcccaggctt gagaccacaa agggcacatt agtggttacg 50
<210> 7
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 7
gtggctcgag gaatcctctc tcctttttta aagagacatc tgcaacttcg 50
<210> 8
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 8
gggtaatctg tgagtaaatc actgtaaacc agcaggcaag tgtttgcacg 50
<210> 9
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 9
tctcaccttt tcaagctgtg agagacacat cagagccctg ggcactgtcg 50
<210> 10
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 10
gtcctgggta tggccctccc catcctgctg ccaggtcagt gtgatctccg 50
<210> 11
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 11
aggtcatgtc tcttctcagg gaaagcggga gcccttctgg agcccttccg 50
<210> 12
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 12
tccttccctg ttctcttttc tattaaaaat aagaacctgg gcagagtgcg 50
<210> 13
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 13
cggtctggag ccttccggct ggtctggttg aaatgcgacc cacagacatg 50
<210> 14
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 14
ctttgtgact ttgatgtaaa catcaaacac agcccccttt cctgtcttcg 50
<210> 15
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 15
cgcatatgca gaaatggaag gggcacaatg ttgctgaaaa ttcagtttgg 50
<210> 16
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 16
aaaaaacatg tggatgtttt ccaaaatatt aaccccatca caatgtctcg 50
<210> 17
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 17
cgtcaagtca tcttaactgt ccattgagat gggactcctg taaaatcact 50
<210> 18
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 18
gttccagctg cccggtgctg cgggtgcgga aggtgcggaa atcccaagcg 50
<210> 19
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 19
aaccaggcca gcaatgatgc ccacgatggg gatggtgggc tgggaagccg 50
<210> 20
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 20
gctactctaa ggctgagtgt aagtgcgggg cgggagcgtg gaggagctcg 50
<210> 21
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 21
cgtgacccac aaccaccagg gagggaaaca ggctgcccga gggctccata 50
<210> 22
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 22
caggcaaaaa cacaatcaca aggtaaaata cagcgcaagg aatccatccg 50
<210> 23
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 23
cggaatagcc atgtacattg aagcaccaaa ctaggcagct ggataatggg 50
<210> 24
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 24
cggctggttg tgagcatgct cgcgccggga acagatccac cctctgttat 50
<210> 25
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 25
tatttcgttt tctttgcttc ttctgtgacc cttacttctt tcgcctaccg 50
<210> 26
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 26
cgggacagtg gttggtgaag ccttaaaatg ccaatgttcc aggaacactg 50
<210> 27
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 27
gtggctcgag gaatcctctc tcctttttta aagagacatc tgcaacttcg 50
<210> 28
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 28
tctctgtgaa accgggaacc cctggctggc tagcccagct ggccaaggcg 50
<210> 29
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 29
cgggaacccc tggctggcta gcccagctgg ccaaggcgcc acgcccccac 50
<210> 30
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 30
ggcgtccgcg gggagttcca gaggatcggg cggatgcgga cgggagagcg 50
<210> 31
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 31
caagaagagc ccgtgcccca gcgtggtggc gcctgtgtgt gggtcggacg 50
<210> 32
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 32
acctacagca acgaatgcga gctgcagcgg gcgcagtgca gccagcagcg 50
<210> 33
<211> 50
<212> DNA
<213>people (Homo sapiens)
<400> 33
tgtctagcct ggagcagccg gttcccagcg caggaagggc agccctggcg 50
Claims (6)
1. a kind of method for predicting the biomarker of PD1/L1 inhibitor curative effect, the method includes,
(1) methylation sites relevant to PD1/L1 inhibitor clinical efficacy are obtained；
(2) the methylation Beta value for being directed to the methylation sites is obtained；
(3) linear equation between the methylation sites Beta value and ORR is constructed using Lasso method；
(4) the corresponding methylation sites of methylation probe involved in the linear equation are the biomarker.
2. according to the method described in claim 1, the methylation sites relevant to PD1/L1 inhibitor clinical efficacy and phase
The probe that should methylate is the methylation sites listed in table 2 and corresponding methylation probe.
3. the biomarker includes CpG chosen from the followings for predicting the biomarker of PD1/L1 inhibitor curative effect
Point group (coordinate of the site in genome):
(1)1:31155158、1:55317188、1:236017325、3:141120919、5:156536107、8:97158052、
11:46299066 and 22:28073997；
(2) 6:31322298,6:30458998,6:41302149,9:91762376,3:172241975,10:123329113 and
2:236579007；
(3)6:31322298、6:30458998、6:30459255、6:30460798、6:41302149、2:98330020、3:
172241975,10:123329113 and 2:236579007；
(4)6:30459255、6:30460244、6:30460798、8:145018075、1:42384365、1:47900320、11:
46298946,11:46299066,11:46299168,1:969257,1:976172 and 1:976227；
(5)6:30458998、6:30459255、6:30459317、8:145018010、8:145018075、1:42384056、1:
42384310、1:42384365、1:47900320、11:46298946、11:46299066、11:46299168、11:
46299204,1:969257 and 1:976172.
4. a kind of for detecting the kit of the biomarker of claim 3, the kit includes:
(1) cover the probe sequence of biomarker of the invention, wherein the C in the site CpG of the biomarker is kept
It is constant or replaced by T；Or
(2) primer pair of DNA methylation marker of the invention is detected, the primer pair amplifies contain the DNA methylation mark
One section of sequence of will object, wherein the C in the site CpG of the biomarker is remained unchanged or replaced by T.
5. kit according to claim 4, the probe sequence is SEQ ID NO.1-8.
6. a kind of method for identifying PD1/L1 inhibitor curative effect, the method includes any one of following,
(1) it obtains and is selected from the site CpG 1:31155158,1:55317188,1:236017325,3:141120919,5 in individual:
156536107, the value of the methylation of 8:97158052,11:46299066 and 22:28073997；Predict curative effect y:
Y=-Ba×xa-Bb×xb-Bc×xc+Bd×xd-Be×xe-Bf×xf+Bg×xg-Bh×xh
+A
Wherein, A indicates about 0.793, Ba-BhRespectively indicate about 0.0526, about 0.0269, about 0.711, about 0.263, about
0.00086, about 0.012, about 1.058, about 0.0603, xa-xhRespectively indicate the site CpG 1:31155158,1:55317188,1:
236017325, the methylation of 3:141120919,5:156536107,8:97158052,11:46299066 and 22:28073997
The value of degree；
(2) it obtains and is selected from the site CpG 1:31155158,1:55317188,1:236017325,3:141120919,5 in individual:
156536107, the value of the methylation of 8:97158052,11:46299066 and 22:28073997；Predict curative effect y:
Y=-Ba×xa-Bb×xb-Bc×xc-Bd×xd-Be×xe-Bf×xf+Bg×xg+A
Wherein, A indicates about 1.41, Ba-BgRespectively indicate about 0.472, about 0.3373, about 0.08073, about 0.10919, about
0.221, about 0.5256, about 0.033, xa-xgRespectively indicate the site CpG 1:31155158,1:55317188,1:236017325,
The value of the methylation of 3:141120919,5:156536107,8:97158052,11:46299066 and 22:28073997；
(3) it obtains and is selected from the site CpG 6:31322298,6:30458998,6:30459255,6:30460798,6 in individual:
41302149, the value of the methylation of 2:98330020,3:172241975,10:123329113 and 2:236579007；In advance
Survey curative effect y:
Y=-Ba×xa-Bb×xb+Bc×xc+Bd×xd-Be×xe+Bf×xf-Bg×xg-Bh×xh
+Bi×xi+A
Wherein, A indicates about 1.32, Ba-BiRespectively indicate about 0.707, about 0.519, about 0.282, about 0.249, about 0.145, about
0.047, about 0.329, about 0.105, xa-xiRespectively indicate the site CpG 6:31322298,6:30458998,6:30459255,6:
30460798, the methylation of 6:41302149,2:98330020,3:172241975,10:123329113 and 2:236579007
The value of degree；
(4) it obtains and is selected from the site CpG 6:30459255,6:30460244,6:30460798,8:145018075,1 in individual:
42384365,1:47900320,11:46298946,11:46299066,11:46299168,1:969257,1:976172 and 1:
The value of 976227 methylation；Predict curative effect y:
Y=Ba×xa+Bb×xb+Bc×xc-Bd×xd+Be×xe-Bf×xf-Bg×xg+Bh×xh-Bi
×xi-Bj×xj+Bk×xk+Bl×xl-A
Wherein, A indicates about 0.628, Ba-BlRespectively indicate about 0.215, about 0.314, about 0.115, about 0.926, about 0.306, about
0.183, about 0.059, about 3.483, about 0.263, about 0.0285, about 0.2317, about 0.267, xa-xlRespectively indicate the site CpG 6:
30459255、6:30460244、6:30460798、8:145018075、
1:42384365、1:47900320、11:46298946、11:46299066、11:46299168、1:969257、1:
The value of the methylation of 976172 and 1:976227；
(5) it obtains and is selected from the site CpG 6:30458998,6:30459255,6:30459317,8:145018010,8 in individual:
145018075、1:42384056、1:42384310、1:42384365、1:47900320、11:46298946、
The value of the methylation of 11:46299066,11:46299168,11:46299204,1:969257 and 1:976172；In advance
Survey curative effect y:
Y=-Ba×xa+Bb×xb+Bc×xc-Bd×xd-Be×xe+Bf×xf+Bg×xg+Bh×xh
-Bi×xi-Bj×xj+Bk×xk-Bl×xl+Bm×xm-Bn×xn+Bo×xo
+Bp×xp-A
Wherein, A indicates about 1.04, Ba-BpRespectively indicate about 0.172, about 1.24, about 0.162, about 4.903, about 0.524, about
0.582, about 0.0668, about 0.497, about 0.198, about 0.284, about 5.695, about 0.612, about 0.0759, about 0.0865, about
0.379, about 0.366, xa-xpRespectively indicate the site CpG 6:30458998,6:30459255,6:30459317,8:
145018010、8:145018075、1:42384056、1:42384310、1:42384365、1:47900320、11:
46298946, the methylation of 11:46299066,11:46299168,11:46299204,1:969257 and 1:976172
Value.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811076262.0A CN109355381A (en) | 2018-09-14 | 2018-09-14 | For predicting the biomarker and method of PD1/L1 inhibitor curative effect |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811076262.0A CN109355381A (en) | 2018-09-14 | 2018-09-14 | For predicting the biomarker and method of PD1/L1 inhibitor curative effect |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109355381A true CN109355381A (en) | 2019-02-19 |
Family
ID=65350750
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811076262.0A Pending CN109355381A (en) | 2018-09-14 | 2018-09-14 | For predicting the biomarker and method of PD1/L1 inhibitor curative effect |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109355381A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112813155A (en) * | 2021-01-20 | 2021-05-18 | 武汉大学 | DNA methylation marker for predicting therapeutic effect of antipsychotic drug, screening method and application |
| WO2022141775A1 (en) * | 2021-01-04 | 2022-07-07 | 江苏先声医疗器械有限公司 | Construction method for tumor immune checkpoint inhibitor therapy effectiveness evaluation model based on dna methylation spectrum |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106947830A (en) * | 2017-05-16 | 2017-07-14 | 中山大学肿瘤防治中心 | Gene methylation panel for diagnosing, predicting therapeutic efficacy for hepatic carcinoma and prognosis |
| WO2017193080A1 (en) * | 2016-05-05 | 2017-11-09 | Nantomics, Llc | Checkpoint failure and methods therefor |
| CN108064170A (en) * | 2015-05-29 | 2018-05-22 | 豪夫迈·罗氏有限公司 | PD-L1 promoter methylations in cancer |
| CN108410980A (en) * | 2018-01-22 | 2018-08-17 | 深圳华大基因股份有限公司 | Screen method, kit and the application of the target area for the PCR detections that methylate |
-
2018
- 2018-09-14 CN CN201811076262.0A patent/CN109355381A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108064170A (en) * | 2015-05-29 | 2018-05-22 | 豪夫迈·罗氏有限公司 | PD-L1 promoter methylations in cancer |
| WO2017193080A1 (en) * | 2016-05-05 | 2017-11-09 | Nantomics, Llc | Checkpoint failure and methods therefor |
| CN106947830A (en) * | 2017-05-16 | 2017-07-14 | 中山大学肿瘤防治中心 | Gene methylation panel for diagnosing, predicting therapeutic efficacy for hepatic carcinoma and prognosis |
| CN108410980A (en) * | 2018-01-22 | 2018-08-17 | 深圳华大基因股份有限公司 | Screen method, kit and the application of the target area for the PCR detections that methylate |
Non-Patent Citations (1)
| Title |
|---|
| MARK YARCHOAN 等: "Tumor Mutational Burden and Response Rate to PD-1 Inhibition", 《N. ENGL. J. MED.》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022141775A1 (en) * | 2021-01-04 | 2022-07-07 | 江苏先声医疗器械有限公司 | Construction method for tumor immune checkpoint inhibitor therapy effectiveness evaluation model based on dna methylation spectrum |
| CN112813155A (en) * | 2021-01-20 | 2021-05-18 | 武汉大学 | DNA methylation marker for predicting therapeutic effect of antipsychotic drug, screening method and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Guo et al. | Assessment of luminal and basal phenotypes in bladder cancer | |
| Babel et al. | Identification of MST1/STK4 and SULF1 proteins as autoantibody targets for the diagnosis of colorectal cancer by using phage microarrays | |
| Morton et al. | Multi-level analysis of the gut–brain axis shows autism spectrum disorder-associated molecular and microbial profiles | |
| Richard et al. | Exome analysis reveals genomic markers associated with better efficacy of nivolumab in lung cancer patients | |
| CN111394456B (en) | Early lung adenocarcinoma patient prognosis evaluation system and application thereof | |
| JP2011523049A (en) | Biomarkers for head and neck cancer identification, monitoring and treatment | |
| CN105936932A (en) | Breast cancer biomarker signatures for invasiveness and prognosis | |
| CN113096728B (en) | Method, device, storage medium and equipment for detecting tiny residual focus | |
| CN107532208A (en) | For determining the composition and method of carcinoma of endometrium prognosis | |
| CN115410713A (en) | Hepatocellular carcinoma prognosis risk prediction model construction based on immune-related gene | |
| Ye et al. | High-throughput sequencing-based analysis of T cell repertoire in lupus nephritis | |
| CN111676288A (en) | System for predicting lung adenocarcinoma patient prognosis and application thereof | |
| CN109355381A (en) | For predicting the biomarker and method of PD1/L1 inhibitor curative effect | |
| Chen et al. | Genetic profile of non‐small cell lung cancer (NSCLC): A hospital‐based survey in Jinhua | |
| CN116206681A (en) | Method for evaluating prognostic gene pair value of immune infiltration cell model | |
| Seo et al. | Tumor microenvironment-aware, single-transcriptome prediction of microsatellite instability in colorectal cancer using meta-analysis | |
| van der Pol et al. | The landscape of cell-free mitochondrial DNA in liquid biopsy for cancer detection | |
| Cornet et al. | Developing molecular signatures for chronic lymphocytic leukemia | |
| Ye et al. | Identification of key genes for HNSCC from public databases using bioinformatics analysis | |
| Timpe et al. | Mining the breast cancer proteome for predictors of drug sensitivity | |
| Al-Fatlawi et al. | NetRank recovers known cancer hallmark genes as universal biomarker signature for cancer outcome prediction | |
| Weiskittel et al. | De novo individualized disease modules reveal the synthetic penetrance of genes and inform personalized treatment regimens | |
| Wang et al. | Establishment of a prognostic-related microRNAs risk model for glioma by bioinformatics analysis | |
| CN114220484A (en) | Identification method of individual differential expression protein | |
| US20140297194A1 (en) | Gene signatures for detection of potential human diseases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190219 |