CN109022582A - A method of detection Glucose transporter-4 genetic analysis - Google Patents
A method of detection Glucose transporter-4 genetic analysis Download PDFInfo
- Publication number
- CN109022582A CN109022582A CN201810951803.3A CN201810951803A CN109022582A CN 109022582 A CN109022582 A CN 109022582A CN 201810951803 A CN201810951803 A CN 201810951803A CN 109022582 A CN109022582 A CN 109022582A
- Authority
- CN
- China
- Prior art keywords
- gene
- glucose transporter
- checked
- cell
- cls
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of methods for detecting Glucose transporter-4 genetic analysis, include the following steps: 1) separation and Extraction individual cells；2) cDNA of cls gene to be checked is synthesized by the individual cells, the cls gene to be checked includes Glucose transporter-4 gene；3) PCR expands the cls gene to be checked in advance；4) the rna expression amount of cls gene to be checked described in quantitative PCR detection.5) cls gene to be checked is classified by different cells and/or different genes, the variation of the rna expression amount between more each cls gene to be checked obtains individual cells related gene quantitative data.It include Glucose transporter-4 gene the invention discloses a kind of individual gene for detecting single loop tumour cell, with the analysis method of multiple gene RNA expression quantity, as detection circulating tumor cell in individual cell level Glucose transporter-4 gene expression detection and research method.
Description
Technical field
The invention belongs to biotechnology and medical domain more particularly to a kind of detection Glucose transporter-4 genetic analysis
Method.
Background technique
It is different there are the protein of cell and gene expression dose or even inconsistent show when analyzing and identifying different cells
As this directly or indirectly influences the classification of the property and function of analysis cell.Almost there is human body in Glucose transporter-4
Each cell is the main protein of epithelial cell glucose transport, is an important indicator of cell metabolism level, to dimension
The stabilization and brain energy supply for holding blood sugar concentration play a key effect.Glucose is the main source of tumour cell energy, general next
It says, tumour cell can only carry out anaerobic metabolism to glucose mostly due to being in low-oxygen environment, thus more to glucose demand
It is high.However, becoming circulating tumor cell after tumour cell enters in blood, the oxygen atmosphere around circulating tumor cell is same
Tumor tissues change, and detect Glucose transporter-4 (the SLC2A1:Solute carrier family in circulating tumor
2member 1) expression quantity may as identification circulating tumor cell a promising tumor marker, while may also as detection
One important indicator of canceration.But for the glucose transport of the circulating tumor cell in blood, especially individual cell level
Protein 1 gene expression analysis did not knew Portugal between individual cells both not directly from the method for its rna expression amount of cell detection yet
The variation of 1 gene expression amount of grape saccharide transporter.
Summary of the invention
In view of the above-mentioned drawbacks in the prior art, the main purpose of the present invention is to provide a kind of detection glucose transport proteins
The method of white 1 genetic analysis, can be as the Glucose transporter-4 gene table of individual cell level in detection circulating tumor cell
Accurate medical technology is increased to unicellular gene level from gene level by the method for the detection and research reached.
In order to achieve the above object, the present invention adopts the following technical scheme: a kind of detection Glucose transporter-4 gene point
The method of analysis, includes the following steps:
1) separation and Extraction individual cells；
2) cDNA of cls gene to be checked is synthesized by the individual cells, the cls gene to be checked includes glucose transporter
1 gene；
3) PCR expands the cls gene to be checked in advance；
4) the rna expression amount of cls gene to be checked described in quantitative PCR detection.
5) cls gene to be checked is classified by different cells and/or different genes, the RNA table between more each cls gene to be checked
Up to the variation of amount, individual cells related gene quantitative data is obtained.
As a further preference, in the step 1), from blood, separation and Extraction individual cells, the cell is to follow
Ring tumour cell.
As a further preference, in the step 2), the individual cells are handled with cell lysis and decompose cell membrane
Afterwards, the cDNA of cls gene to be checked is synthesized.
As a further preference, in the step 2), the cls gene to be checked further includes GAPDH, Beta Acting,
The gene of UBB, RPS11, RPS18, CD45, EpCAM and CK8/18/19.
As a further preference, in the step 3), the PCR expands the pcr amplification primer of Glucose transporter-4 in advance
Object is respectively as follows: forward primer: ACGGGTCGCCTCATGCT；Reverse primer: TGTAGAACTCCTCGATCACCTTCTG.
As a further preference, in the step 4), when the quantitative PCR detection, Glucose transporter-4 expresses water
The quantitative PCR the primer for dividing analysis equally is respectively as follows: forward primer: ACGGGTCGCCTCATGCT；Reverse primer:
TGTAGAACTCCTCGATCACCTTCTG；Probe: CTCCCTGCAGTTTGGCTACAACACTGGA.
As a further preference, in the step 5), the change of the rna expression amount between more each cls gene to be checked
Change, comprising: the comparison of the rna expression level of the Glucose transporter-4 gene of individual cell level, individual cell level includes Portugal
The analysis of polygenes rna expression level including grape saccharide transporter 1 compare and/or individual cell level, in housekeeping gene table
Under the same conditions up to amount, the analysis of the rna expression amount of individual gene or multiple genes is compared.
The beneficial effects of the present invention are: it is slender to establish a kind of circulating tumor cell for the first time from individual cell level by the present invention
The gene expression analysis method of the Glucose transporter-4 of born of the same parents' level analyzes individually and simultaneously glucose with other polygenes and turns
The unicellular gene RNA that albumen 1 is transported in circulating tumor cell expresses variation characteristic, the results show that utilizing the list of individual cell level
The analysis of the Glucose transporter-4 expression of a gene or multiple genes is compared, into its Portugal of the tumour cell in blood
The expression of grape saccharide transporter 1 generally reduces, or even inspection does not measure, may be indirectly related to the metaboilic level of cell,
Its Variation Features can combine individually or with reference gene, the effective marker as the type of circulating tumor cell, function, feature
One of object, the method for the present invention can get unicellular related gene quantitative data, be used for cell function metabolic analysis, qualitative point of cell
The science such as analysis, cell origin analysis and clinical information needed.
Detailed description of the invention
By reading the following detailed description of the preferred embodiment, various other advantages and benefits are common for this field
Technical staff will become clear.The drawings are only for the purpose of illustrating a preferred embodiment, and is not considered as to the present invention
Limitation.
Fig. 1 is the rna expression amount analysis detection schematic illustration of Glucose transporter-4.
Fig. 2 is individual cell level of Glucose transporter-4 of the embodiment of the present invention gene in MCF-7 tumor cell line
Rna expression analyzes schematic diagram.
Fig. 3 is RNA table of Glucose transporter-4 of the embodiment of the present invention gene in the individual cell level of circulating tumor cell
Up to analysis schematic diagram.
Fig. 4 is unicellular water of the 12 kinds of genes such as Glucose transporter-4 of the embodiment of the present invention in MCF-7 tumor cell line
Flat expression analysis schematic diagram.
Fig. 5 is that the multi-gene expression of the individual cell level of circulating tumor cell of the embodiment of the present invention analyzes schematic diagram.
Fig. 6 is that the multi-gene expression of the individual cell level of MCF-7 of embodiment of the present invention tumor cell line analyzes schematic diagram.
Fig. 7 is tumour cell and blood leucocyte of Glucose transporter-4 of the embodiment of the present invention gene in different tumours
In individual cell level expression analysis schematic diagram.
Fig. 8 is that the multi-gene expression of the individual cell level of different cells analyzes schematic diagram (comprising Glucose transporter-4 base
Cause).
Fig. 9 be different cells, different genes individual cell level expression analysis schematic diagram.
Figure 10 is the Glucose transporter-4 gene expression analysis schematic diagram of the individual cell level of different tumour cells.
Specific embodiment
The embodiment of the present invention solves existing by providing a kind of method for detecting Glucose transporter-4 genetic analysis
Glucose transporter-4 gene expression analysis the defects of of the technology in individual cell level.
In order to solve drawbacks described above, the main thought of the embodiment of the present invention is:
The method that the embodiment of the present invention detects Glucose transporter-4 genetic analysis, includes the following steps:
1) separation and Extraction individual cells；
2) cDNA of cls gene to be checked is synthesized by the individual cells, the cls gene to be checked includes glucose transporter
1 gene；
3) PCR expands the cls gene to be checked in advance；
4) the rna expression amount of cls gene to be checked described in quantitative PCR detection.
5) cls gene to be checked is classified by different cells and/or different genes, the RNA table between more each cls gene to be checked
Up to the variation of amount, individual cells related gene quantitative data is obtained.
Above-mentioned steps 1) in, from blood, using circulating tumor cell separator, single cell can be separated, is used respectively
Cell-preservation liquid (Hubei Province Yichang tool is for 20170006 cell-preservation liquids, Silicon Valley Life Science limited liability company of Yichang Micron Technology) saves
In -20 DEG C (being used in 3 months) or -80 DEG C (saving within 3 months or more).
The embodiment of the present invention can not have to special extract RNA or DNA, so that it may with the present invention directly by fresh cell
Embodiment method, the directly rna expression of the Glucose transporter-4 gene of detection and analysis individual cell level and other different genes
It is horizontal.
Above-mentioned cell saves, and in the case where operating allows, can directly make from the fresh cells being separated to subsequent
Genetic analysis.
Test sample of the embodiment of the present invention can be single loop tumour cell or a small amount of circulating tumor cell or the circulation
The a small amount of RNA or cDNA of tumour cell.
Above-mentioned steps 2) in, it can use above-mentioned individual cells, handled with cell lysis after decomposing cell membrane, synthesis of glucose
Transport protein 1 and GAPDH, the cDNA of Beta Acting, UBB, RPS11, RPS18, CD45, EpCAM, CK8/18/19 gene.
Specifically, the cDNA synthesis of said gene is respectively as follows:
GAPDH (ABI, Hs02786624_g1),
Beta Acting (ACTB) (ABI, Hs01060665_g1),
UBB (ubiquitin B) (ABI, Hs00430290_m1),
RPS11 (ABI, Hs00817975_g1),
RPS18 (ribosomal protein S18) (ABI, Hs02387368_g1),
CD45 (ABI, Hs04189704_m1),
EpCAM (ABI, Hs00901885_m1),
CK8 (ABI, Hs02339473_g1),
CK18 (ABI, Hs01649352_g1),
CK19(ABI,Hs00761767_s1)。
Above-mentioned steps 3) in gene expand in advance, can be the amplification of qualitative gene, be also possible to broad spectrum activity gene expand
Increase.The PCR amplification primer of Glucose transporter-4 is respectively as follows: forward primer: ACGGGTCGCCTCATGCT；Reverse primer:
TGTAGAACTCCTCGATCACCTTCTG。
Above-mentioned steps 4) in, the quantitative PCR the primer of Glucose transporter-4 expression analysis is respectively as follows: forward direction
Primer: ACGGGTCGCCTCATGCT；Reverse primer: TGTAGAACTCCTCGATCACCTTCTG；Probe:
CTCCCTGCAGTTTGGCTACAACACTGGA。
Above-mentioned steps 5) in, the quantitative PCR detection of said gene is analyzed and is compared, and between different cells, can be slender
The comparison of the rna expression level of the Glucose transporter-4 gene of born of the same parents' level, be also possible to individual cell level includes glucose
The analysis of polygenes rna expression level including transport protein 1 is compared, be also possible to individual cell level, in housekeeping gene table
Under the same conditions up to amount, the analysis of the rna expression amount of individual gene or multiple genes is compared.Have completely in other housekeeping genes
In the circulating tumor cell that the sum of expression is expressed without housekeeping gene, the rna expression feature of Glucose transporter-4 has significantly
It is different.In the circulating tumor cell for having housekeeping gene expressed intact, Glucose transporter-4 has expression, but expression quantity
Tumour cell than tissue cultures is substantially reduced, in the circulating tumor cell of not complete housekeeping gene expression, substantially
It can't detect the rna expression of Glucose transporter-4, these indexs can be used as the property and function of analysis circulating tumor cell
One of important symbol object of identification.
Thus, the embodiment of the present invention can get individual cells related gene quantitative data, for cell function analysis, cell
The science such as Qualitative Identification, cell origin identification and clinical information needed.
In order to which above and other purpose, feature and the advantage of the present invention can be clearer and more comprehensible, several implementations are cited below particularly
Example, the method to illustrate detection Glucose transporter-4 genetic analysis of the present invention.
Embodiment 1:
The rna expression amount analysis detection schematic illustration of Glucose transporter-4 is as shown in Figure 1.
The detection and analysis side of rna expression amount of the Glucose transporter-4 in single tumor cell strain MCF7 tumour cell
Method, comprising:
1. catching the tumour cell that instrument isolates single MCF7 cell strain with magnetic, it is placed on 1 microlitre PBS and 0.1 microlitre
In the PCR test tube of cell-preservation liquid (Micron Technology Silicon Valley, cell-preservation liquid), it is stored in -20C, or directly use.
2. after handling cell with cell lysis, with the cDNA of random primer synthesis SLC2A1 gene.
3. expanding the cDNA of SLC2A1 gene in advance with the PCR primer of design.
Forward primer: ACGGGTCGCCTCATGCT
Reverse primer: TGTAGAACTCCTCGATCACCTTCTG
4. with the rna expression amount of the SLC2A1 gene in the quantification PCR primer and probe assay individual cells of design.It is quantitative
PCR probe: CTCCCTGCAGTTTGGCTACAACACTGGA.From quantitative PCR reaction, CT numerical value is obtained, eCT is converted to
(eCT-35-CT), for directly comparing the expression quantity level of detection gene.
From figure 2 it can be seen that SLC2A1 gene in MCF7 tumour cell, can obtain stable detection.
Embodiment 2:
The determination method of rna expression amount of the Glucose transporter-4 in circulating tumor cell, comprising:
1. catching instrument with magnetic isolates circulating tumor cell in single breast cancer disease human blood, be placed on 1 microlitre of PBS and
In the PCR test tube of 0.1 microlitre of cell-preservation liquid (Micron Technology Silicon Valley, cell-preservation liquid), -20 DEG C are stored in, or directly use.
2. after handling cell with cell lysis, with the cDNA of random primer synthesis SLC2A1 gene.
3. expanding the cDNA of SLC2A1 gene in advance with the PCR primer of design.
Forward primer: ACGGGTCGCCTCATGCT
Reverse primer: the quantification PCR primer and probe of TGTAGAACTCCTCGATCACCTTCTG design
4. measuring the rna expression amount of the SLC2A1 gene in individual cells.Quantitative PCR probe:
CTCCCTGCAGTTTGGCTACAACACTGGA。
From figure 3, it can be seen that SLC2A1 gene only detects in few part circulating tumor cell, and eCT
It is worth lower.
Embodiment 3:
The rna expression analysis method of multiple genes in single mammary gland cancerous swelling tumor cell strain MCF7 tumour cell, comprising:
1. catching the tumour cell that instrument isolates single MCF7 cell strain with magnetic, it is placed on 1 microlitre PBS and 0.1 microlitre
In the PCR test tube of cell-preservation liquid (Micron Technology Silicon Valley, cell-preservation liquid), it is stored in -20C, or directly use.
2. synthesizing the cDNA of unicellular RNA with random primer after handling cell with cell lysis.
The pre- amplification of 3.SLC2A1 gene cDNA using autonomous Design the pre- amplimer of PCR primer (forward primer:
ACGGGTCGCCTCATGCT；Reverse primer: TGTAGAACTCCTCGATCACCTTCTG), other genes are pre- using ABI cDNA
Expand product (GAPDH:Hs02786624_g1；Beta Acting (ACTB): Hs01060665_g1；UBB(ubiquitin
B): Hs00430290_m1；RPS11:Hs00817975_g1；RPS18 (ribosomal protein S18): Hs02387368_
g1；CD45:Hs04189704_m1；EpCAM:Hs00901885_m1；
CK8:Hs02339473_g1；CK18:Hs01649352_g1；CK19:Hs00761767_s1).
4. multiple gene RNA expressions in quantitative PCR detection individual cells.The quantitative detection of SLC2A1 gene uses
Be specially designed primer and probe (forward primer: ACGGGTCGCCTCATGCT；Reverse primer:
TGTAGAACTCCTCGATCACCTTCTG)；ABI reagent (the GAPDH:Hs02786624_ that the quantitative detection of other genes uses
g1；
Beta Acting (ACTB): Hs01060665_g1；UBB (ubiquitin B): Hs00430290_m1；
RPS11:Hs00817975_g1；RPS18 (ribosomal protein S18): Hs02387368_g1；
CD45:Hs04189704_m1；EpCAM:Hs00901885_m1；CK8:Hs02339473_g1；
CK18:Hs01649352_g1；CK19:Hs00761767_s1).
Fig. 4 is unicellular water of the 12 kinds of genes such as Glucose transporter-4 of the embodiment of the present invention in MCF-7 tumor cell line
Flat expression analysis schematic diagram.Analysis detection can detecte different gene expression into single MCF-7 tumour cell.From Fig. 4
As can be seen that detection while 12 genes can obtain stablizing in unicellular.In all tumour cells, haemocyte marker
Feminine gender is presented in CD45, demonstrates tumour cell and does not express CD45.
Using similar method, the rna expression of multiple genes in single loop tumour cell is detected, Fig. 5 result is obtained.
Fig. 5 is that the multi-gene expression of the individual cell level of circulating tumor cell of the embodiment of the present invention analyzes schematic diagram.It is unicellular using this
Gene analysis can detecte the table of the different genes of circulating tumor cell different, in single mammary gland carninomatosis human blood
Up to level.Fig. 5 indicates, detection while 12 genes can obtain stablizing in single loop tumour cell.Haemocyte marker
Feminine gender is presented in CD45, demonstrates the result that circulating tumor cell does not express CD45.In Fig. 5, PT-CTC-9 to PT-CTC-19 pairs
The column figure answered arranges from left to right.
Fig. 6 is that the multi-gene expression of the individual cell level of MCF-7 of embodiment of the present invention tumor cell line analyzes schematic diagram.Benefit
With the unicellular multiple baseline images method, can detecte in different, single MCF-7 tumour cell, the difference of different genes
Expression.In Fig. 6, the corresponding column figure of CL-MCF7-1 to CL-MCF7-7 arranges from left to right.
Embodiment 4:
Glucose transporter-4 is thin in blood leucocyte, circulating tumor cell, cells of tumorous bone, bone marrow dissemination tumour
The analysis of the rna expression amount of the individual cell level of born of the same parents and tumor cell line cell and compare
As shown in fig. 7, SLC2A1 gene is in tumor cell line, cells of tumorous bone and bone marrow dissemination tumour cell, table
Up to height is measured, the expression quantity in circulating tumor cell and blood leucocyte is low, even can't detect.
Fig. 8 is that the multi-gene expression of the individual cell level of different cells analyzes schematic diagram (comprising Glucose transporter-4 base
Cause).Fig. 8 shows detect different gene expression in different individual cells, it is shown that the different expressions of different genes.
In Fig. 8, CL-MCF7-1, PT-CTC-9, PT-Bone-DTC-1, PT-BoneMarrow-DTC-2, PT-Bone-DTC-1, NL-
The corresponding column figure of wbc-1 arranges from left to right.
Fig. 9 be different cells, different genes individual cell level expression analysis schematic diagram.Fig. 9 expression, different cells
The several genes expression analysis of individual cell level demonstrates the validity of the unicellular several genes analytic approach.In Fig. 9,
The corresponding column of GAPDH, b-Actin, UBB, RPS11, RPS18, CD45, CK19, EpCAM, KRT8, KRT18, KRT7, SLC2A1
Shape figure arranges from left to right.
Figure 10 is the Glucose transporter-4 gene expression analysis schematic diagram of the individual cell level of different tumour cells.Figure
10 indicate, Glucose transporter-4 gene it is different types of it is unicellular in expression be it is different, circulating tumor is thin
Expression in born of the same parents (CTC), hence it is evident that lower.
Be comprehensively compared expression of results of the different genes in individual cell level of different cells, CD45 be to discriminate between tumour cell and
The promising tumor marker of blood leucocyte, and SLC2A1 is in the expression of individual cells level, with tumor cell line cell, osteocyte and
Bone marrow dissemination tumour cell is compared, and the SLC2A1 expression in circulating tumor cell is substantially reduced, and most circulating tumors are thin
Born of the same parents even can't detect the expression of SLC2A1 gene.The circulating tumor cell partly referring to gene expression be can't detect at some
In, it substantially can't detect the expression of SLC2A1.It is related to metabolism in view of SLC2A1 gene, SLC2A1 gene and reference gene phase
In conjunction with, it may be possible to judge an important indicator of circulating tumor cell life or death.
Technical solution in above-mentioned the embodiment of the present application, at least have the following technical effects or advantages: the present invention is implemented
Example method has in unicellular, a small amount of cell and a small amount of RNA sample, effectively detects the slender of Glucose transporter-4 gene
The expression of born of the same parents' level.Show in the testing result of the individual cell level of circulating tumor cell thin into the tumour in blood
The expression of its Glucose transporter-4 of born of the same parents generally reduces, in addition inspection do not measure, may indirectly with the metaboilic level of cell
Correlation, Variation Features can combine individually or with reference gene, have as the type of circulating tumor cell, function, feature
One of valid flag object.
Above-described specific embodiment has carried out further the purpose of the present invention, technical scheme and beneficial effects
It is described in detail, it should be understood that being not limited to this hair the foregoing is merely a specific embodiment of the invention
Bright, all within the spirits and principles of the present invention, any modification, equivalent substitution, improvement and etc. done should be included in the present invention
Protection scope within.
Claims (8)
1. a kind of method for detecting Glucose transporter-4 genetic analysis, characterized by the following steps:
1) separation and Extraction individual cells；
2) cDNA of cls gene to be checked is synthesized by the individual cells, the cls gene to be checked includes Glucose transporter-4 base
Cause；
3) PCR expands the cls gene to be checked in advance；
4) the rna expression amount of cls gene to be checked described in quantitative PCR detection.
5) cls gene to be checked is classified by different cells and/or different genes, the rna expression amount between more each cls gene to be checked
Variation, obtain individual cells related gene quantitative data.
2. detecting the method for Glucose transporter-4 genetic analysis according to claim 1, it is characterised in that: the step
1) in, from blood, separation and Extraction individual cells.
3. detecting the method for Glucose transporter-4 genetic analysis according to claim 1, it is characterised in that: the step
1) in, the cell is circulating tumor cell.
4. detecting the method for Glucose transporter-4 genetic analysis according to claim 1, it is characterised in that: the step
2) in, the individual cells are handled after decomposing cell membrane with cell lysis, synthesize the cDNA of cls gene to be checked.
5. according to claim 1 or 4 it is described detection Glucose transporter-4 genetic analysis methods, it is characterised in that: the step
It is rapid 2) in, the cls gene to be checked further includes GAPDH, Beta Acting, UBB, RPS11, RPS18, CD45, EpCAM and CK8/
18/19 gene.
6. detecting the method for Glucose transporter-4 genetic analysis according to claim 1, it is characterised in that: the step
3) in, the PCR amplification primer that the PCR expands Glucose transporter-4 in advance is respectively as follows: forward primer:
ACGGGTCGCCTCATGCT；Reverse primer: TGTAGAACTCCTCGATCACCTTCTG.
7. detecting the method for Glucose transporter-4 genetic analysis according to claim 1, it is characterised in that: the step
4) in, when the quantitative PCR detection, the quantitative PCR the primer of Glucose transporter-4 expression analysis is respectively as follows: just
To primer: ACGGGTCGCCTCATGCT；Reverse primer: TGTAGAACTCCTCGATCACCTTCTG；Probe:
CTCCCTGCAGTTTGGCTACAACACTGGA。
8. detecting the method for Glucose transporter-4 genetic analysis according to claim 1, it is characterised in that: the step
5) in, the variation of the rna expression amount between more each cls gene to be checked, comprising: the glucose transport protein of individual cell level
The comparison of the rna expression level of white 1 gene, the polygenes rna expression including Glucose transporter-4 of individual cell level
Horizontal analysis compare and/or individual cell level, housekeeping gene expression quantity under the same conditions, individual gene or multiple
The analysis of the rna expression amount of gene is compared.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810951803.3A CN109022582A (en) | 2018-08-21 | 2018-08-21 | A method of detection Glucose transporter-4 genetic analysis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810951803.3A CN109022582A (en) | 2018-08-21 | 2018-08-21 | A method of detection Glucose transporter-4 genetic analysis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109022582A true CN109022582A (en) | 2018-12-18 |
Family
ID=64626505
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810951803.3A Pending CN109022582A (en) | 2018-08-21 | 2018-08-21 | A method of detection Glucose transporter-4 genetic analysis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109022582A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109752530A (en) * | 2019-01-31 | 2019-05-14 | 宜昌美光硅谷生命科技股份有限公司 | A kind of liquid phase cellular immunity identification method and its application |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102242204A (en) * | 2011-06-24 | 2011-11-16 | 武汉格蓝丽富科技有限公司 | Method for identifying single cells in molecular biology |
| CN104011198A (en) * | 2011-12-27 | 2014-08-27 | 奥林巴斯株式会社 | ACF detection method |
| EP2821502A1 (en) * | 2013-07-05 | 2015-01-07 | Centre National de la Recherche Scientifique (CNRS) | Method for evaluating developmental competence of an oocyte |
| WO2017040520A1 (en) * | 2015-08-31 | 2017-03-09 | Hitachi Chemical Co., Ltd. | Molecular methods for assessing urothelial disease |
| US20170073763A1 (en) * | 2014-03-12 | 2017-03-16 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and Compositions for Assessing Patients with Non-small Cell Lung Cancer |
-
2018
- 2018-08-21 CN CN201810951803.3A patent/CN109022582A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102242204A (en) * | 2011-06-24 | 2011-11-16 | 武汉格蓝丽富科技有限公司 | Method for identifying single cells in molecular biology |
| CN104011198A (en) * | 2011-12-27 | 2014-08-27 | 奥林巴斯株式会社 | ACF detection method |
| EP2821502A1 (en) * | 2013-07-05 | 2015-01-07 | Centre National de la Recherche Scientifique (CNRS) | Method for evaluating developmental competence of an oocyte |
| US20170073763A1 (en) * | 2014-03-12 | 2017-03-16 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and Compositions for Assessing Patients with Non-small Cell Lung Cancer |
| WO2017040520A1 (en) * | 2015-08-31 | 2017-03-09 | Hitachi Chemical Co., Ltd. | Molecular methods for assessing urothelial disease |
Non-Patent Citations (2)
| Title |
|---|
| ASHLEY A. POWELL等: "Single Cell Profiling of Circulating Tumor Cells: Transcriptional Heterogeneity and Diversity from Breast Cancer Cell Lines", 《PLOS ONE》 * |
| MASUHIRO NISHIMURA等: "Tissue-speciˆc mRNA Expression Proˆles of Human ATP-binding Cassette and Solute Carrier Transporter Superfamilies", 《DRUG METAB PHARMACOKINET》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109752530A (en) * | 2019-01-31 | 2019-05-14 | 宜昌美光硅谷生命科技股份有限公司 | A kind of liquid phase cellular immunity identification method and its application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Brock et al. | Liquid biopsy for cancer screening, patient stratification and monitoring | |
| Bodaghi et al. | Biomarkers: Promising and valuable tools towards diagnosis, prognosis and treatment of Covid-19 and other diseases | |
| US9416422B2 (en) | Methods for detecting minimum residual disease | |
| Li et al. | Application of liquid biopsy in bone and soft tissue sarcomas: Present and future | |
| Casagrande et al. | Liquid biopsy for lung cancer: up-to-date and perspectives for screening programs | |
| CN106591438A (en) | Nucleic acid combination for detecting Her2 gene, kit and application | |
| Turner et al. | Can biomarker assessment on circulating tumor cells help direct therapy in metastatic breast cancer? | |
| Paidi et al. | Coarse Raman and optical diffraction tomographic imaging enable label-free phenotyping of isogenic breast cancer cells of varying metastatic potential | |
| Mondelo-Macía et al. | Current status and future perspectives of liquid biopsy in small cell lung cancer | |
| CN105684989A (en) | A liver cancer PDX standardization model base | |
| WO2021253544A1 (en) | Model using 87 genes serving as biomarkers to predict cell proliferation activity | |
| Keup et al. | Multimodal targeted deep sequencing of circulating tumor cells and matched cell-free DNA provides a more comprehensive tool to identify therapeutic targets in metastatic breast cancer patients | |
| Pérez-Sánchez et al. | Clinical utility of microRNAs in exhaled breath condensate as biomarkers for lung cancer | |
| Soave et al. | Do circulating tumor cells have a role in deciding on adjuvant chemotherapy after radical cystectomy? | |
| Huang et al. | Current trends in circulating biomarkers for melanoma detection | |
| CN109444425A (en) | A kind of cellular level albumen high-flux detection method | |
| Gallerani et al. | Circulating tumor cells in the adenocarcinoma of the esophagus | |
| CN105696087A (en) | Lung cancer PDX standardized model library | |
| Kardos et al. | Development and validation of a NanoString BASE47 bladder cancer gene classifier | |
| Edgar et al. | Culture-associated DNA methylation changes impact on cellular function of human intestinal organoids | |
| Bell et al. | PanIN and CAF transitions in pancreatic carcinogenesis revealed with spatial data integration | |
| CN109022582A (en) | A method of detection Glucose transporter-4 genetic analysis | |
| D’Ambrosi et al. | Combinatorial blood platelets-derived circRNA and mRNA signature for early-stage lung cancer detection | |
| Im et al. | Exploratory profiling of extracellular MicroRNAs in cerebrospinal fluid comparing leptomeningeal metastasis with other central nervous system tumor statuses | |
| CN107723343A (en) | A kind of method of gene quantification analysis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181218 |
|
| RJ01 | Rejection of invention patent application after publication |