CN109022426A - It is a kind of extract Antrodia camphorata total DNA reagent and application - Google Patents

It is a kind of extract Antrodia camphorata total DNA reagent and application Download PDF

Info

Publication number
CN109022426A
CN109022426A CN201811101679.8A CN201811101679A CN109022426A CN 109022426 A CN109022426 A CN 109022426A CN 201811101679 A CN201811101679 A CN 201811101679A CN 109022426 A CN109022426 A CN 109022426A
Authority
CN
China
Prior art keywords
dna
adsorption column
centrifuged
rpm
antrodia camphorata
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
CN201811101679.8A
Other languages
Chinese (zh)
Inventor
李晶
张煜隆
王泽辉
刘艳玲
刘朋虎
林辉
林占熺
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fujian Agriculture and Forestry University
Original Assignee
Fujian Agriculture and Forestry University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fujian Agriculture and Forestry University filed Critical Fujian Agriculture and Forestry University
Priority to CN201811101679.8A priority Critical patent/CN109022426A/en
Publication of CN109022426A publication Critical patent/CN109022426A/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
    • C12N15/1006—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Saccharide Compounds (AREA)

Abstract

The invention discloses a kind of reagent for extracting Antrodia camphorata total DNA and applications.Eluted including column equilibration, sample dissociation, DNA absorption, washing and DNA and etc..This method is compared with traditional DNA extraction method as CTAB method, SDS method, alkaline lysis are compared with conventional kit,, high efficiency and time conservation few with amount of samples, DNA sample are with high purity, integrality is good, simple operation and other advantages, and it is not related to the toxic reagents such as chloroform, phenol, beta -mercaptoethanol in entire extraction process, it ensure that researcher from the injury of toxic reagent.The experimental results showed that, the present invention is suitable for the extraction and PCR identification of a variety of fungi total DNAs, and single sample extraction time foreshortens to 15 min, and extracted DNA integrality is good, with high purity, can be directly used for the test of the downstream molecular biologies such as PCR, Real-Time PCR, molecular labeling.

Description

It is a kind of extract Antrodia camphorata total DNA reagent and application
Technical field
The invention belongs to technique for gene engineering molecular biology fields, and in particular to a kind of examination for extracting Antrodia camphorata total DNA Agent and application.
Background technique
DNA is the carrier of hereditary information in life entity, contains the inhereditary feature of organism.High quality, high-purity it is total DNA be guarantee carry out PCR amplification, digestion with restriction enzyme, genetic map analysis, molecule hybridization, analysis of genetic diversity with And the most important condition of the molecular biology researches such as genomics.Therefore, the good total DNA of high-purity, integrality efficiently, is quickly prepared Sample seems particularly important.
Currently, the method for tradition preparation fungi total DNA includes CTAB method, SDS method, alkaline lysis and conventional reagent cassette method Release genome, then pass through for cracking fungal cell using ionic surfactant Deng, CTAB method and SDS method The multiple extracting of phenol/chloroform/isoamyl alcohol etc. is deposited in protein etc. in organic reagent, finally passes through isopropanol or ethyl alcohol Precipitating obtains the good DNA molecular of purity is high, integrality.There is the process be centrifuged repeatedly, precipitate, waiting, behaviour in this approach Make cumbersome and time-consuming, extraction process needs 2-3 h；And the organic solvents such as phenol, chloroform and isoamyl alcohol have poison in drug Property, certain injury may cause to operator；Under next may cause organic solvent residual in total DNA sample to cause Trip test can not be successfully progress.
Conventional reagent cassette method is to combine the progress of DNA adsorption column excellent on the basis ofs conventional methods such as CTAB method, SDS method etc. Change, solves the DNA sample sedimentation time long disadvantage low with sample purity, and whole experiment process shortens to 1h or so.But It still needs to be related to the toxic reagents such as chloroform, phenol, beta -mercaptoethanol in conventional reagent cassette method extraction process.
Alkaline lysis directly makes cellular membrane lysis using highly basic NaOH solution, and albuminous degeneration discharges total DNA, using TE Buffer, which dilutes aqueous slkali, to be neutralized, so that having obtained DNA solution is directly used in PCR amplification, is presently the most common quick The method that simplicity extracts total DNA.The DNA that this method obtains due to without any purification process, containing a large amount of pigments, polysaccharide and The substances such as albumen, content and purity are all low to be unfavorable for subsequent experimental, and highly basic NaOH can interrupt DNA fragmentation in reaction process, The DNA sample for causing this method to obtain only expands the gene that the upper limit is 1000 bp or so, and for longer genetic fragment and Speech, this extracting method are obviously not suitable for.
Antrodia camphorata is rare medicinal fungi, because having liver protection, anti-radiation, hypoglycemic and other effects to be significantly increasingly becoming China The hot spot of continent and Taiwan and foreign study.With the development of modern biotechnology, carry out Antrodia camphorata molecular biology Research is development and the important directions for carrying forward Antrodia camphorata culture, but due to containing a large amount of stickiness in Antrodia camphorata fructification and mycelium Polysaccharose substance, in the market only the fungal agents box of QIAGEN company and Omega BioTek company to Antrodia camphorata fructification Extraction with mycelium total DNA basically reaches subsequent reactions requirement in purity and concentration, but exists simultaneously that time-consuming is more, step is numerous The disadvantages of more, extracted amount lacks, therefore this method has been invented against the above deficiency and by the improvement to existing extractive technique, have Safety, quick, easy, efficient, economy etc. mention a little.
Summary of the invention
The present invention by repeatedly optimizing experiment flow and agent prescription, sum up a kind of safety, quickly, it is simple, efficiently mention The method for taking Antrodia camphorata total DNA.This method utilizes alumina-silicate ceramic fibre film from DNA under the conditions of different salt ionic concentrations and pH Combination degree difference to achieve the purpose that extracting and developing, purifying DNA.This method safe operation, quick, simple, 15 min The preparation process of entire total DNA can be completed, raw material dosage is few in extraction process, is not necessarily to phenol, chloroform, avoids organic molten Pollution of the agent to operator；Experimental result shows that total DNA integrality is good, and purity is high is suitable for PCR, SSR, ISSR, qPCR Deng experiment.To solve, existing extractive technique amount of samples is big, time-consuming, reagent is toxic, extracts DNA fragmentation is shorter etc. to be lacked Point, to meet the needs of the precious material molecule biological experiment such as Antrodia camphorata.Specific steps are as follows:
To achieve the above object, the present invention adopts the following technical scheme:
A kind of reagent extracting Antrodia camphorata total DNA, including following four reagent:
(1) equilibrium liquid includes following component: the Na of 2wt%2SiO3·9H2The KOH of O, 0.5wt%；
(2) lysate includes following component: the guanidine hydrochloride of 5.0M, the isopropanol of 30%v/v and the PVP- K30 of 2wt%；
(3) DNA cleaning solution includes following component: 20 mM NaCl, 20 mM Tris-HCl, the ethyl alcohol of final concentration of 90%v/v, pH 7.5；
(4) DNA eluent includes following component: 10 mM Tris-HCl, pH 8.5.
A method of Antrodia camphorata total DNA being extracted using the reagent, specifically includes the following steps:
(1) add equilibrium liquid 200 μ L, 10,000 rpm to be centrifuged 1 min into DNA adsorption column, abandon waste liquid, DNA adsorption column is carried out Pretreatment；
(2) 500 μ L of lysate is added after grinding the sample of 50 mg, mixes, 10,000 rpm of room temperature, is centrifuged 30 s；
(3) supernatant is transferred to processed DNA adsorption column, 10,000 rpm of room temperature is centrifuged 1 min, abandons waste liquid；
(4) 650 μ L of DNA cleaning solution is added into DNA adsorption column, 10,000 rpm of room temperature is centrifuged 1 min, abandons DNA after waste liquid Adsorption column recovers waste collection pipe, and 10,000 rpm of room temperature is centrifuged 1 min；
(5) DNA adsorption column is moved on in 1.5 new mL centrifuge tubes, uncaps and place 1-2 min removal ethyl alcohol residual, is added 65 The DNA eluent of DEG C preheating, 30-100 μ L, or add 37 DEG C of RNA enzyme 30 min of incubations of 20 μ g/ mL, removal RNA are quiet Set 1-2 min；
(6) 12,000 rpm are centrifuged 2 min, and eluted dna saves backup.
The DNA adsorption column is alumina-silicate ceramic fibre film DNA adsorption column.
This method is applied in the extraction or ITS sequence identification of edible mushroom total DNA as needed.
Advantages of the present invention is as follows:
(1) during DNA is isolated and purified, present invention uses alumina-silicate ceramic fibre film DNA adsorption columns, and by using this The equilibrium liquid of invention research and development pre-processes alumina-silicate ceramic fibre film, can obviously increase alumina-silicate ceramic fibre film and DNA Percentage bound；
(2) by the formula of optimization lysate and cleaning solution, it on the one hand can adequately go removing protein, polysaccharide etc. other miscellaneous Matter, on the other hand due to without using the organic reagents such as phenol, chloroform, can avoid toxic reagent is poisoned caused by operator with Inhibiting effect of the remaining reagent to downstream tests；
(3) in the step of DNA is eluted, make DNA molecular more to accelerate the warm-up movement of molecule by 65 DEG C of preheating DNA eluents It is easy and silica gel post separation, the maximum elution efficiency for guaranteeing DNA；
(4) operation of the present invention is simple, quick, with high purity, integrity degree is high, can be directly used for PCR, Real-Time PCR, molecule mark The Total DNA extraction method of the fungies such as the quick Antrodia camphorata of the downstream molecular biologies such as note test, can be to the son of the fungies such as Antrodia camphorata The total DNAs such as entity, mycelium and other tunnings carry out rapidly extracting, and extracting product can be used for molecular biology and heredity Research and Molecular Identification, can preferably meet the needs of molecular biology.
Detailed description of the invention
Fig. 1 is that Antrodia camphorata fructification, mycelium total DNA and mushroom, ganoderma lucidum, the race of acupuncture needle massee fruiting bodies total DNA are cementing Fruit；Sample is successively in figure are as follows: M, Beijing Quan Shi King Company Trans 15K DNA Marker；1. Antrodia camphorata fructification total DNA； 2. antrodia mycelia total DNA；3. ganoderma lucidum fruitbody total DNA；4. acupuncture needle massee fruiting bodies total DNA；5. mushroom fruiting body is total DNA。
Fig. 2 is Antrodia camphorata fructification, mycelium, dry-eye disease DNA and mushroom, ganoderma lucidum, the acupuncture needle extracted using this method Mushroom total DNA is that template carries out ITS sequence amplification；Sample is successively in figure are as follows: M, Beijing Quan Shi King Company Trans 15K DNA Marker；1. Antrodia camphorata fructification ITS segment；2. antrodia mycelia ITS segment；3. ganoderma lucidum dry-eye disease ITS segment；4. Ganoderma lucidum fruitbody ITS segment；5. acupuncture needle massee fruiting bodies ITS segment；6. mushroom fruiting body ITS segment.
Specific embodiment
Below in conjunction with drawings and examples, the present invention is further described, is only intended to clearly illustrate made by the present invention and lifts Example, should not be construed as limitation of the invention.For those of ordinary skill in the art, on the basis of the above description It can also make other variations or changes in different ways.There is no necessity and possibility to exhaust all the enbodiments.And Thus amplify out it is obvious to modifications or substitutions made by the method for the present invention, step or condition still in of the invention Among protection scope.
Embodiment 1 extracts Antrodia camphorata fructification and mycelial total DNA using this method
(1) Antrodia camphorata fructification and mycelium 2-100 mg are collected respectively, it is spare after dry ice is ground；
(2) add equilibrium liquid 200 μ L, 10,000 rpm to be centrifuged 1 min into DNA adsorption column, waste liquid is abandoned, to DNA adsorption silica gel Column is pre-processed；
(2) sample is placed in centrifuge tube, 600 μ L of lysate is added, mixed, 10,000 rpm of room temperature, be centrifuged 30 s；
(3) supernatant is transferred to processed DNA adsorption column, 10,000 rpm of room temperature is centrifuged 1 min, abandons waste liquid；
(4) 600 μ L of DNA cleaning solution is added into DNA adsorption silica gel column, 10,000 rpm of room temperature is centrifuged 1 min, after abandoning waste liquid DNA adsorption silica gel column sleeve is returned into waste collection pipe, 10,000 rpm of room temperature is centrifuged 1 min；
(5) DNA adsorption column is moved on in 1.5 new mL centrifuge tubes, uncaps and place 1-2 min removal ethyl alcohol residual, 30- is added 100 65 DEG C of μ L preheating ethidium bromides stand 2 min；
(6) 12,000 rpm are centrifuged 2 min, collect DNA eluent.
After measured, mentioned mycelium DNA concentration is 198 ng/ μ L,OD 260/OD 280It is 1.813；Mentioned DNA of fruiting body is pure Degree is 277 ng/ μ L,OD 260/OD 280It is 1.869.
2 variety classes mushroom DNA of embodiment extracts test
(1) sample pretreatment: the Antrodia camphorata fructification, antrodia mycelia, mushroom, ganoderma lucidum, needle mushroom of 2-50 mg are taken respectively Entity sample is ground；
(2) add equilibrium liquid 200 μ L, 10,000 rpm to be centrifuged 1 min into DNA adsorption column, abandon waste liquid, DNA adsorption column is carried out Pretreatment；
(3) sample after grinding is packed into centrifuge tube, 450 μ L of lysate is added, mixed, 10,000 rpm of room temperature, centrifugation 30 s；
(3) supernatant is transferred to processed DNA adsorption column, 10,000 rpm of room temperature is centrifuged 1 min, abandons waste liquid；
(4) 600 μ L of DNA cleaning solution is added into DNA adsorption column, 10,000 rpm of room temperature is centrifuged 1 min, abandons DNA after waste liquid Adsorption column recovers waste collection pipe, and 10,000 rpm of room temperature is centrifuged 1 min；
(5) DNA adsorption column is moved on in 1.5 new mL centrifuge tubes, uncaps and place 1-2 min removal ethyl alcohol residual, is added 65 DEG C DNA eluent 30-100 μ L, 37 DEG C of 30 min of incubation of preheating stand 1-2 min；
(6) 12,000 rpm be centrifuged 2 min, eluted dna, take 2 μ L carry out agarose gel electrophoresis detection, the result is shown in Figure 1, as a result Show to extract above-mentioned five kinds of samples with the inventive method, can obtain the visible genome of electrophoresis.
3 Antrodia camphorata ITS sequence PCR amplification of embodiment
Using edible mushroom ITS segment universal primer ITS-4/5, Antrodia camphorata fructification, antrodia mycelia, ganoderma lucidum dry-eye disease, spirit Sesame fructification, acupuncture needle massee fruiting bodies, mushroom fruiting body DNA carry out PCR detection.
Primer sequence are as follows:
ITS-4: 5’- TCCTCCGCTTATTGATATGC -3’
ITS-5: 5’- GGAAGTAAAAGTCGTAACAAGG -3’
PCR amplification agents useful for same is purchased from Beijing Quan Shijin Biotechnology Co., Ltd, the system of reaction are as follows:
The condition of PCR reaction are as follows: 94 DEG C of 7min → [94 DEG C of 30s → 56 DEG C 30s → 72 DEG C 30s] × 34cicles → 72℃ 10min → 4℃。
Pcr amplification product is detected with 1% agarose gel electrophoresis, and sample-loading buffer is 10 × Loading Buffer, electricity Swimming buffer is 1 × TAE, and molecular weight standard Marker is Trans 15K, and ethidium bromide staining, ultraviolet gel imager exists It observes and takes pictures under 312nm.The result shows that dry with universal primer ITS amplification Antrodia camphorata fructification, antrodia mycelia, ganoderma lucidum Sample, ganoderma lucidum fruitbody, acupuncture needle massee fruiting bodies, mushroom fruiting body ITS segment, all samples can obtain size on the left side 600bp Right purpose band and luminance difference is little (Fig. 2), has wide applicability.
The foregoing is merely presently preferred embodiments of the present invention, all equivalent changes done according to scope of the present invention patent with Modification, is all covered by the present invention.
SEQUENCE LISTING
<110>University Of Agriculture and Forestry In Fujian
<120>a kind of reagent for extracting Antrodia camphorata total DNA and application
<130> 2
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
tcctccgctt attgatatgc 20
<210> 2
<211> 22
<212> DNA
<213>artificial sequence
<400> 2
ggaagtaaaa gtcgtaacaa gg 22

Claims (4)

1. a kind of reagent for extracting Antrodia camphorata total DNA, which is characterized in that including following four reagent:
(1) equilibrium liquid includes following component: the Na of 2wt%2SiO3·9H2The KOH of O, 0.5wt%；
(2) lysate includes following component: the guanidine hydrochloride of 5.0M, the isopropanol of 30%v/v and the PVP- K30 of 2wt%；
(3) DNA cleaning solution includes following component: 20 mM NaCl, 20 mM Tris-HCl, the ethyl alcohol of final concentration of 90%v/v, pH 7.5；
(4) DNA eluent includes following component: 10 mM Tris-HCl, pH 8.5.
2. a kind of method for extracting Antrodia camphorata total DNA using the reagent as described in claim 1, which is characterized in that specifically include Following steps:
(1) add equilibrium liquid 200 μ L, 10,000 rpm to be centrifuged 1 min into DNA adsorption column, abandon waste liquid, DNA adsorption column is carried out Pretreatment；
(2) 500 μ L of lysate is added after grinding the sample of 50 mg, mixes, 10,000 rpm of room temperature, is centrifuged 30 s；
(3) supernatant is transferred to processed DNA adsorption column, 10,000 rpm of room temperature is centrifuged 1 min, abandons waste liquid；
(4) 650 μ L of DNA cleaning solution is added into DNA adsorption column, 10,000 rpm of room temperature is centrifuged 1 min, abandons DNA after waste liquid Adsorption column recovers waste collection pipe, and 10,000 rpm of room temperature is centrifuged 1 min；
(5) DNA adsorption column is moved on in 1.5 new mL centrifuge tubes, uncaps and place 1-2 min removal ethyl alcohol residual, is added 65 The DNA eluent of DEG C preheating, 30-100 μ L, or add 37 DEG C of RNA enzyme 30 min of incubations of 20 μ g/ mL, removal RNA are quiet Set 1-2 min；
(6) 12,000 rpm are centrifuged 2 min, and eluted dna saves backup.
3. a kind of method for extracting Antrodia camphorata total DNA according to claim 2, which is characterized in that the DNA adsorption column is Alumina-silicate ceramic fibre film DNA adsorption column.
4. a kind of reagent for extracting Antrodia camphorata total DNA is extracting edible mushroom total DNA or edible mushroom ITS sequence as described in claim 1 Application in column identification.
CN201811101679.8A 2018-09-20 2018-09-20 It is a kind of extract Antrodia camphorata total DNA reagent and application Withdrawn CN109022426A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811101679.8A CN109022426A (en) 2018-09-20 2018-09-20 It is a kind of extract Antrodia camphorata total DNA reagent and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811101679.8A CN109022426A (en) 2018-09-20 2018-09-20 It is a kind of extract Antrodia camphorata total DNA reagent and application

Publications (1)

Publication Number Publication Date
CN109022426A true CN109022426A (en) 2018-12-18

Family

ID=64617529

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811101679.8A Withdrawn CN109022426A (en) 2018-09-20 2018-09-20 It is a kind of extract Antrodia camphorata total DNA reagent and application

Country Status (1)

Country Link
CN (1) CN109022426A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113549703A (en) * 2020-04-24 2021-10-26 财团法人食品工业发展研究所 Method for identifying antrodia camphorata strains

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113549703A (en) * 2020-04-24 2021-10-26 财团法人食品工业发展研究所 Method for identifying antrodia camphorata strains

Similar Documents

Publication Publication Date Title
CN108624586B (en) Nucleic acid extraction kit and application method thereof
KR101006562B1 (en) Nucleic acid extraction method
US20080176320A1 (en) Selective Lysis of Sperm Cells
CN102154264B (en) Method for rapidly extracting total ribonucleic acid from blood
CN110592072B (en) Extraction method and application of plant genome DNA
CN107779451A (en) A kind of mankind&#39;s dissociative DNA extracting method and its kit
CN102146112B (en) Method for extracting desoxyribonucleic acid from formalin fixed and paraffin embedded tissues
CN112899266A (en) Cracking binding solution for nucleic acid extraction, kit and application thereof
CN103289990A (en) Rapid extraction method of blood deoxyribonucleic acid (DNA)
CN109055361A (en) It is a kind of extract ganoderma lucidum total DNA reagent and its application
CN109022426A (en) It is a kind of extract Antrodia camphorata total DNA reagent and application
KR100454869B1 (en) Cell lysis buffer for extracting DNA and extraction method by using thereof
CN112941067A (en) Lysis binding solution for whole blood nucleic acid extraction and kit and application thereof
CN107119039A (en) It is a kind of to organize not grinding the method for directly extracting nucleic acid
CN111019940A (en) Extracting solution for directly extracting whole blood genome DNA and extracting method thereof
CN108998449A (en) It is a kind of extract grifola frondosus total DNA reagent and its application
CN108998448A (en) It is a kind of extract halimasch total DNA reagent and its application
CN109371110B (en) LAMP (loop-mediated isothermal amplification) detection kit for bacterial canker pathogen of poplar
CN116622909A (en) Isothermal amplification detection reagent and detection method for feline herpesvirus I type
CN109055362A (en) A kind of kit and method extracting long root mushroom genomic DNA
CN109022424A (en) It is a kind of extract dictyophora phalloidea total DNA reagent and application
CN109022425A (en) It is a kind of extract Agricus blazei total DNA reagent and application
CN105296470A (en) Kit for extracting high-purity DNA of colla corii asini and derivative products of colla corii asini, as well as extraction method
CN114525275A (en) Method and kit for applying eutectic solvent to DNA extraction and DNA extraction
CN114525274A (en) Lysate and centrifugation column method virus nucleic acid extraction kit based on lysate

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WW01 Invention patent application withdrawn after publication
WW01 Invention patent application withdrawn after publication

Application publication date: 20181218