CN108982876B

CN108982876B - Application of SAA1 detection agent in preparation of kit for diagnosing Henoch-Schonlein purpura nephritis

Info

Publication number: CN108982876B
Application number: CN201810982489.5A
Authority: CN
Inventors: 何强; 金娟; 李一文; 龚建光; 赵黎
Original assignee: Zhejiang Provincial Peoples Hospital
Current assignee: Zhejiang Provincial Peoples Hospital
Priority date: 2018-08-27
Filing date: 2018-08-27
Publication date: 2021-09-17
Anticipated expiration: 2038-08-27
Also published as: CN108982876A

Abstract

The invention relates to a novel anaphylactoid purpura nephritis disease marker SAA1, and application thereof is researched. Clinical experiments prove that the change of individual serum and urine SAA1 has higher sensitivity and specificity for the diagnosis of anaphylactoid purpura nephritis, and the marker is found to have obvious difference in anaphylactoid purpura, thrombocytopenic purpura and chronic kidney injury. The invention provides a new diagnosis means for clinical diagnosis of the anaphylactoid purpura (nephropathy), and has certain potential clinical value in assisting the treatment and the course monitoring of the anaphylactoid purpura (nephropathy).

Description

Application of SAA1 detection agent in preparation of kit for diagnosing Henoch-Schonlein purpura nephritis

Technical Field

The invention relates to the field of medical diagnosis, in particular to application of an SAA1 detection agent in preparation of a kit for diagnosing Henoch-Schonlein purpura nephritis.

Background

Anaphylactoid purpura (HSP) is an inflammatory disease which involves the whole body of small blood vessels, is clinically mainly characterized in that skin, gastrointestinal tract, joints and kidneys are involved, and organs such as brain, lung and scrotum are also involved, and is pathologically characterized in that immune complex deposition (immune smart fluorescence) mainly comprising immunoglobulin a (IgA) is formed on the small blood vessel wall of the involved organs, and anaphylactoid purpura nephritis (Henoch-Schonlein purpura nephritis, HSPN) is renal parenchyma damage caused by anaphylactoid purpura, and hematuria and/or proteinuria are clinically developed in the course of anaphylactoid purpura (including within 6 months of anaphylactoid purpura) and can be diagnosed as anaphylactoid nephritis.

At present, infection, toxicant, medicament and the like are considered to be important causes of allergic purpura, the upper respiratory tract infection is frequent 1-3 weeks before the allergic purpura of children is developed, and pathogens possibly related to the disease comprise parvovirus B19, hepatitis B virus, hepatitis C virus, adenovirus, beta hemolytic streptococcus, staphylococcus aureus and mycoplasma; poisons and medicines such as insect bites and clarithromycin can be related to the onset of allergic purpura of adults.

Although the specific pathogenesis of anaphylactoid purpura and anaphylactoid purpura nephritis is not clear, many studies provide a great deal of data for further studying the pathogenesis, and in recent years, the studies on the pathogenesis of anaphylactoid purpura are focused on the aspects of gene susceptibility, abnormal glycosylation of the IgA1 hinge region, complement activation cytokines, autoantibodies and the like.

Human Serum Amyloid A (SAA) is an acute phase reaction protein belonging to a heterogeneous class of proteins in the apolipoprotein family and has a molecular weight of about 12000. In the acute phase reaction, SAA is synthesized in the liver by activated macrophages and fibroblasts by stimulation with IL-1, IL-6 and TNF, and can be increased to 1000 times of the initial concentration by 100-fold, but has a short half-life of only about 50 minutes. Previous studies demonstrated that the SAA family consists of four family members, SAA1, SAA2, SAA3 and SAA 4. SAA1, the most major component of the family, is the most widely expressed, most active, and most responsive subtype of the SAA family. Although the SAA1 expression level was low in the normal state, the serum concentration increased 1000-fold in a very short time in the acute phase state. No obvious association of SAA1 with henoch-schonlein purpura nephritis has been found in the prior art.

Disclosure of Invention

The invention relates to a novel marker for anaphylactoid purpura nephritis diseases, and researches on application of the novel marker.

In order to achieve the above purpose of the present invention, the following technical solutions are adopted:

the invention relates to an application of a SAA1 detection agent in preparation of a kit for diagnosing Henoch-Schonlein purpura nephritis.

According to one aspect of the invention, the invention also relates to the use of a SAA1 detection agent for the preparation of a kit for distinguishing between acute kidney injury and chronic kidney injury.

According to one aspect of the invention, the invention also relates to the application of the SAA1 detection agent in the preparation of a kit for distinguishing anaphylactoid purpura nephritis from thrombocytopenic purpura nephritis.

Clinical experiments prove that the change of individual serum and urine SAA1 has higher sensitivity and specificity for the diagnosis of anaphylactoid purpura nephritis, and the marker is found to have obvious difference in anaphylactoid purpura, thrombocytopenic purpura and chronic kidney injury. The invention provides a new diagnosis means for clinical diagnosis of the anaphylactoid purpura (nephropathy), and has certain potential clinical value in assisting the treatment and the course monitoring of the anaphylactoid purpura (nephropathy).

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a graph showing the expression levels of mRNA of SAA1, SAA2, SAA3 and SAA4 in different human populations according to an embodiment of the present invention;

FIG. 2 is a graph showing the protein expression levels of SAA1 in different populations according to an embodiment of the present invention.

Detailed Description

The invention relates to an application of a SAA1 detection agent in preparing a kit for diagnosing Henoch-Schonlein purpura nephritis (particularly acute nephritis complicated with diabetes infection).

Preferably, the kit is for use in the detection of a body fluid of a subject, as described above.

Preferably, the use as described above, wherein the body fluid comprises peripheral blood, serum, plasma, sputum, synovial fluid, aqueous humor, amniotic fluid, breast milk, semen, prostatic fluid, sweat, urine, tears, cyst fluid, pleural fluid, ascites, pericardial fluid, chyle, bile, interstitial fluid, menses, pus, vomit, vaginal secretions, mucosal secretions, pancreatic juice, bronchopulmonary aspirates, blastocoel fluid or umbilical cord blood.

Preferably, the use as described above, wherein the body fluid comprises peripheral blood, serum, plasma, urine.

Preferably, the kit further comprises one or more detection agents for the purpura nephritis biomarkers.

Preferably, the Henoch Schonlein purpura nephritis biomarker is selected from urine podocyte and its associated marker Protein (PCX), monocyte chemotactic protein-1 (MCP-1), macrophage Migration Inhibitory Factor (MIF), neutrophil gelatinase-associated transporter protein (NGAL), urine transforming growth factor beta 1 (TGF-beta 1), tumor necrosis factor-alpha (TNF-alpha), MPO myeloperoxidase, Toll-like receptor 4 (TLR 4), superoxide dismutase (SOD), pentraxin 3 (PTX 3), insulin-like growth factor 1 (IGF-1) Epidermal Growth Factor (EGF), urine protein.

Preferably, the urine protein comprises Albumin (ALB), immunoglobulin g (igg), Soluble transferrin (sTfR), Tamm-horsfll protein, retinol binding protein, for use as described above.

Preferably, for use as described above, the SAA1 detection agent comprises an anti-SAA1 antibody; or; qPCR primers and/or probes for detection of SAA1 mRNA.

The SAA1 detection agent can be used in conjunction with any known quantitative or semi-quantitative protein/mRNA detection method, such as western blot, qPCR, ELISA, flow cytometry, and the like.

The term "antibody" includes polyclonal and monoclonal antibodies and antigenic compound-binding fragments of these antibodies, including Fab, F (ab') 2, Fd, Fv, scFv, diabodies and minimal recognition units of antibodies, as well as single chain derivatives of these antibodies and fragments. The type of antibody can be selected from IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD. Furthermore, the term "antibody" includes naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, chimeric (chimeric), bifunctional (bifunctional) and humanized (humanized) antibodies, as well as related synthetic isomeric forms (isoforms). The term "antibody" is used interchangeably with "immunoglobulin".

According to one aspect of the invention, the invention also relates to the use of a SAA1 detection agent in the preparation of a kit for distinguishing between acute kidney injury (especially acute henoch-schonlein purpura nephritis associated with diabetes) and chronic kidney injury (especially chronic henoch-schonlein nephritis associated with diabetes).

According to one aspect of the invention, the invention also relates to the use of a SAA1 detection agent in the preparation of a kit for distinguishing anaphylactoid purpura nephritis (especially those complicated with diabetes infection) from thrombocytopenic purpura nephritis.

Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1 iTRAQ screening for differential proteins

Part I. screening of urine molecular markers of renal injury

1. The main experimental materials:

urine from patients with renal impairment (diabetic AKI patients, AKI + CKD patients, diabetic CKD patients, non-diabetic IgA CKD patients, non-diabetic non-IgA CKD patients, 50 cases each); healthy population (50 cases); iTRAQ kit.

2. Experimental setup:

2.1 early detection and inclusion criteria for renal patients

2.1.1 AKI inclusion criteria (clinical diagnosis)

Inclusion criteria for early AKI (AKI phase I) were according to the following two criteria: the blood creatinine content is increased by 26.2 mu mol/L within 48 hours or increased to a baseline value of 1.5-1.9 times; the urine volume is less than 0.5ml/Kg/h for more than 6 hours (no more than 12 hours) continuously.

2.1.2 AKI + CKD (CKD-based AKI patients, i.e. CKD-concurrent AKI) inclusion criteria (clinical diagnosis)

And judging whether the patient is the AKI + CKD patient according to the clinical detection indexes.

2.1.3 CKD inclusion criteria (clinical diagnosis)

And (3) detecting blood creatinine (enzyme method), calculating the glomerular filtration rate GFR according to a formula, and when the GFR is in a range of (45-59) ml/min/1.73m2, determining that the patient is an early stage CKD (CKD 3A) patient.

And judging which kind of CKD patients the patient belongs to according to whether the patient has diabetes, IgA nephropathy and the like.

The simplified MDRD formula: GFR (ml/min/1.73 m 2) =186 × [ Scr (mg/dL) ] -1.154 × age-0.203 × 0.742 (female).

The sample providing method comprises the following steps: patient samples: fresh middle-stage morning urine 50ml (normal human sample is increased to 150 ml), is divided into 10 ml/tube, 1ml protease inhibitor is added into every 10ml urine, 4000rpm, 4 degrees are adopted, after centrifugation is carried out for 10 minutes, the centrifuged supernatant is transferred into a freezing tube of 15ml, and is preserved at-80 degrees, and sample concentration is completed by me.

2.2 detection of protein types and content in various early renal injuries

2.2.1 Experimental groups (6 groups)

Urine samples were pooled from 50 patients with Acute Kidney Injury (AKI);

50 cases of AKI + CKD patients mixed urine samples;

urine samples were pooled from 50 diabetic chronic kidney injury (CKD) patients;

mixed urine samples of 50 non-diabetic IgA CKD patients;

urine samples were pooled from 50 non-diabetic non-IgA CKD patients;

urine samples were pooled from 50 healthy subjects.

Each group, 3 in parallel. (three biological replicates, i.e., 150 urine samples per group of patients are provided)

2.2.2iTRAQ Combined with LC-MS/MS technology for protein identification and content analysis (6 groups X2 times)

1. Sample preparation, enrichment and preservation: taking 50ml of fresh middle-end morning urine of patients and healthy people, immediately cooling to 4 ℃, centrifuging for 20min at 2000g, taking supernatant, mixing urine of patients with the same diseases or urine of healthy people, storing in a refrigerator at-80 ℃, or directly performing subsequent operations, thawing urine, and extracting protein by using an acetone precipitation method;

2. protein concentration determination: protein concentration is measured by adopting a BCA method;

3. proteolysis and iTRAQ labeling;

4. performing primary mass spectrometry by using the combination of liquid chromatography and mass spectrometry;

5. performing secondary mass spectrometry;

6. database retrieval and bioinformatics analysis, identification of protein species, and analysis of expression content.

2.3 preliminary screening of potential urine markers

2.3.1 first screening

1. Comparing the types and the contents of the proteins in the mixed urine sample of the AKI patient and the mixed urine sample of the healthy person, and screening out the protein which is abnormally expressed in the AKI patient;

2. comparing the protein types and the protein contents in the mixed urine sample of the AKI + CKD patient and the mixed urine sample of the healthy person, and screening out the protein which is abnormally expressed in the AKI + CKD patient;

3. comparing the types and the contents of the proteins in the mixed urine sample of the diabetic CKD patient and the mixed urine sample of the healthy person, and screening out the protein which is abnormally expressed in the diabetic CKD patient;

4. comparing the types and the contents of the proteins in the non-diabetic IgA CKD patient mixed urine sample and the healthy person mixed urine sample, and screening out the protein abnormally expressed in the early non-diabetic IgA CKD patient;

5. and (3) comparing the types and the contents of the proteins in the non-diabetic non-IgA CKD patient mixed urine sample with the healthy person mixed urine sample, and screening the proteins which are abnormally expressed in the early non-diabetic non-IgA CKD patient.

2.3.2 second screening

1. Comparing the type and amount of protein in urine from non-diabetic CKD (including IgA and non-IgA CKD) patients based on 2.3.1 results, screening for proteins that are aberrantly expressed in both non-diabetic CKD and proteins that are aberrantly expressed only in certain types of non-diabetic kidney damage (i.e. proteins that are aberrantly expressed only in non-diabetic IgA CKD patients and proteins that are aberrantly expressed only in non-diabetic non-IgA CKD patients);

2. based on the results of 2.3.1 and 2.3.2.1 (proteins abnormally expressed in each type of non-diabetic kidney injury), the types and contents of proteins in urine of diabetic CKD and non-diabetic CKD (IgA and non-IgA CKD) renal disease patients were compared, and proteins abnormally expressed in both diabetic CKD and non-diabetic CKD and proteins abnormally expressed specifically in each type of CKD (i.e., proteins abnormally expressed in only diabetic CKD and proteins abnormally expressed in only non-diabetic CKD) were selected;

3. based on the results 2.3.1 and 2.3.2.2 (proteins abnormally expressed in each class of CKD), the types and amounts of proteins in urine of patients with AKI, CKD + AKI, and CKD (diabetic CKD, non-diabetic IgA CKD, non-diabetic non-IgA CKD) were compared, and proteins that were abnormally expressed in each class of kidney injury and proteins that were differentially expressed only in a certain class of kidney injury (i.e., proteins that were differentially expressed only in AKI, proteins that were differentially expressed only in CKD + AKI, and proteins that were abnormally expressed only in CKD) were selected.

2.3.3 third screening

1. According to the 2.3.2.3 result and the 2.3.1 result, screening out the protein which is only abnormally expressed in the urine of the AKI patient and the protein which is only abnormally expressed in the urine of the AKI + CKD patient;

2. screening for proteins that are aberrantly expressed only in diabetic CKD and only in non-diabetic kidney injury based on the 2.3.2.2 and 2.3.1 results;

3. based on the 2.3.2.1 results and 2.3.1 results, proteins that were abnormally expressed only in non-diabetic IgA CKD and proteins that were abnormally expressed only in non-diabetic non-IgA CKD were selected.

As a result: screening out common potential urine markers of kidney injury, screening out AKI specific potential urine markers, screening out AKI + CKD specific potential urine markers, screening out CKD common specific potential urine markers, screening out CKD specific potential urine markers of diabetes, screening out CKD common specific potential urine markers of non-diabetes, screening out CKD specific potential urine markers of non-diabetes IgA, and screening out CKD specific potential urine markers of non-diabetes and non-IgA.

2.4 biological function analysis of potential urine markers

The database, bioinformatics software and analysis method are adopted to analyze the relevance and possible effects (proliferation, apoptosis, survival, inflammation, repair, migration and the like) between the protein factor after 2.2 primary screening and the protein or signal molecules, so as to judge the possible effects and possible molecular mechanisms of the potential urine markers in kidney injury.

Interactions between urine proteins and other proteins were analyzed using the PEIMAP method.

1. Using databases such as BOND (http:// BOND:. unleashing formats. com /), DIP (http:// DIP. do-mbi. ula.edu/DIP), MINT (http:// min. bio. unit A2.it/min /), IntAct (http:// www.ebi.ac.uk/act /), HPRD (http:// www.hprd.org /), meta core, Ingenity Pathway Analysis, Drosophila (http:// www.fruitfly.org /), Arabidopsis thaliana (http:// www.arabidopsis.org /), rice (http:// gene64. dnau. affrec. go. jp/RPD /), slime (http:// gene. vary. org /), etc., and NCBI Blast et al software, the possible interacting proteins of urine markers are analyzed by predicting the principle of protein interaction based on "homology" (i.e., two proteins in one species interact with each other, and then homologous proteins of the two proteins should interact with each other in other species).

2. According to literature and the above results, these proteins which may interact with urine proteins are functionally classified, such as proliferation (cyclins: cyclinD, cycline, etc.; cyclin-dependent kinases: CDK1, CDK2, etc.; cyclin-dependent kinase inhibitors: p21, p53, etc.; and other proliferation regulators), apoptosis (Bax, Bcl-2, p53, Caspase family, Survivin, etc.), interstitial fibrosis (matrix metalloproteinases MMPs and their inhibitors, TIMPs, collagen, cytoskeleton-related proteins and signaling molecules, etc.), oxidative stress, etc.

3. Based on the protein functional classification and 2.3.1 results, the potential role and molecular mechanism of potential urine proteins were analyzed.

Example 2 results relating to SAA1

The fold difference of the protein is more than 1.2 (up-regulation) or less than 0.83 (down-regulation) andp<differential protein was selected at 0.05. Sorting the screened differential proteins of each group according to the fold difference, and selecting the first 10 differential proteins of each group.

Wherein the SAA1 protein is abnormally expressed in urine of AKI patients infected with diabetes mellitus, the up-regulation times are more than 2.4 times, and the SAA1 protein has no obvious change in CKD patients infected with diabetes mellitus.

The protein of interest is obtained by screening and verified in molecular biology.

Example 3 SAA1 is a potential marker for Henoch-Schonlein purpura (HSP) nephritis

1. The main experimental materials:

patients with HSP-renal impairment infected with diabetes were pooled in hematuria (HSP group, AKI type, 50 cases) and renal puncture specimens (7 cases); hematuria of HSP kidney injured patients not infected with diabetes (HSP-non-diabetic group, AKI type, 30 cases); those with diabetes; urine (50) and renal puncture samples (8) from chronic renal injury (CKD) population; urine (AKI type, 50 cases) and renal puncture samples (7 cases) from patients with thrombocytopenic purpura (ITP) renal injury; urine (50 cases) of healthy people. All specimens were retained with patient informed consent and signed with an informed consent form.

2. And (4) reserving a urine specimen:

the hematuria specimens of the anaphylactoid purpura nephritis group, the chronic kidney injury group and the thrombocytopenic purpura group are collected in the morning of the next day after the patient is admitted, and the hematuria specimens of healthy people are collected when the patient is in a clinic. Wherein 5ml of urine and 5m of blood are respectively reserved, the reserved urine is centrifuged at 3000r/min for 10 minutes, and supernate is taken and subpackaged into 200uL of EP tubes, and is frozen at-80 ℃ for standby; centrifuging the retained blood at 3000r/min for 10min, collecting the upper layer serum, subpackaging into 200uL EP tube, and freezing at-80 deg.C;

3. the experimental method comprises the following steps:

3.1 real-time quantitative PCR (qPCR)

1) RNA in the kidney puncture sample is extracted by a Trizol method.

2) Real-time quantitative PCR reaction system

SYBR 10ul

Primer F(10um) 0.5ul

Primer R(10um) 0.5ul

cDNA 2ul

H₂O 7ul

Total 20ul system, belt-supported centrifugation <2000rbpm after sample addition.

2) The primer sequence is as follows:

name (R)	Primer and method for producing the same
		SAA1	Forward 5' GAGGCACTGGCTCTCAGAATG3' Reverse 5’ AGTTGTGCGCTAATGACTGTTT 3’
SAA2	Forward 5' GCTCATCCACTTACCGCATCTTCC 3' Reverse5' CTGCGCCAGCACTGATAGCTCCTT 3'
		SAA3	5’ ACAATGAAGTATAGGAGTACAGTCTACA 3’ Reverse 5' CGAATCCAGCGCCAGC3'
SAA4	Forward 5' TAATGCACACTCTAGAATG3' Reverse 5' CCAAGCGCAGAGTTAAC3'
		β-actin	Forward 5' TCCATCATGAAGTGTGACGT3' Reverse 5'GAGCAATGATCTTGATCTTCAT3'

3) Reaction conditions are as follows:

SAA1 reaction conditions:

95℃ 30s

95℃ 0s

62 ℃ for 5s (annealing temperature)

72℃ 10s

40 cycles

95℃ 0s

65℃ 30s

0.1/continuous cooling at 95 DEG C

40℃ 30s

The annealing temperatures of SAA2, SAA3 and SAA4 are 64 ℃, 63 ℃ and 62 ℃ respectively, and other reaction conditions are the same as those of SAA 1.

The results of the experiment are shown in FIG. 1. Wherein the expression level of SAA1 mRNA was significantly changed only in the HSP group (p＜0.05，vsCKD population). While the remaining groups were unchanged. To further validate the feasibility of SAA1 as an HSP biomarker from the protein level, the inventors next performed further validation from the protein level.

3.2 immunoblotting (Western blot)

1) Protein extraction: the resulting protein was extracted from the renal puncture sample.

2) The specific steps of measuring the protein concentration are the same as ELISA.

3) Immunoblotting (Western blot)

Firstly, glue preparation: the gel was chosen at a concentration of 10% depending on the molecular weight of the protein.

The upper layer adhesive formula comprises:

30% acrylamide	6.67
		Double distilled water	8.10
1.5M Tris 8.8	5.0
		20%SDS	0.1
10%APS	0.1
		TEMED	34µl
Total volume	20ml

The lower layer glue formula comprises:

30% acrylamide	1.67
		Double distilled water	5.68
0.5M Tris 6.8	2.5
		20%SDS	0.05
10%APS	0.1
		TEMED	10µl
Total volume	10ml

The upper and lower layers were combined simultaneously, water, acrylamide, 1.5M Tris, 10% APS, 20% SDS and TEMED were added sequentially.

② adding sample

③ electrophoresis: after the sample is added, the steady flow electrophoresis is carried out, 32mA is used for one piece of glue current, the glue current stops when the voltage slowly rises to about 99V (after about 1 h), and the glue running time can be automatically adjusted according to the molecular weight of the protein to be detected.

Fourthly, film transfer, wherein the film transfer is performed at constant pressure of 100-120V (110V), and the specific steps are as follows:

activating the PVDF membrane in methanol, washing in water, and adding transfer liquid after settling.

And (3) adding transfer liquid into a transfer tank, putting the black splint below, and sequentially putting the sponge, the three layers of filter paper, the glue, the PVDF membrane, the three layers of filter paper and the sponge. And (5) stacking the films neatly, removing bubbles by using a rolling shaft, pressing the films, putting the films into a film rotating groove, and marking film cutting corners.

The membrane transfer time is determined according to the molecular weight of the protein and is about 2 hours.

Sealing the PVDF film: at the end of the membrane transfer, blocking was performed for 1h with blocking solution 5% BSA to remove non-specific binding.

Sixthly, primary anti-incubation: after the blocking solution was poured off, Anti-SAA1 Anti body Clone B333A (dilute with 5% BSA 1:3000) was added and incubated overnight at 4 ℃.

And washing for 3x 10min by TBST.

And incubation of the second antibody:

SAA1 Secondary antibody anti-Human 1:5000, in 5% BSA

Room temperature 1 h.

And ninthly, TBST washing for 3x 10 min.

The color developing liquid for red R is developed for 5min, and then the tablet is pressed in the dark.

The films were statistically analyzed using Image J software and the change in SAA1 was measured as the change in the ratio of SAA1 to tubulin (internal reference).

3.3 ELISA

(1) Protein extraction: according to the following steps of 1:10 to the urine sample, adding protein lysate (TNE: PMSF, NaF, Na3VO4 and Leuppeptin 1:100), turning and mixing uniformly on a silent suspension for 2h, centrifuging and taking the supernatant.

(2) Protein concentration assay (performed with reference to BCA kit instructions):

calculating the amount of the required BCA, preparing mixed solution according to a certain proportion (MA: MB: MC =25:24: 1), adding 150ul of each mixed solution, adding 150ul of each standard product A-I, and preparing a plurality of wells during sample adding.

② because the standard substance is dissolved in 0.9% NaCl, the sample to be measured is diluted with 0.9% NaCl and then loaded with 150ul, and the sample to be measured needs to be perforated again.

Thirdly, shaking for 5s by using a microplate reader to uniformly mix the samples, and then placing the samples in an incubator at 37 ℃ for incubation for 2 h.

Fourthly, taking out the protein from the incubator at 37 ℃, cooling the protein, measuring the absorbance value of the protein by using an enzyme-labeling instrument, and calculating the concentration of the protein.

(3) Sample adding: the 96-well plate is filled with 100ul of standard substance or sample to be tested, and incubated for 2h at 37 ℃.

(4) Washing: washing with washing solution for 4-6 times.

(5) Antigen-antibody reaction: 100ul of antibody working solution was added to each well and incubated at 37 ℃ for 1 h.

(6) After washing sufficiently, 100ul of enzyme-labeled antibody was added and incubated at 37 ℃ for 30 min.

(7) After washing off excess antibody, 100ul of substrate working solution was added to each well and incubated at 37 ℃ for 15 min.

(8) The reaction was stopped and absorbance was measured by microplate reader within 30 min.

The results are shown in the following table:

the SAA1 of the invention is used for HSP detection, has very good sensitivity and can be well distinguished from CKD, ITP and healthy people.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

Claims

Application of SAA1 detection agent in preparation of kit for distinguishing acute Henoch Schonlein purpura nephritis complicated with diabetes infection from chronic Henoch Schonlein purpura nephritis complicated with diabetes infection and acute Henoch Schonlein purpura nephritis not infected with diabetes.
2. The use of claim 1, wherein the kit is for detecting a body fluid of a subject.
3. The use of claim 2, wherein the bodily fluid comprises peripheral blood, sputum, synovial fluid, aqueous humor, amniotic fluid, breast milk, semen, prostatic fluid, sweat, urine, tears, cystic fluid, pleural fluid, ascites, pericardial fluid, chyle, bile, interstitial fluid, menses, pus, vomit, vaginal secretions, mucosal secretions, pancreatic juice, bronchopulmonary aspirates, blastocoel fluid, or umbilical cord blood.
4. The use of claim 1, wherein the SAA1 detection agent comprises an anti-SAA1 antibody; or qPCR primers and/or probes for detecting SAA1 mRNA.