CN108823211A - A kind of CD19 aptamer and its application - Google Patents
A kind of CD19 aptamer and its application Download PDFInfo
- Publication number
- CN108823211A CN108823211A CN201810421653.5A CN201810421653A CN108823211A CN 108823211 A CN108823211 A CN 108823211A CN 201810421653 A CN201810421653 A CN 201810421653A CN 108823211 A CN108823211 A CN 108823211A
- Authority
- CN
- China
- Prior art keywords
- aptamer
- sequence
- cell
- albumen
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
- G01N33/57492—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving compounds localized on the membrane of tumor or cancer cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
Abstract
The present invention provides a kind of CD19 aptamer, and the nucleotide sequence of the aptamer is as shown in SEQ ID No.1, or is sequence of the sequence after missing or extension shown in SEQ ID No.1.Aptamer provided by the invention can be with higher affinity and specific binding CD19 albumen, and it can identify the lymphoma cell of the CD19 positive, it is combined weaker with intersecting for other albumen and negative cells simultaneously, is expected to the new ligand molecular as CD19 positive lymphomas targeted therapy.
Description
Technical field
The invention belongs to field of biotechnology, are related to a kind of novel nucleic acids aptamers, and in particular to a kind of specific recognition
Target molecules CD19, and can be with the CD19 aptamer in conjunction with CD19 positive tumor cell.
Background technique
Lymthoma (Lymphoma) is a kind of malignant tumour originating from lymphohematological that disease incidence rises year by year, can
It is divided into Hodgkin lymphoma (Hodgkin ' s lymphoma, HL) and non-Hodgkin lymphoma (Non Hodgkin ' s
Lymphoma, NHL).Wherein, non-Hodgkin lymphoma is a kind of general name with very strong heterogeneous independent disease, lesion
The lymphoid organs such as lymph node, thymus gland, spleen are taken place mostly in, lymphoid tissue and organ except lymph node can also be betided.With
The Hodgkin lymphoma for belonging to lymthoma is compared, and the disease incidence of non-Hodgkin lymphoma will be significantly higher than Hodgkin lymphoma,
Its disease incidence constantly risen and its damage serious to whole body multiple organ have made it human health and life quality
One big killer.Currently, chemotherapy is to treat one of the main method of non-Hodgkin lymphoma.However, not due to traditional chemotherapeutic
Normal cell and tumour cell can be distinguished, normal tissue cell can be also killed while killing tumour cell, be brought sternly to patient
The toxic side effect of weight.Therefore it is badly in need of new treatment method to solve this problem.Targeted therapy, by the way that drug targeting to be delivered to
Tumour cell, killing tumor cell while, reduce the damage to organism normal cell, become a kind of new antitumoral strategy.
In recent years, more and more attention has been paid to compared to traditional radiotherapy and chemotherapy because target for the targeted therapy of lymthoma
Treatment also can reduce the damage of drug normal tissue and cell while playing curative effect of medication.Realize neoplasm targeted therapy,
It needs in the highly expressed target of tumor cell surface, CD19 high is expressed on the malignant cell in B cell source, such as acute
Lymphocytic leukemia, non-Hodgkin lymphoma etc., and in granulocyte, monocyte, thick liquid cell, T cell and other are normal
It is not expressed in tissue and cell, therefore, CD19 is expected to become a good anti-tumor target.Neoplasm targeted therapy also needs energy
The ligand of specific recognition tumor targets, aptamer (Aptamer) are one of which.Aptamer is in structure
A kind of short single stranded DNA or RNA molecule, itself are capable of forming containing stem ring, protrusion, hair clip, false knot or G- tetrad etc.
Complicated Spatial Structure, thus in conjunction with various target specificities, its target can be protein, polypeptide, nucleic acid, amino acid,
Cell, even some metal ions etc..In addition, aptamer have can largely synthesize in vitro, cheap, stability
It the advantages that good, convenient for storage, is expected to provide better strategy for new targeted therapies.Currently, using CD19 as the core of target
Sour aptamers are not yet reported that.
Summary of the invention
To solve the above-mentioned problems, the purpose of the present invention is to provide a kind of new aptamer, the aptamers
Can be with higher affinity and specific binding CD19 albumen, and can identify the lymphoma cell of the CD19 positive, simultaneously
With other albumen and negative cells intersect combined it is weaker.
Another object of the present invention is to provide the applications of above-mentioned aptamer.
To achieve the goals above, the present invention provides a kind of CD19 aptamer, includes the core as shown in SEQ ID No.1
Nucleotide sequence
(5 '-TGCGTGTGTAGTGTGTCTGTTCTCCTTTTTTTGGTTGCTGCTCTTAGGGATTTGGG CGG-3 '),
Or sequence of the nucleotide sequence after missing or extension shown in SEQ ID No.1.
Wherein, the sequence after the missing is listed in 5 ' ends for nucleotides sequence shown in SEQ ID No.1 and clips 8 bases, has
Body sequence is as shown in SEQ ID No.2：
5’-TAGTGTGTCTGTTCTCCTTTTTTTGGTTGCTGCTCTTAGGGATTTGGGCGG-3’。
Wherein, the sequence after the extension is that nucleotides sequence shown in SEQ ID No.1 is listed in 3 ' one section of 20 alkali of end increase
The polyA of base, particular sequence is as shown in SEQ ID No.3：
5’-TGCGTGTGTAGTGTGTCTGTTCTCCTTTTTTTGGTTGCTGCTCTTAGGGATTTGGGCGGAAAAAAA
AAAAAAAAAAAAA-3’。
Wherein, thio-modification is carried out for all base A of the aptamer.
The present invention also provides above-mentioned CD19 aptamers in the tumour medicine for detecting and/or treating the CD19 positive
Application, it is preferable that the tumour be lymthoma.
New aptamer provided by the invention, the aptamer are single stranded DNA (the SEQ ID containing 59 bases
No.1), which can spontaneously form space structure, can be in conjunction with the cell extracellular domain of CD19 albumen, to target point
Sub- CD19 albumen affinity with higher (85.4nM) and specificity, and it is capable of the positive lymph of recognition expression CD19 albumen
Oncocyte, at the same with other albumen and negative cells intersect combined it is weaker.
In addition, wherein truncated sequence is by 5 ' the present invention also provides the sequence that above-mentioned aptamer is truncated or lengthened
End is clipped after 8 bases (SEQ ID No.2), and experiment confirms that the sequence still is able to combine CD19 albumen.Lengthen sequence be
After the polyA (SEQ ID No.3) of the former end of aptamer 3 ' plus one section of 20 base, obtained recruit still is able to combine
CD19.In order to increase the nuclease-resistant characteristic of aptamer, modification appropriate is carried out to aptamer molecule, has been synthesized
When DNA, common adenine is replaced with the adenine of thio-modification, has obtained the aptamer of thio-modification, the nucleic acid
Aptamers still are able to specific binding CD19.
The beneficial effects of the present invention are：
Aptamer provided by the invention affinity with higher and specificity, compared with existing CD19 ligand
Compared with, having largely to synthesize, and it is cheap, it is easy to modify, is easy to save, the advantages such as immunogenicity is low.
Detailed description of the invention
Fig. 1 is the secondary structure figure of CD19 aptamer preferred embodiment provided by the invention.
Fig. 2A is the specific outcome that CD19 aptamer provided by the invention is directed to people CD19 recombinant protein.
Fig. 2 B is the specific outcome that CD19 aptamer provided by the invention is directed to bovine serum albumin(BSA).
Fig. 2 C is the specific outcome that CD19 aptamer provided by the invention is directed to ovalbumin.
Fig. 3 is the measurement result figure of CD19 aptamer affinity costant provided by the invention.
Fig. 4 A to Fig. 4 D be detected respectively using flow cytometer CD19 aptamer and CD19 positive cell (Ramos,
Raji), the combination result figure of CD19 negative cells (Jurkat, NB4).
Fig. 5 A to Fig. 5 B is the knot of CD19 aptamer and CD19 albumen, BSA after being truncated using flow cytomery
Close result figure.
Fig. 6 A to Fig. 6 B is CD19 aptamer and CD19 positive cell, CD19 after being truncated using flow cytomery
The combination result figure of negative cells.
Fig. 7 A to Fig. 7 B be using flow cytomery increase Poly A after CD19 aptamer and CD19 albumen,
The combination result figure of BSA.
Fig. 8 A to Fig. 8 B is the CD19 aptamer and the CD19 positive after increasing Poly A using flow cytomery
The combination result figure of cell, CD19 negative cells.
Fig. 9 A to Fig. 9 B is the CD19 aptamer and CD19 albumen, BSA using flow cytomery thio-modification
Combination result figure.
Figure 10 A to Figure 10 B is positive thin using the CD19 aptamer and CD19 of flow cytomery thio-modification
Born of the same parents, CD19 negative cells combination result figure.
Specific embodiment
The present invention is directed to the design feature of CD19 albumen, devises a kind of completely new DNA aptamers, which can be with
The cell extracellular domain of CD19 albumen combines, and aptamer is as shown in SEQ ID No.1：
5’-TGCGTGTGTAGTGTGTCTGTTCTCCTTTTTTTGGTTGCTGCTCTTAGGGATTTGGGCGG-3’。
Truncated sequence is SEQ ID No.2：
5’-TAGTGTGTCTGTTCTCCTTTTTTTGGTTGCTGCTCTTAGGGATTTGGGCGG-3’。
Extension sequence is SEQ ID No.3：
5’-TGCGTGTGTAGTGTGTCTGTTCTCCTTTTTTTGGTTGCTGCTCTTAGGGATTTGGGCGGAAAAAAA
AAAAAAAAAAAAA-3’
Materials and methods
1. the random single chain DNA of aptamer, truncation, extension sequence and equal length is closed by Invitrogen company
At.
The aptamer of 2.FITC label truncates, extends the random dna of sequence and equal length by Invitrogen
Company's synthesis.
3. people's CD19 recombinant protein is bought from Abcam company, article No. ab168693.
4. bovine serum albumin(BSA) (fifth component) is bought from the Tianjin ocean Hao Biotechnology Co., Ltd, product number：
735108-10。
5. ovalbumin is bought from Amresco company.
6. monodisperse magnetic bead, Streptavidin coating magnetic bead is purchased from Pu Luomaige company, and (magnetic bead surfaces are strepto- parent
It is modified with element).
7. magnetic microsphere Affimag UF, the epoxy group modified Tianjin that is purchased from surface is thought again in happy chromatographic technique exploitation
The heart.
8. cell line：Human B cell lymphoma cell Raji, human B cell lymphoma cell Ramos, human T cell lymphoma are thin
Born of the same parents Jurket, acute promyelocytic leukemia cell NB4 are purchased from Chinese Academy of Medical Sciences's cell centre.
9. cell culture medium RPMI1640 is bought from Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences's cell centre.
10. fetal calf serum (FBS) is bought from Gibico company.
11. penicillin, streptomysin are purchased from Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences's cell centre.
12. flow cytometer Accuri C6 is rented in central laboratory of Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences.
Use below sequence for the CD19 aptamer of SEQ ID No.1 (hereinafter referred to as：Aptamer) as excellent
Select embodiment, the secondary structure of the aptamer as shown in Figure 1, the aptamer of the aptamer and FITC label by
The synthesis of Invitrogen company.
The measurement of the specificity of 1 CD19 aptamer of embodiment
The connection of target and magnetic bead：For the target behaviour CD19 recombinant protein (back abbreviation CD19 albumen) of detection,
CD19 albumen ddH2O dissolution.Firstly, taking 5 × 105A magnetic bead is cleaned 3 times with PBS, and 500 μ l carbonate buffer solutions are then added
(CBS, pH=10.7) is resuspended magnetic bead, 2ug CD19 albumen is mixed with magnetic bead, and room temperature concussion is incubated for 12h, and PBS is washed 3 times,
Magnetic bead is resuspended with PBS again, 4 DEG C save backup.Bovine serum albumin(BSA) (fifth component, BSA), egg white are prepared using same method
Albumen (OVA) is coated with magnetic bead.
Flow cytometry analysis：In order to detect specificity of the aptamer in conjunction with target, by the nucleic acid of FITC label
Aptamers are incubated with people CD19 recombinant protein, BSA or the coated magnetic bead of OVA in 37 DEG C of concussions respectively in 200 μ l PBS buffer solution
30min is educated, PBS is washed 3 times, and magnetic bead, flow cytometry analysis is resuspended in 200 μ l PBS.The random dna of the equal length of FITC label
As random controls.
Black curve indicates that the control fluorescence signal that random single chain DNA generates, Grey curves indicate that CD19 nucleic acid is suitable in figure
The fluorescence signal that ligand generates.
As a result as shown in Fig. 2A to Fig. 2 C, wherein Fig. 2A is aptamer streaming figure in conjunction with CD19 protein-specific,
Fig. 2 B is aptamer and BSA specifically binds streaming figure, and Fig. 2 C is that aptamer and OVA specifically bind streaming figure.
Compared with random controls, aptamer rear fluorescence signal in conjunction with BSA, OVA is extremely weak (Fig. 2 B, 2C), and anti-with CD19 albumen
Should after fluorescence signal significantly increase (Fig. 2A), illustrate aptamer and BSA, OVA have weaker cross reaction, can with compared with
Strong specificity and target CD19 protein binding.
The measurement of embodiment 2CD19 aptamer affinity costant
The measurement of Kd value：The FITC of the coated magnetic bead of target proteins CD19 albumen and various concentration in embodiment 1 is marked
Aptamer washed 3 times in 200 μ l combination buffers (PBS) in 37 DEG C of reaction 30min, PBS, flow cytomery is flat
The random library of equal fluorescence intensity, equal length is used for nonspecific combination, aptamer and target as negative control
In conjunction with average fluorescent strength subtract the average fluorescent strength of random library non-specific binding, according to formula Y=B max X/
(Kd+X)(Y：Average fluorescent strength, X：The concentration of aptamer used, B are a constants, and max is the meaning of maximum value) meter
The Kd value that aptamer and target combine is calculated, as shown in Figure 3.
As can be seen from Figure 3 the Kd value of aptamer and target CD19 albumen is 85.4nM, the results showed that, the nucleic acid
Aptamers and target proteins affinity with higher.
The combination of embodiment 3CD19 aptamer and CD19 positive cell, CD19 negative cells
By human B cell lymphoma cell Raji, human B cell lymphoma cell Ramos, human T cell lymphoma cell
Jurkat, acute promyelocytic leukemia cell NB4 are cultivated respectively containing 10%FBS, normal concentration penicillin and streptomysin
In 1640 culture mediums, cell is set in 37 DEG C, 5%CO2It is cultivated in incubator, cell used in all tests is in logarithmic growth
The cell of phase.2 × 10 are collected respectively5Raji, Ramos, Jurkat and NB4 cell, the nucleic acid of itself and FITC label is adapted to
Body is washed 3 times in 200 μ l PBS in 37 DEG C of reaction 30min, PBS, and flow cytometry analysis is used；FITC label equal length with
Machine DNA is as random controls.
Black curve indicates that the control fluorescence signal that random single chain DNA generates, Grey curves indicate aptamer in figure
The fluorescence signal of generation.
As a result as shown in figure 4, after aptamer and CD19 positive cell Ramos (Fig. 4 A) and Raji (Fig. 4 B) incubation
Fluorescence intensity is significantly higher than random controls, and fluorescence is strong after being incubated for CD19 negative cells Jurkat (Fig. 4 C) and NB4 (Fig. 4 D)
It spends similar to random controls.Above-mentioned experiment shows that CD19 aptamer can specifically combine CD19 positive tumor cell,
And it is weak in conjunction with CD19 negative cells, illustrate that the aptamer is capable of the lymphoma cell surface of recognition expression CD19 albumen
CD19 is expected to become the novel targeted ligand of CD19, provides experiment basis to target the anti-lymphadenoma treatment of CD19.
The combination of aptamer and CD19 albumen and CD19 positive tumor cell after the truncation of embodiment 4
It for the further research of the aptamer in the future and applies, we have carried out above-mentioned aptamer suitably
The truncation of base number.
After 8 bases are clipped at the end of aptamer 5 ', molecular sequences 5 '-
TAGTGTGTCTGTTCTCCTTTTTTTGGTTGCTGCTCTTAGGGATTTGGGCGG-3 ' is synthesized by Invitrogen company
FITC label truncate aptamer and FITC label equal length random single chain DNA, respectively by aptamer, with
Machine single stranded DNA and the magnetic bead of coating CD19 albumen are incubated in 200 μ l PBS systems, after 30min, are washed magnetic bead 3 times with PBS,
The detection of streaming instrument.
Black curve indicates that the control fluorescence signal that random single chain DNA generates, Grey curves indicate nucleic acid after truncating in figure
The fluorescence signal that aptamers generate.
As a result as shown in figure 5, compared with random controls, aptamer after the truncation fluorescence signal in conjunction with BSA is weaker
(Fig. 5 B), and fluorescence signal is relatively strong (Fig. 5 A) after reacting with CD19 albumen, illustrates still to be able to after aptamer truncates with relatively strong
Specificity with target CD19 protein binding.Identical method (with embodiment 3) detects the sequence and CD19 positive cell Ramos
And the combination of negative cells Jurkat, it is found that the sequence and CD19 positive cell Ramos have higher binding force (Fig. 6 A), and with
The combination of CD19 negative cells Jurkat is but very weak (Fig. 6 B).
Embodiment 5 increases the combination of the aptamer and CD19 albumen and CD19 positive tumor cell of Poly A
CD19 aptamer 3 ' is held and increases by 20 base A, sequence 5 '-
TGCGTGTGTAGTGTGTCTGTTCTCCTTTTTTTGGTTGCTGCTCTTAGGGATTTGGGCGGAAAAAAAAAAAAAAAAAA
AA-3 ', by company synthesize FITC label the A containing Poly aptamer and equal length random dna, respectively with CD19
With the coated magnetic bead reaction (method is with embodiment 1) of BSA, the fluorescence intensity of flow cytomery magnetic bead surfaces.The results show that
Compared with random dna, the extended sequence and CD19 still have higher combination, and very weak (result is shown in Fig. 7) with the combination of BSA.
Identical method (with embodiment 3) detects the combination of the sequence and CD19 positive cell Ramos and negative cells Jurkat, discovery
The sequence and CD19 positive cell Ramos have a higher binding force, and and CD19 negative cells Jurkat the weaker (result of combination
See Fig. 8).Black curve indicates that the control fluorescence signal that random single chain DNA generates, Grey curves indicate to increase Poly A's in figure
The fluorescence signal that aptamer generates.
After 6 aptamer thio-modification of embodiment and the combination of CD19 albumen and CD19 positive tumor cell
All base A in CD19 aptamer original sequence are subjected to thio-modification, are synthesized through Invitrogen company
FITC label thio-modification aptamer and equal length random dna, respectively with CD19 albumen and the coated magnetic of BSA
Pearl reacts (method is with embodiment 1), the fluorescence intensity of flow cytomery magnetic bead surfaces.The results show that with random dna phase
Than the sequence and CD19 albumen of the thio-modification still have higher combination, and very weak (result is shown in Fig. 9) with the combination of BSA.It is identical
Method (with embodiment 3) detect the combination of the sequence and CD19 positive cell Ramos and negative cells Jurkat, find the sequence
Column and CD19 positive cell Ramos have a higher binding force, and and the combination of CD19 negative cells Jurkat weaker (result is shown in figure
10).Black curve indicates that the control fluorescence signal that random single chain DNA generates, Grey curves indicate the nucleic acid of thio-modification in figure
The fluorescence signal that aptamers generate.
From above-described embodiment as can be seen that CD19 aptamer provided by the invention and the CD19 aptamer
Truncation or extend sequence and modification sequence, can be with higher affinity and specific binding CD19 albumen, and can know
The lymphoma cell of the other CD19 positive, at the same with other albumen and negative cells intersect combined it is weaker.Therefore the CD19 nucleic acid
Aptamers can be used for detecting and/or treating the application in the tumour medicine especially lymthoma of the CD19 positive.
SEQUENCE LISTING
<110>Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences
<120>A kind of CD19 aptamer and its application
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 59
<212> DNA
<213>Artificial sequence
<400> 1
tgcgtgtgta gtgtgtctgt tctccttttt ttggttgctg ctcttaggga tttgggcgg 59
<210> 2
<211> 51
<212> DNA
<213>Artificial sequence
<400> 2
tagtgtgtct gttctccttt ttttggttgc tgctcttagg gatttgggcg g 51
<210> 3
<211> 79
<212> DNA
<213>Artificial sequence
<400> 3
tgcgtgtgta gtgtgtctgt tctccttttt ttggttgctg ctcttaggga tttgggcgga 60
aaaaaaaaaa aaaaaaaaa 79
Claims (6)
1. a kind of CD19 aptamer, which is characterized in that include the nucleotide sequence as shown in SEQ ID No.1 or SEQ ID
Sequence of the nucleotide sequence shown in No.1 after missing or extension.
2. CD19 aptamer as shown in claim 1, which is characterized in that the sequence after the missing is SEQ ID
Nucleotides sequence shown in No.1 is listed in 5 ' ends and clips 8 bases, and particular sequence is as shown in SEQ ID No.2.
3. CD19 aptamer as shown in claim 1, which is characterized in that the sequence after the extension is SEQ ID
Nucleotides sequence shown in No.1 is listed in the polyA that 3 ' ends increase by one section of 20 base, and particular sequence is as shown in SEQ ID No.3.
4. CD19 aptamer as described in claim 1, which is characterized in that base As all for the aptamer
Carry out thio-modification.
5. CD19 aptamer according to any one of claims 1-4 is for detecting and/or treating the swollen of the CD19 positive
Application in tumor medicine.
6. application as claimed in claim 5, which is characterized in that the tumour is lymthoma.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810421653.5A CN108823211A (en) | 2018-05-04 | 2018-05-04 | A kind of CD19 aptamer and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810421653.5A CN108823211A (en) | 2018-05-04 | 2018-05-04 | A kind of CD19 aptamer and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108823211A true CN108823211A (en) | 2018-11-16 |
Family
ID=64147459
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810421653.5A Pending CN108823211A (en) | 2018-05-04 | 2018-05-04 | A kind of CD19 aptamer and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108823211A (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090197271A1 (en) * | 2006-06-16 | 2009-08-06 | Cornell Research Foundation, Inc. | Functional nucleic acid ligands to fluorescent proteins |
| WO2013049307A2 (en) * | 2011-09-30 | 2013-04-04 | University Of Miami | Enhanced immune memory development by aptamer targeted mtor inhibition of t cells |
| CN103080131A (en) * | 2010-08-20 | 2013-05-01 | 南安普敦大学 | Combined use of Fc gamma RIIb (CD32B) and CD20-specific antibodies |
| CN104561013A (en) * | 2015-01-05 | 2015-04-29 | 中国人民解放军南京军区福州总医院 | Method for optimizing aptamer sequence based on high-throughput sequencing technology |
| CN105087596A (en) * | 2014-05-23 | 2015-11-25 | 中国医学科学院基础医学研究所 | CD20 aptamer and application thereof |
| CN105087593A (en) * | 2014-05-12 | 2015-11-25 | 中国医学科学院基础医学研究所 | HER2 nucleic acid aptamer and application thereof |
| WO2017004243A1 (en) * | 2015-06-29 | 2017-01-05 | Caris Science, Inc. | Therapeutic oligonucleotides |
-
2018
- 2018-05-04 CN CN201810421653.5A patent/CN108823211A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090197271A1 (en) * | 2006-06-16 | 2009-08-06 | Cornell Research Foundation, Inc. | Functional nucleic acid ligands to fluorescent proteins |
| CN103080131A (en) * | 2010-08-20 | 2013-05-01 | 南安普敦大学 | Combined use of Fc gamma RIIb (CD32B) and CD20-specific antibodies |
| WO2013049307A2 (en) * | 2011-09-30 | 2013-04-04 | University Of Miami | Enhanced immune memory development by aptamer targeted mtor inhibition of t cells |
| CN105087593A (en) * | 2014-05-12 | 2015-11-25 | 中国医学科学院基础医学研究所 | HER2 nucleic acid aptamer and application thereof |
| CN105087596A (en) * | 2014-05-23 | 2015-11-25 | 中国医学科学院基础医学研究所 | CD20 aptamer and application thereof |
| CN104561013A (en) * | 2015-01-05 | 2015-04-29 | 中国人民解放军南京军区福州总医院 | Method for optimizing aptamer sequence based on high-throughput sequencing technology |
| WO2017004243A1 (en) * | 2015-06-29 | 2017-01-05 | Caris Science, Inc. | Therapeutic oligonucleotides |
Non-Patent Citations (3)
| Title |
|---|
| GÜNTER MAYER 等: "Fluorescence-activated cell sorting for aptamer SELEX with cell mixtures", 《NAT PROTOC》 * |
| 李晓欧: "针对白蛋白及CD19的新型核酸适配体的筛选", 《中国优秀硕士学位论文全文数据库 基础科学辑》 * |
| 韩晓军: "《生物功能化界面》", 31 January 2017, 哈尔滨工业大学出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102624509B1 (en) | Stimulatory cell lines for EX VIVO expansion and activation of natural killer cells | |
| TWI406946B (en) | Cell penetrating peptides for intracellular delivery | |
| CN108137704A (en) | Macrophage CAR in immunotherapy（MOTO-CAR） | |
| JP6483645B2 (en) | Albumin production and cell proliferation | |
| CN102827845B (en) | Nucleic acid aptamer of epithelial cell adhesion molecule and preparation method thereof | |
| JP2019512489A5 (en) | ||
| CN107794267A (en) | A kind of targeting PD1 PDL1 bispecific aptamer and its derivative | |
| CN106929508B (en) | SaRNA for activating PTPRO gene expression and transport vector thereof | |
| US20050026178A1 (en) | Allosteric probes and methods | |
| CN105087593A (en) | HER2 nucleic acid aptamer and application thereof | |
| Hu et al. | Selection of a novel DNA thioaptamer against HER2 structure | |
| WO2009088837A2 (en) | Methods and products to target, capture and characterize stem cells | |
| CN107868786A (en) | The single stranded DNA aptamers of multidrug resistance colon cancer cell | |
| CN108823211A (en) | A kind of CD19 aptamer and its application | |
| CN108239646B (en) | Aptamer combined with liver cancer cell, application of aptamer and detection method using aptamer | |
| CN110628770B (en) | Aptamer targeting OFA/iLRP | |
| CN107326028B (en) | Aptamer capable of being combined with CD123 and construction and application of targeting drug-loading system thereof | |
| CN100352922C (en) | SiRAN and expression carrier for inhibiting human VEGF gene expression and their pharmaceutical use | |
| CN112779261B (en) | Aptamer combined with human B7-H4 protein, application thereof and detection method using aptamer | |
| CN116003622A (en) | Chimeric antigen receptor for treating ovarian cancer and application thereof | |
| CN109576273A (en) | A set of tumor-marker molecular nucleic acid aptamers and application based on CRISPR/Cas9 | |
| CN105267983B (en) | iNGR modified brain glioma targeted self-assembly RNAi nano drug delivery system and preparation method thereof | |
| CN108486120B (en) | Novel CpG ODN sequence and application thereof in anti-melanoma | |
| JPWO2012008361A1 (en) | Nucleic acid introduction method and nucleic acid complex | |
| Kwon et al. | Genome-wide profiling induced by ionizing radiation (IR) in non-small cell lung cancer (NSCLC) grown as three-dimensional spheroid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181116 |
|
| RJ01 | Rejection of invention patent application after publication |