CN108949964A - For detecting the primed probe group and its application of rs12041331 - Google Patents
For detecting the primed probe group and its application of rs12041331 Download PDFInfo
- Publication number
- CN108949964A CN108949964A CN201810951485.0A CN201810951485A CN108949964A CN 108949964 A CN108949964 A CN 108949964A CN 201810951485 A CN201810951485 A CN 201810951485A CN 108949964 A CN108949964 A CN 108949964A
- Authority
- CN
- China
- Prior art keywords
- sequence
- component
- probe
- nucleotide
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of for detecting the primed probe group and its application of rs12041331.The present invention protects a kind of primed probe group first, is made of primers F, primer R and probe P；Primers F is single strand dna shown in the sequence 1 of sequence table；Primer R is single strand dna shown in the sequence 2 of sequence table；Probe P is the single strand dna that an end has fluorescent quenching group with fluorophor and another end, and the partial nucleotide in DNA molecular is lock nucleic acid, and the nucleotides sequence of DNA molecular is classified as shown in the sequence 3 of sequence table.The present invention can be used for detecting rs12041331, judge genotype of the sample to be tested based on the site, so that direction of medication usage, has great application and popularization value.
Description
Technical field
The present invention relates to a kind of for detecting the primed probe group and its application of rs12041331.
Background technique
PEAR1 gene is the important gene of the regulation platelet function found in recent years, high in blood platelet and endothelial cell
Degree expression, its phosphorylation can promote the aggregation of blood platelet.The PEAR1 assignment of genes gene mapping of people is in 1q23.1, about 30kbp, packet
Include 23 exons and 22 intrones；Its albumen encoded be it is a kind of with multilist skin growth factor similar to object area across
1 type albumen of film, the albumen are the component parts of extracellular protein interaction zone, and extracellular portion has 15 epidermal growth factors
Increment repetitive unit, has multiple tyrosine and proline, and regional structure intracellular includes 5 proline regions and one
The region NPXY922 is the binding site of phosphorylated tyrosine.
Rs12041331 is a SNP in PEAR1 gene, and there are two kinds of polymorphic forms, G/A, G are wild type,
A is saltant type, and there are three kinds of genotype, respectively GG, GA, AA, polymorphism and the significant phases of PEAR1 expressing quantity in crowd
It closes.
Clopidogrel and aspirin are that clinically common medicament for resisting platelet aggregation, the two use in conjunction are percutaneously to be preced with
Shape arterial Interventional Therapy (Percutaneous coronary intervention, abbreviation PCI) postoperative patient antiplatelet is poly-
Collection treats most common dosage regimen.However, part PCI postoperative patient takes Clopidogrel Ah Si according to routine dose
Woods Antiplatelet therapy is ineffective, and reason may be related with the drug metabolic enzyme gene polymorphism in patient itself liver.
The study found that PEAR1 gene pleiomorphism is most related to therapeutic effect of aspirin, then Cardia cevent occurs carriers of mutation
Probability dramatically increases.Controllable 3 kinase of PI3K/PTEN(phosphatidylinositol of PEAR1 gene, phosphatidyl-4
3 kinases of alcohol, pentaerythritol tetranitrate pentaerythritol tetranitrate) access, influence the function of blood platelet.
PEAR1 gene has activation blood platelet, the proliferation of reduction megakaryoblast (platelet progenitor), the aggregation of influence blood platelet anti-
Functions should be waited, it is associated with the diseases such as coronary heart disease and viscous mass formed by blood stasis.Therefore, PEAR1 gene pleiomorphism will will lead to aspirin and resist
There is significant individuation difference in anti-platelet therapy effect.GG allele is preferable to aspirin platelet effects response；
GA/AA genotype, with aspirin (or combining clopidogrel), PCI patient, heart infarction and the death rate are higher.PEAR1 AA and AG
Genotype person, standard care, heart infarction and mortality risk are 2.03 ~ 3.97 times of GG genotype.
Summary of the invention
The object of the present invention is to provide a kind of for detecting the primed probe group and its application of rs12041331.
The present invention protects a kind of primed probe group first, is made of primers F, primer R and probe P；
Primers F is following (a1) or (a2):
(a1) single strand dna shown in the sequence 1 of sequence table；
(a2) have by sequence 1 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 1 identical
The DNA molecular of function；
Primer R is following (b1) or (b2):
(b1) single strand dna shown in the sequence 2 of sequence table；
(b2) have by sequence 2 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 2 identical
The DNA molecular of function；
Probe P is the single strand dna that an end has fluorescent quenching group with fluorophor and another end, and
Partial nucleotide in DNA molecular is lock nucleic acid, and the nucleotides sequence of DNA molecular is classified as following (c1) or (c2):
(c1) shown in the sequence 3 of sequence table；
(c2) by sequence 3 by the substitution and/or deletion and/or addition of one or several nucleotide.
Probe P is 5 ' ends with FAM fluorophor and 3 ' ends have the single stranded DNA point of BHQ1 fluorescent quenching group
Son.
Specifically, the nucleotide sequence of the probe P is as shown in the sequence 3 of sequence table, and 2-4 nucleotide and
23-25 nucleotide are lock nucleic acid.
In the primed probe group, the mol ratio of primers F, primer R, probe P are as follows: 15:5:10.
The present invention also protects the primed probe group preparing the application in the kit for detecting rs12041331.
The present invention also protects a kind of for detecting the kit of rs12041331, including the primed probe group.
The present invention also protects component first and component second preparing the application in the kit for detecting rs12041331；
Component first is the primed probe group；Component second is that reagent or reagent combine, and the function of component second is to be prepared to use with blood sample
In the template samples of quantitative fluorescent PCR.Component second includes lysate.The lysate is that the NaCl of 1.5-2 g/100ml is water-soluble
Liquid, concretely the NaCl aqueous solution of 1.7 g/100ml.Component second further includes saving liquid.Save the preparation method of liquid: 1. by 25
Parts by volume FG buffer and the mixing of 4 parts by volume Proteinase K Solutions, obtain mixed liquor；2. 1. mixing that 1 parts by volume step is obtained
Liquid and 5 parts by volume ddH2O mixing obtains saving liquid.
The present invention also protects a kind of for detecting the kit of rs12041331, including component first and component second；Component first
For the primed probe group；Component second is that reagent or reagent combine, and the function of component second is to be used for fluorescence with blood sample preparation
The template samples of quantitative PCR.Component second includes lysate.The lysate is the NaCl aqueous solution of 1.5-2 g/100ml, specifically
It can be the NaCl aqueous solution of 1.7 g/100ml.Component second further includes saving liquid.Save the preparation method of liquid: 1. by 25 parts by volume
FG buffer and the mixing of 4 parts by volume Proteinase K Solutions, obtain mixed liquor；2. 1. mixed liquor and 5 that 1 parts by volume step is obtained
Parts by volume ddH2O mixing obtains saving liquid.
The present invention also protects a kind of kit, including lysate.The function of the kit is with blood sample preparation for glimmering
The template samples of Fluorescent Quantitative PCR.The lysate is the NaCl aqueous solution of 1.5-2 g/100ml, concretely 1.7 g/100ml
NaCl aqueous solution.The kit further includes saving liquid.Save the preparation method of liquid: 1. by 25 parts by volume FG buffers and 4
The mixing of parts by volume Proteinase K Solution, obtains mixed liquor；2. 1. mixed liquor and 5 parts by volume ddH that 1 parts by volume step is obtained2O
Mixing obtains saving liquid.
A kind of method that the present invention also protects template samples with blood sample preparation for quantitative fluorescent PCR, including such as
Lower step:
(1) anticoagulation is taken, the lysate is added, is mixed by inversion, supernatant is abandoned in centrifugation；
(2) after completing step (1), the preservation liquid, 60-70 DEG C first (concretely 65 DEG C) water-bath, then 80-90 DEG C of (tool is added
Body can be 85 DEG C) water-bath, it is then centrifuged for, when use takes supernatant, as template samples.
The method of the template samples with blood sample preparation for quantitative fluorescent PCR, specifically comprises the following steps:
(1) 65 μ L EDTA anticoagulations are taken, lysate described in 500 μ L of addition is mixed by inversion, 12000rpm centrifugation 4min, in abandoning
Clearly；
(2) it after completing step (1), is added and saves liquid described in 120 μ L, first 65 DEG C of water-bath 10min, then 85 DEG C of water-bath 10min, then
12000rpm is centrifuged 4min, is subsequently placed in 4 DEG C and saves backup, and when use takes supernatant, as template samples.
The present invention also protects specific probe carrying out the application in fluorescence quantitative PCR detection；The specific probe be with
The molecular beacon of lock nucleic acid modification.
The present invention also protects a kind of specific probe for fluorescence quantitative PCR detection, for the molecule modified with lock nucleic acid
Beacon.
Any description above rs12041331 is the 73rd of nucleotide shown in the sequence 4 of sequence table in human gene group DNA
Nucleotide.
Nucleosides shown in sequence 4 of any description above rs12041331 for sequence table in the PEAR1 gene in human genome
73rd nucleotide of acid.
The present invention is directed to detect the Genotyping of most important mononucleotide polymorphism site in PEAR1 gene, determine to suffer from
The drug metabolic rate type of person improves drug and uses to help doctor correctly to select drug and reasonably adjust drug dose
Validity, and reduce toxic side effect.
Primed probe group provided by the invention using molecular beacon as probe, and introduces several lock nucleic acids.Molecule
Beacon is a kind of fluorescence probe, by ring-shaped area and stem district's groups at the 5' end mark fluorophor in stem area, the end 3' is marked
Remember quencher, is in hairpin structure when closure, the fluorescence that fluorophor issues is quenched group absorptions, whole not issue fluorescence letter
Number.In the presence of target sequence, in conjunction with target sequence, stem part is forced to open ring portion, fluorophor far from quenching group,
Issue fluorescence.Δ Tm value very little between nucleotide chain with mononucleotide difference, general detection means are difficult to differentiate between.Lock nucleic acid
It is a kind of double-ring oligonucleotide derivative, base pair complementarity principle can be followed in conjunction with nucleic acid, the β-D- in structure
2'-O and 4'-C of ribofuranose act on forming Oxymethylene bridge, sulphur methylene bridge or amine methylene bridge by shrink, and even
It is connected into annular, this annular bridge has locked the N configuration of furanose C3'- inner mold, reduces the flexibility of ribose structure, increases
The stability of phosphate backbone partial structurtes.In LNA/DNA heteroduplex, one LNA monomer of every increase, Tm improves 2-6 DEG C.
The application method of primed probe group provided by the invention: template samples are prepared with blood sample, then use primer
Probe groups carry out unbalanced fluorescent quantitative PCR, judge genotype by observing melting curve.Imbalance amplification: it is added
The excessive and reversed primer of probe, a small amount of primer in the same direction with probe and suitable probe P, after amplification, due to
Side primer is present in excess, and the template strand that participation amplification obtains is extra far more than the chain obtained with other side primer amplification
The not formed double-strand of template strand, the individualism in system.
The method of template samples provided by the invention with blood sample preparation for quantitative fluorescent PCR, it is easy to operate,
Product may be implemented to carry out effective fluorescent quantitative PCR as template.
Provided by the present invention for the specific probe of fluorescence quantitative PCR detection, for the molecular beacon modified with lock nucleic acid.
The Tm value of nucleotide combination double-strand can be significantly improved due to introducing lock nucleic acid.By controlling the temperature change of melting curve,
To control the closure of molecular beacon, analyzes to obtain fluorescence curve by data and change corresponding peak value map and distinguish open country well
The mutation chain of raw chain and unit point.In addition, will appear two peaks in the peak value map of melting curve for heterozygous sample
Value, avoids general PCR and expands the cumbersome of definitive result twice.
The present invention can be used for detecting rs12041331, judge genotype of the sample to be tested based on the site, to instruct to use
Medicine has great application and popularization value.
Detailed description of the invention
Fig. 1 is the melting curve of exemplary sample (GG is homozygous).
Fig. 2 is the melting curve of exemplary sample (AA is homozygous).
Fig. 3 is the melting curve (GA heterozygous) of exemplary sample.
Fig. 4 is the melting curve of exemplary sample (GG is homozygous).
Fig. 5 is the melting curve of exemplary sample (AA is homozygous).
Fig. 6 is the melting curve (GA heterozygous) of exemplary sample.
Fig. 7 is the melting curve of exemplary sample (GG is homozygous).
Fig. 8 is the melting curve of exemplary sample (AA is homozygous).
Fig. 9 is the melting curve (GA heterozygous) of exemplary sample.
Specific embodiment
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly
What routine biochemistry reagent shop was commercially available.Quantitative test in following embodiment is respectively provided with three repeated experiments, as a result makes even
Mean value.Unless otherwise specified, each nucleotide in primer, probe and target sequence is the nucleotide on conventional meaning.
Embodiment 1, the design of primed probe group for detecting rs12041331
By largely designing, preliminary experiment, effect compare, obtain one group for detecting the primed probe group of rs12041331.
Primers F: 5'- CCTATGCTACATGACTTCCCAGAGA -3'；
Primer R:5'- GGATTAGAGTTCCTGGTGGACAAGA -3'；
Probe P:5'-FAM-AGACGGAAGTGAGACAGCAGAAGTCA-BHQ1-3'。
Primers F is single strand dna shown in the sequence 1 of sequence table.Primer R is single-stranded shown in the sequence 2 of sequence table
DNA molecular.Probe P is 5 ' ends with FAM fluorophor and 3 ' ends have the single stranded DNA point of BHQ1 fluorescent quenching group
Son, the nucleotide sequence of DNA molecular is as shown in the sequence 3 of sequence table, nucleotide (i.e. the 2nd, the 3rd, the of underscore mark
4, the 23rd, the 24th and the 25th) it is lock nucleic acid (LNA).
The target sequence of primers F and primer R are as shown in the sequence 4 of sequence table.
The application of embodiment 2, primed probe group for detecting rs12041331
One, blood sample processing (processing method of single blood sample)
1,65 μ L EDTA anticoagulations are taken, 500 μ L lysates are added, are mixed by inversion, 12000rpm is centrifuged 4min, abandons supernatant.
Lysate are as follows: 1.7g/100ml NaCl aqueous solution.
2, after completing step 1,120 μ L is added and save liquid, first 65 DEG C of water-bath 10min, then 85 DEG C of water-bath 10min, then
12000rpm is centrifuged 4min, is subsequently placed in 4 DEG C and saves backup, and when use takes supernatant, as template samples.
It saves the preparation method of liquid: 1. 25 parts by volume FG buffers and 4 parts by volume Proteinase K Solutions being mixed, are mixed
Close liquid；2. 1. mixed liquor and 5 parts by volume ddH that 1 parts by volume step is obtained2O mixing obtains saving liquid.
FG buffer: the Buffer FG in poba gene group DNA extraction system (0.1-20ml) (DP319) kit.Egg
White enzyme K solution: the Proteinase K in poba gene group DNA extraction system (0.1-20ml) (DP319) kit, concentration are
20mg/ml.The producer of poba gene group DNA extraction system (0.1-20ml) (DP319) is that Tiangeng biochemical technology (Beijing) is limited
Company.
Two, the amplification of PCR and the acquisition of fluorescence signal
1, it takes EP to manage, each component is added, prepare reaction system.
Reaction system: 7.5 μ L 2 × Reaction Buffer, 0.12 μ L Taq archaeal dna polymerase solution (Taq containing 0.6U
Archaeal dna polymerase), 0.09 μ L dNTP solution (in dNTP solution contain dATP, dCTP and dGTP, dATP, dCTP and dGTP exist
Concentration in dNTP solution is 33mmol/L), (in dUTP solution, the concentration of dUTP is 100mmol/ to 0.06 μ L dUTP solution
L), 0.06 μ L UDG enzyme solutions (enzyme of UDG containing 0.12U), 3 μ L 5 × PCR Enhancer, 0.3 μ L primers F solution, 0.3 μ L draw
DdH is added in the template samples that object R solution, 0.3 μ L probe P solution, 1 μ L step 1 obtain2O to 15 μ L.In reaction system, draw
The concentration of object F is 15 μM, and the concentration of primer R is 5 μM, and the concentration of probe P is 10 μM.
Buffer: Fei Peng Biological Co., Ltd. of 2 × Reaction.Taq DNA polymerase solution, that is, AnstartTaq
DNA Polymerase, 5U/ μ L, Fei Peng Biological Co., Ltd..UDG enzyme solutions, that is, Uracil-DNA Glycosylase,
2U/ μ L, Fei Peng Biological Co., Ltd..5 × PCR Enhancer: Tiangeng biochemical technology Co., Ltd, article No. RP202.
2, the EP pipe for taking into step 1, is added 25 μ L paraffin.
3, the EP pipe for taking into step 2, carries out quantitative fluorescent PCR.
①50℃ 2min,95℃ 10min；
2. 95 DEG C of 15s, 55 DEG C of 15s, 72 DEG C of 20s, 50 circulations；
③95℃ 5min,20℃ 5min；45 DEG C of 1s, it is then heated up for interval up to 75 DEG C (every since 45 DEG C with 0.3 DEG C
A temperature acquisition fluorescence obtains melting curve) and then 75 DEG C of 15s.
If being shown as unimodal in melting curve, and the corresponding Tm value of peak value is 62.5 DEG C -64.1 DEG C, sample is based on
The genotype of rs12041331 is that GG is homozygous.
If being shown as unimodal in melting curve, and the corresponding Tm value of peak value is 55.0 DEG C -56.6 DEG C, sample is based on
The genotype of rs12041331 is that AA is homozygous.
If being shown as bimodal in melting curve, and the peak value at two peaks respectively corresponds 55.0 DEG C -56.6 DEG C and 62.5
DEG C -64.1 DEG C, genotype of the sample based on rs12041331 is GA heterozygous.
To volunteer's EDTA anticoagulation of 500 informed consents, then detected according to above-mentioned steps, 112
The genotype of volunteer is that GG is homozygous, genotype of 97 volunteers are that AA is homozygous, genotype of 291 volunteers are GA
Heterozygous.It extracts the anticoagulant genomic DNA of EDTA and carries out sequence verification, sequencing result shows the standard of above-mentioned steps identification
True rate is 100%.
In volunteer's EDTA anticoagulation of 500 informed consents, the result is shown in Figure 1s of 3 exemplary samples, Fig. 2 and
Fig. 3.It is shown as unimodal in the melting curve of exemplary sample in Fig. 1, the corresponding Tm value of peak value is 63.8 DEG C, the base of the volunteer
Because type is that GG is homozygous.It is shown as unimodal in the melting curve of exemplary sample in Fig. 2, the corresponding Tm value of peak value is 55.9 DEG C,
The genotype of the volunteer is that AA is homozygous.It is shown as bimodal in the melting curve of exemplary sample in Fig. 3, the corresponding Tm of peak value
Value is respectively 56.0 DEG C and 63.1 DEG C, and the genotype of the volunteer is GA heterozygous.
Comparative example 1,
One, blood sample is handled
With the step of embodiment 2 one.
Two, the amplification of PCR and the acquisition of fluorescence signal
1, it takes EP to manage, each component is added, prepare reaction system.
Replace probe P with probe DP, other with the step of embodiment 2 two 1.
Probe DP:5'-FAM- AGACGGAAGTGAGACAGCAGAAGTCA-BHQ1-3'.
2, the EP pipe for taking into step 1, is added 25 μ L paraffin.
3, the EP pipe for taking into step 2, carries out quantitative fluorescent PCR.
Response procedures with the step of embodiment 2 one 3.
To 500 parts of EDTA anticoagulations in embodiment 2, then detected according to above-mentioned steps.
The sample standard deviation of each genotype is shown without effective peak.
The result of 3 exemplary samples is shown in Fig. 4 (GG is homozygous), Fig. 5 (AA is homozygous) and Fig. 6 (GA heterozygous).
Comparative example 2,
One, blood sample is handled
With the step of embodiment 2 one.
Two, the amplification of PCR and the acquisition of fluorescence signal
1, it takes EP to manage, each component is added, prepare reaction system.
Replace primers F with primer DF, and replace primer R with primer DR, other with the step of embodiment 2 two 1.
DF:5'-GACCTATGCTACATGACTTCCCAG-3'；
DR:5'- GACGGATTAGAGTTCCTGGTGGA-3'.
2, the EP pipe for taking into step 1, is added 25 μ L paraffin.
3, the EP pipe for taking into step 2, carries out quantitative fluorescent PCR.
Response procedures with the step of embodiment 2 one 3.
To 500 parts of EDTA anticoagulations in embodiment 2, then detected according to above-mentioned steps.
The sample standard deviation of each genotype is shown without effective peak.
The result of 3 exemplary samples is shown in Fig. 7 (GG is homozygous), Fig. 8 (AA is homozygous) and Fig. 9 (GA heterozygous).
Sequence table
<110>Weifang De-Nol Tyke Biotechnology Co., Ltd
<120>for detecting the primed probe group and its application of rs12041331
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
cctatgctac atgacttccc agaga 25
<210> 2
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
ggattagagt tcctggtgga caaga 25
<210> 3
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
agacggaagt gagacagcag aagtca 26
<210> 4
<211> 134
<212> DNA
<213> Homo sapiens
<220>
<221> misc_feature
<222> (73)
<223> r =g or a
<400> 4
cctatgctac atgacttccc agagaagctg gaagggagcc cgtggggaag tcccttctgc 60
tgtctcactt ccrtcaccct tactctctgc tttctataga aatggatcct cttgtccacc 120
aggaactcta atcc 134
Claims (10)
1. primed probe group is made of primers F, primer R and probe P；
Primers F is following (a1) or (a2):
(a1) single strand dna shown in the sequence 1 of sequence table；
(a2) have by sequence 1 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 1 identical
The DNA molecular of function；
Primer R is following (b1) or (b2):
(b1) single strand dna shown in the sequence 2 of sequence table；
(b2) have by sequence 2 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 2 identical
The DNA molecular of function；
Probe P is the single strand dna that an end has fluorescent quenching group with fluorophor and another end, and
Partial nucleotide in DNA molecular is lock nucleic acid, and the nucleotides sequence of DNA molecular is classified as following (c1) or (c2):
(c1) shown in the sequence 3 of sequence table；
(c2) by sequence 3 by the substitution and/or deletion and/or addition of one or several nucleotide.
2. primed probe group as described in claim 1, it is characterised in that: the nucleotide sequence such as sequence table of the probe P
Shown in sequence 3, and 2-4 nucleotide and 23-25 nucleotide are lock nucleic acid.
3. primed probe group as claimed in claim 1 or 2 is preparing the application in the kit for detecting rs12041331.
4. a kind of for detecting the kit of rs12041331, including primed probe group as claimed in claim 1 or 2.
5. component first and component second are preparing the application in the kit for detecting rs12041331；Component first is claim
The 1 or 2 primed probe groups；Component second is that reagent or reagent combine, and the function of component second is with blood sample preparation for glimmering
The template samples of Fluorescent Quantitative PCR.
6. a kind of for detecting the kit of rs12041331, including component first and component second；Component first is claims 1 or 2
The primed probe group；Component second is that reagent or reagent combine, and the function of component second is fixed for fluorescence with blood sample preparation
Measure the template samples of PCR.
7. a kind of kit of the template samples with blood sample preparation for quantitative fluorescent PCR, including lysate；The cracking
Liquid is the NaCl aqueous solution that the lysate is 1.5-2 g/100ml.
8. a kind of method of the template samples with blood sample preparation for quantitative fluorescent PCR, includes the following steps:
(1) anticoagulation is taken, lysate described in claim 7 is added, is mixed by inversion, supernatant is abandoned in centrifugation；
(2) it after completing step (1), is added and saves liquid, first 60-70 DEG C of water-bath, then 80-90 DEG C of water-bath is then centrifuged for, and when use takes
Supernatant, as template samples.
9. specific probe is carrying out the application in fluorescence quantitative PCR detection；The specific probe is point modified with lock nucleic acid
Sub- beacon.
10. a kind of specific probe for fluorescence quantitative PCR detection, for the molecular beacon modified with lock nucleic acid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810951485.0A CN108949964A (en) | 2018-08-21 | 2018-08-21 | For detecting the primed probe group and its application of rs12041331 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810951485.0A CN108949964A (en) | 2018-08-21 | 2018-08-21 | For detecting the primed probe group and its application of rs12041331 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108949964A true CN108949964A (en) | 2018-12-07 |
Family
ID=64470921
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810951485.0A Pending CN108949964A (en) | 2018-08-21 | 2018-08-21 | For detecting the primed probe group and its application of rs12041331 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108949964A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111593106A (en) * | 2019-02-21 | 2020-08-28 | 葛猛 | Artificial mimic nucleic acid molecular beacon and kit for detecting polymorphism of rs12041331 locus of PEAR1 gene |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009007726A2 (en) * | 2007-07-10 | 2009-01-15 | European Cardiovascular Genetics Foundation | Abnormal blood conditions |
| WO2012031008A2 (en) * | 2010-08-31 | 2012-03-08 | The General Hospital Corporation | Cancer-related biological materials in microvesicles |
| CN105671142A (en) * | 2015-09-10 | 2016-06-15 | 南京仁天生物科技有限公司 | Kit for detecting human PEAR1 gene polymorphism and application thereof |
| CN108060230A (en) * | 2018-02-07 | 2018-05-22 | 山东德诺生物科技有限公司 | For detecting the primed probe group of rs1045642 and its application |
-
2018
- 2018-08-21 CN CN201810951485.0A patent/CN108949964A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009007726A2 (en) * | 2007-07-10 | 2009-01-15 | European Cardiovascular Genetics Foundation | Abnormal blood conditions |
| WO2012031008A2 (en) * | 2010-08-31 | 2012-03-08 | The General Hospital Corporation | Cancer-related biological materials in microvesicles |
| CN105671142A (en) * | 2015-09-10 | 2016-06-15 | 南京仁天生物科技有限公司 | Kit for detecting human PEAR1 gene polymorphism and application thereof |
| CN108060230A (en) * | 2018-02-07 | 2018-05-22 | 山东德诺生物科技有限公司 | For detecting the primed probe group of rs1045642 and its application |
Non-Patent Citations (3)
| Title |
|---|
| MUPENG LI等: "Association of PEAR1 rs12041331 polymorphism and pharmacodynamics of ticagrelor in healthy Chinese volunteers", 《XENOBIOTICA》 * |
| PARAS N. PRASAD著: "《生物光子学导论》", 31 October 2006, 浙江大学出版社 * |
| 邢晓清等: "焦磷酸测序技术对阿司匹林个体化用药相关SNP位点分型", 《中国药科大学学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111593106A (en) * | 2019-02-21 | 2020-08-28 | 葛猛 | Artificial mimic nucleic acid molecular beacon and kit for detecting polymorphism of rs12041331 locus of PEAR1 gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108060230A (en) | For detecting the primed probe group of rs1045642 and its application | |
| KR101153058B1 (en) | Primer set for amplification of ugt1a1 gene, reagent for amplification of ugt1a1 gene comprising the same, and use of the same | |
| KR20100080621A (en) | Method for amplification of target nucleic acid sequence, method for detection of mutation by using the method, and reagents for use in the methods | |
| WO2010108325A1 (en) | Loop-shaped primer employed in nucleic acid amplification and the use thereof | |
| KR20080100429A (en) | Primer set for amplification of cyp2c19 gene, reagent for amplification of cyp2c19 gene comprising the same, and use of the same | |
| KR20090012222A (en) | Primer set for gene amplification, gene amplification reagent containing the same and use thereof | |
| EP2025764B1 (en) | Probe for detection of mutation in abl gene and use thereof | |
| KR20160106040A (en) | Compositions and methods for multimodal analysis of cmet nucleic acids | |
| CA2865163A1 (en) | Multimodal pcr target detection | |
| EP2450443B1 (en) | Target sequence amplification method, polymorphism detection method, and reagents for use in the methods | |
| KR20160106041A (en) | Compositions and methods for multiplex analysis of nras and braf nucleic acids | |
| CN108949964A (en) | For detecting the primed probe group and its application of rs12041331 | |
| CN102199662B (en) | Primer set for amplification of SULT1A1 gene, reagent for amplification of SULT1A1 gene containing same, and uses thereof | |
| CN108929906A (en) | For detecting the primed probe group and its application of rs1799889 | |
| CN106520948B (en) | Reverse probe, kit and detection method for visually detecting single nucleotide polymorphism sites in gene sequence | |
| KR101068605B1 (en) | Primer set for amplification of nat2 gene, reagent for amplification of nat2 gene comprising the same, and use of the same | |
| CN108949966A (en) | For detecting the primed probe group and its application of rs1801133 | |
| CN109371019A (en) | For detecting the primed probe group and its application of rs6065 | |
| US20080305470A1 (en) | Nucleic Acid Sequencing | |
| CN108949996A (en) | For detecting the primed probe group and its application of rs1695 | |
| CN109055526A (en) | For detecting the primed probe group and its application of rs662 | |
| CN109022430A (en) | For detecting the primed probe group and its application of rs730012 | |
| CN109055527A (en) | For detecting the primed probe group and its application of rs4149056 | |
| CN109371115A (en) | For detecting the primed probe group and its application of rs5918 | |
| CN108929913A (en) | For detecting the primed probe group and its application of rs2032582 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20181207 |
|
| WD01 | Invention patent application deemed withdrawn after publication |