CN108676801A - The cDNA of the egg mother cell marker gene slbp2 of Epinephelus coioides a kind of and its application - Google Patents
The cDNA of the egg mother cell marker gene slbp2 of Epinephelus coioides a kind of and its application Download PDFInfo
- Publication number
- CN108676801A CN108676801A CN201810397763.2A CN201810397763A CN108676801A CN 108676801 A CN108676801 A CN 108676801A CN 201810397763 A CN201810397763 A CN 201810397763A CN 108676801 A CN108676801 A CN 108676801A
- Authority
- CN
- China
- Prior art keywords
- slbp2
- mother cell
- egg mother
- epinephelus coioides
- marker gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/461—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from fish
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1096—Processes for the isolation, preparation or purification of DNA or RNA cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Computational Biology (AREA)
- Plant Pathology (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the cDNA of the egg mother cell marker gene slbp2 of Epinephelus coioides a kind of, its nucleotide sequence such as SEQ ID NO：Shown in 1.And the preparation method of the cDNA of the egg mother cell marker gene slbp2 of the Epinephelus coioides, the invention also discloses the coding albumen of the egg mother cell marker gene slbp2 of above-mentioned Epinephelus coioides, its amino acid sequence such as SEQ ID NO：Shown in 2.The present invention further discloses application of the specific probe of a kind of specific probe of egg mother cell marker gene slbp2 of Epinephelus coioides and preparation method thereof and the egg mother cell marker gene slbp2 of the Epinephelus coioides in specific marker egg mother cell and identification egg mother cell type.
Description
Technical field
The invention belongs to technical field of molecular biology, and in particular to a kind of egg mother cell marker gene of Epinephelus coioides
The cDNA of slbp2 and its application.
Background technology
Only have fraction mRNA to pass through phosphorylation in eucaryote, and carries poly (A) tail；And most mRNA belongs to
In replication-dependent mRNA, without phosphorylation, without poly (A) tail, but the 3 ' of this kind of mRNA end noncoding regions include
One highly conserved loop-stem structure.The structure and a kind of protein interaction of specific bond on RNA, this protein
It is referred to as stem ring binding protein (SLBP or HBP).Forefathers' studies have shown that stem ring binding protein participate in mRNA precursor synthesis,
A variety of significant process such as embryonic development, cell Proliferation.Generally there are two types of hypotypes by SLBP, and it is 2 types to study at present more, i.e.,
SLBP2, the gene for encoding SLBP2 are exactly slbp2.
Epinephelus Perciformes (Perciformes), Sushi sections (Serranidae), Epinephelinae
(Epinephelinae), Epinephelus (Epinephelus).Grouper delicious meat, full of nutrition, economic value is high, is me
The coastal main economic cultured fishes of seawater in state south.Grouper is hermaphroditic fish, after first female in ontogenetic process
Hero, there are sexual reversal phenomenons.This phenomenon causes the problem of often will appear milter lazy weight during artificial propagation, sternly
The development of the large-scale production and aquaculture cause of grouper artificial propagation techniques is constrained again.Therefore, it is inverse to explore lithosporic piscinity
The specific mechanism turned is necessary, and special, apparent, the believable Sex-linked marker gene of signal is that one very in research process
The exploitation of effective tool, grouper marker gene is particularly significant to subsequent experimental study.
Invention content
An object of the present invention be to provide a kind of egg mother cell marker gene slbp2 of Epinephelus coioides cDNA and its
Preparation method and coding albumen.
The present invention also aims to provide a kind of specificity spy of the egg mother cell marker gene slbp2 of Epinephelus coioides
Needle and its preparation method and application.
Above-mentioned first purpose of the present invention is achieved through the following technical solutions：A kind of ovum of Epinephelus coioides is female
The cDNA of cell marking gene slbp2, its nucleotide sequence such as SEQ ID NO：Shown in 1.
The coding albumen of the egg mother cell marker gene slbp2 of above-mentioned Epinephelus coioides, its amino acid sequence such as SEQ
ID NO：Shown in 2.
The preparation method of the cDNA of the egg mother cell marker gene slbp2 of above-mentioned Epinephelus coioides, includes the following steps：
(1) Epinephelus coioides sexual gland total serum IgE is extracted；
(2) by the total serum IgE SMART of extractionTMPCR cDNA synthetic agent box reverse transcriptions go out the template for RACE；
(3) two pairs of special upstream and downstream primers are designed, are expanded by RACE, the egg mother cell label of Epinephelus coioides is obtained
The cDNA of gene slbp2.
The specific upstream and downstream primer of two couple described in step (3), the core of the upstream and downstream primer of one pair of which specificity
Nucleotide sequence is respectively such as SEQ ID NO：3~SEQ ID NO：Shown in 4, the nucleotides sequence of the upstream and downstream primer of another pair specificity
Row are respectively such as SEQ ID NO：5~SEQ ID NO：6.
Above-mentioned second purpose of the present invention is achieved through the following technical solutions：A kind of ovum of Epinephelus coioides is female
The specific probe of cell marking gene slbp2, its nucleotide sequence such as SEQ ID NO：Shown in 7.
The preparation method of the specific probe of the egg mother cell marker gene slbp2 of above-mentioned Epinephelus coioides, including it is following
Step：
(1) Epinephelus coioides sexual gland total serum IgE is extracted；
(2) by the total serum IgE SMART of extractionTMPCR cDNA synthetic agent box reverse transcriptions go out the template for RACE；
(3) two pairs of special upstream and downstream primers are designed, are expanded by RACE, the egg mother cell label of Epinephelus coioides is obtained
The cDNA of gene slbp2；
(4) it chooses in the cDNA of slbp2 than more conservative segment, designs upstream and downstream primer, carry out PCR amplification, gained production
Object carries out electrophoresis, recycles purpose product, target fragment is carried out construction of recombinant plasmid, screening positive clone extracts plasmid, with limit
Property endonuclease (ApaI, PstI) processed cuts plasmid, obtains target fragment after agarose gel electrophoresis, then will cut to obtain adhesive tape
It is recycled, the product of glue recycling prepares the egg mother cell marker gene slbp2 of Epinephelus coioides with DIG probe reagent boxes
Specific probe.
The nucleotide sequence of upstream and downstream primer such as SEQ ID NO described in step (4)：8~SEQ ID NO：Shown in 9.
The specific probe of the egg mother cell marker gene slbp2 of above-mentioned Epinephelus coioides is female thin in specific marker ovum
Born of the same parents and identification egg mother cell type in application.
Probe in the present invention can define the developmental stage residing for egg mother cell, simultaneously with specific marker egg mother cell
Can in research reverses molecular mechanism identification of cell type.
The present invention has the following advantages：
(1) present invention devises specific primer using grouper genome database binding molecule biological method,
RACE amplification clones obtain the full length sequence of slbp2 genes；
(2) present invention chooses specific segment in ORF sequences, and reverse transcription is used for the probe of in situ hybridization, through examining,
Slbp2 genes are only expressed in Epinephelus coioides female sex cell, and the table in the egg mother cell of different developmental phases
It is different with expressive site up to measuring, the process of formation and the degradation of barr body is clearly reflected during entire expression；
(3) present invention provides the specific marker gene of egg mother cell for research Epinephelus coioides sex reversal mechanism, is
Subsequent experimental study is laid a good foundation.
Description of the drawings
Fig. 1 is the expression during Epinephelus coioides slbp2 is organized at 16 in embodiment 1, wherein M DS
2000DNA Marker, 1-16 respectively represent olfactory bulb, akrencephalon, diencephalon, cerebellum, medulla oblongata, inferior colliculus, hypophysis, heart, head-kidney, stomach,
16 gill, sexual gland, kidney, liver, spleen, intestines tissues；
Fig. 2 is the homology analysis situation between Epinephelus coioides SLBP2 and other species SLBP in embodiment 1；
Fig. 3 is the electrophoretogram of Epinephelus coioides slbp2 probes in embodiment 2, and M, which is DS 2000DNAMarker, P, is
Slbp2 probes；
Fig. 4 is that for Epinephelus coioides slbp2 in the expression of egg mother cell different developmental phases, a represents ovum in embodiment 3
Archaeocyte phase sexual gland, b represent the sexual gland containing a large amount of primary growth stage oocytes (PO), and c represents a large amount of egg mother cells and contains
There are the sexual gland in a large amount of cortex vesicle (PVO) periods, the sexual gland of d yolk generation phase (VO)；
Fig. 5 be in embodiment 3 Epinephelus coioides slbp2mRNA in the positioning scenarios of egg mother cell different developmental phases, A generations
Table oogonium phase sexual gland, B represent the sexual gland containing a large amount of primary growth stage oocytes (PO), and it is female thin that C represents a large amount of ovum
Born of the same parents contain the sexual gland in a large amount of cortex vesicle (PVO) periods, the sexual gland of D yolk generation phase (VO), and a-d respectively represents slbp2 spies
Needle feminine gender figure, as negative control；
Fig. 6 is expression pattern figures of the Epinephelus coioides slbp2 in the egg mother cell of different developmental phases in embodiment 3；
Fig. 7 is expressions of Epinephelus coioides slbp2mRNA during artificial induction's sex reversal in embodiment 3, a,
C, e respectively represents sex reversal early stage, mid-term, the sexual gland in latter stage, and g is natural male sexual gland, and b, d, g, h are a, c, e, g couple respectively
DAPI (nucleus dedicated dye) the dye core figures answered.
Specific implementation mode
Present invention be described in more detail in the following with reference to the drawings and specific embodiments.Unless specifically indicated, the present invention uses
Device and method be the art regular market purchase reagent, equipment and conventional use of method.
The gene cloning of 1 Epinephelus coioides slbp2 of embodiment
1, the extraction of 16 total tissue RNAs of Epinephelus coioides
Epinephelus coioides (Epinephelus coioides), body are taken to grow 30~40cm, 1~1.5kg of weight, with ice bath fiber crops
After liquor-saturated about 2min, kill fish sampling, isolate olfactory bulb, akrencephalon, diencephalon, cerebellum, medulla oblongata, inferior colliculus, hypophysis, heart, head-kidney, stomach, the gill,
16 sexual gland, kidney, liver, spleen, intestines tissues, after quick-frozen in liquid nitrogen, it is spare to deposit in -80 DEG C of refrigerators.Using Trizol
Reagent method extracts the total serum IgE of 16 tissues of Epinephelus coioides, OD260/280=1.90.
2, the distribution situation during Epinephelus coioides slbp2 is organized at 16
RNA reverse transcriptions by 16 tissues of Epinephelus coioides in step 1 are cDNA, and PCR detects slbp2 in each tissue
Expression.After testing, expression quantity highest in sexual gland, there is a small amount of expression in kidney, without expression (Fig. 1) in hetero-organization.
3, the clone of Epinephelus coioides slbp2 gene cDNAs complete sequence
The structure of cDNA library
Utilize SMARTTMPCR cDNA amplification kit (Clontech) construction cDNAs library carries out real according to specification
Operation is tested, all centrifuge tubes used, pipette tips are all by no enzymatic treatment.Template is synthesized with kit corresponding step, and
Corresponding buffer solution is added according to the concentration of final product, -20 DEG C preserve three months.
The clone of Epinephelus coioides slbp2 gene cDNA complete sequences
According to the slbp2 genetic fragments of other species in ncbi database, two couples of special upstream and downstream primer SEQ are designed
ID NO：3 (CGGCGACAGAAACAGATA), SEQ ID NO：4 (GTACAGTCGTCGCTCTTG), SEQ ID NO：5
(ACACCACCACCTTCTTCC), SEQ ID NO：6 (TCTCATCATCTTCCACCTG), archaeal dna polymerase used in PCR amplification are
The Taq archaeal dna polymerases of high-fidelity utilize SEQ ID NO：3 and SEQ ID NO：4 primer carries out the reaction of first round PCR and completes
The template for the PCR reaction products of the first round being diluted later the PCR reactions that 100 times are taken turns as second, with SEQ ID NO：5 Hes
SEQ ID NO：6 carry out the PCR amplification of the second wheel.The PCR reaction product loadings of second wheel carry out 2% agarose gel electrophoresis,
The gel extraction if purposeful band.
The gel-purified cut is recycled to obtain purpose product, purpose product is then connected to pGEM-easy carriers,
DH5 α Escherichia coli are converted, positive colony is selected and company is sent to be sequenced.Blast it is homologous compare analysis shows, obtain slbp2 genes
3 ＇, 5 ends ＇ non-coding sequences, splice intersection, you can obtain the cDNA complete sequences of slbp2 genes by software.ATG is located at
27-30 nucleotide, terminator codon are located at 795-798 nucleotide, and opening code-reading frame is 798 nucleotide, thus it is speculated that coding one
The albumen of 225 amino acid.5 ' UTR are 27bp, and 3 ' UTR are 798bp, and there are typical tailing signal AATAAA by 3 ' UTR.RACE
Amplification obtains the complete sequence SEQ ID NO of slbp2 gene cDNAs：1, and predict corresponding amino acid sequence SEQID NO:2,
Black runic region is probe sequence (the SEQ ID NO in embodiment 2:7).
4, the homology analysis of Epinephelus coioides SLBP2 and other species
The SLBP of the amino acid sequence for being predicted Epinephelus coioides using 6.06 softwares of MEGA and other species carries out homologous
Property compare, comparison result such as Fig. 2.The result shows that Epinephelus coioides SLBP2 gathers one with Xenopus laevis, both possible SLBP2 exists
It is relatively close on evolutionary distance.
The preparation of 2 Epinephelus coioides slbp2 gene-specific probes of embodiment
The synthesis of the first chains of cDNA
Take the progress DNAase I processing of 10 μ g Epinephelus coioides sexual gland total serum IgE samples to remove the pollution of genomic DNA, with
RNA Oligo dT mixing, carries out reverse transcription PCR, the product of gained is placed in -20 DEG C and saves backup.
The clone of Epinephelus coioides slbp2 gene probe sequences
According to the slbp2 full length sequences in example 1, choose in slbp2 gene orders than one section of more conservative SEQID NO：
7, respectively in 3 ＇ of the segment, 5 ends ＇ design primer SEQ ID NO：8 (CAGCAACAAACCTCGAAGGC), SEQ ID NO：9
(CGGAGCCAGTCAGTCATGTT), PCR amplification is carried out, gained PCR product loading carries out 1.5% agarose gel electrophoresis, with
DNA fragmentation is separated by electrophoresis in low-voltage, the purifying recycling purpose product from gel.Purpose product after purification is connected to pGEM-
Easy carriers convert DH5 α Escherichia coli, select positive colony sequencing.Blast it is homologous compare analysis shows, purpose product is
Slbp2 probes, sequence such as SEQ ID NO：Shown in 7.
The structure of Epinephelus coioides slbp2 recombinant plasmids
The target fragment of acquisition is subjected to construction of recombinant plasmid, screening positive clone extracts plasmid, in restriction nuclease
Enzyme cutting (ApaI, PstI) cuts plasmid and obtains target fragment (666bp) glue recycling afterwards, and the DNA fragmentation being recovered to is tried with DIG probes
Agent box prepares probe.Whole process ensures the pollution without RNA enzyme, operates on ice.Probe after purification is in the prefectures RNA, with 2% fine jade
RNA segments are separated by electrophoresis in sepharose low-voltage, purpose size segment occur and band is single clear, then available (the figure of probe
3).Probe is placed on -80 DEG C of preservations, can be placed on -20 DEG C and continue to employ after dilution.
3 Epinephelus coioides slbp2 probes of embodiment and different times gonadal tissue in situ hybridization
The processing of Epinephelus coioides gonadal tissue
Take fresh gonadal tissue block 1cm3Left and right is immediately placed in 4% paraformaldehyde, and 4 DEG C overnight.30% sucrose impregnates
Sample, 4 DEG C of incubator overnights.30% sucrose and OCT embedding mediums (oriental cherry) are according to 1:1 ratio handled sample after 2~4 hours,
OCT embedding medium embedded samples are used on dry ice, sample is put into -80 DEG C of preservations after solidification.
Epinephelus coioides gonadal tissue frozen section
Freezing-microtome (Lecia) is pre-chilled to -20 DEG C in advance, and embedded tissue block is first put into freezing-microtome
(Lecia) cavity inner equilibrium 30~60 minutes, are then sliced.Immature ovary tissue slice thickness is 7 μm, and ovum is female thin
The gonadal tissue slice thickness that born of the same parents contain a large amount of yolk proteins is 8-10 μm.Slice is put into -80 DEG C of preservations.
In situ hybridization
It takes different times ovary sexual gland to be sliced 42 DEG C to dry 45 minutes, can then carry out in situ hybridization in two days by a definite date.It visits
A concentration of 0.5-1ng/ μ L of needle, hybridization temperature are 55~65 DEG C, and actual conditions needs are made adjustment according to actual conditions.Entirely
Process ensures the pollution without RNA enzyme.
First day flow：Rehydration 30 minutes under 1 × PBS (configuration of DEPC water), and prehybridization solution (50% deionized formamide, 5
× SSC, 0.5mg/ml salmon essence RNA, 1 × Denhard ＇ s, 5% dextran sulfate) 65 DEG C be incubated 1h, then with probe is added
65 DEG C of prehybridization solution overnight.
First day flow：50% formamide：2 × SSCT=1:1 elution 30min, is washed 2 times；2 × SSCT elutes 15min；
0.2 × SSCT elutes 30min, washes 2 times.Elution process is carried out in 65 DEG C of baking oven.After room temperature closes 1h, use
Anti-DIG-AP is incubated 2h, finally uses NBT/BCIP Stock Solution colour developings.
Fig. 4 is expressions of the Epinephelus coioides slbp2 in egg mother cell different developmental phases, and a represents the oogonium phase
Sexual gland, b represent the sexual gland containing a large amount of primary growth stage oocytes (PO), and c represents a large amount of egg mother cells and contains a large amount of skins
The sexual gland in matter vesicle (PVO) period, the sexual gland of d yolk generation phase (VO).As a result show that Epinephelus coioides slbp2 is former thin in ovum
Expression quantity is extremely low in born of the same parents, is largely accumulated in primary growth stage oocytes, and subsequent slbp2 expression quantity continuously decreases.
Fig. 5 is positioning scenarios of the Epinephelus coioides slbp2 in egg mother cell different developmental phases, and A represents the oogonium phase
Sexual gland, B represent the sexual gland containing a large amount of primary growth stage oocytes (PO), and C represents a large amount of egg mother cells and contains a large amount of skins
The sexual gland in matter vesicle (PVO) period, the sexual gland of D yolk generation phase (VO).
Fig. 5 in situ hybridizations are the results show that when egg mother cell is in the early stage in primary growth stage, slbp2mRNA is converged in
In the barr body in nucleus week, a fine and close sphere is formed.When egg mother cell is in the mid-term in primary growth stage, this
Dense body is gradually distance from nucleus, moves to cytoplasm；When egg mother cell is in the latter stage in primary growth stage, barr body disappears
It loses, slbp2mRNA is dispersed in cytoplasm.In cortex vesicle phase egg mother cell, signals of the slbp2mRNA in cytoplasm is big
It is big to weaken, mainly converge in the one side edge of cell；In the egg mother cell that yolk generates the phase, slbp2mRNA is in cytoplasm
Almost without can't detect signal, or only there is a small amount of signal in the one side edge of cell.
Fig. 6 is expression pattern figures of the Epinephelus coioides slbp2 in the egg mother cell of different developmental phases.
Expressions of Fig. 7 Epinephelus coioides slbp2mRNA during artificial induction's sex reversal.The results show that slbp2
Expression and localization situation in egg mother cell is consistent with Fig. 5, and slbp2 has no expression in male sex-cell, demonstrate,proves again
Bright slbp2 is the special marker gene of egg mother cell.
The present invention is not limited within the scope of above-mentioned specific embodiment, and the embodiment above is used for the purpose of can be to this
The use process of invention is described in detail, and has the production method of equal function and technical detail to also belong in the present invention
A part for appearance.In fact, those skilled in the art are according to description above, it will be able to according to respectively needing to find different tune
Perfect square case, these adjustment all should be in the scope of the claims by the appended claims herein.
Sequence table
<110>Zhongshan University
Hainan morning seawater produces Co., Ltd
Yangjiang Vocationl Technical College
<120>The cDNA of the egg mother cell marker gene slbp2 of Epinephelus coioides a kind of and its application
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1866
<212> DNA
<213>Stem ring binding protein (stem loop binding protein)
<400> 1
acatggggtg aaactcaaac tgcaatcatg tcaaccagca gagtggaaac agccgctcac 60
agcccgctgc tctcctccag cttgtgtttc agcccgtggt catgcgtctg tgtgaagggc 120
tggtcagccg ccatgtggaa cggcctcccc gacccgctgc tgactgctgc caactcctcc 180
agatgctccg cccccgagcc atggctcctc cccggctgca gctccgtctt cgacagcctg 240
gtcagtaaca cgtctccgac cccatctcct cctgctgcca gcggcctgag aggacgagag 300
cgagctgtca gcaacaaacc tcgaaggccg tccatcctgg agcgatgtat cctcaaagtg 360
tccaccagca gtgtcgctgt ggggacagaa gatctggaca acaagcggcc ccctatcggc 420
cgctgctacc cccgcctccc ggacccggcc aacaccgaga ccaacggtgc ggttctgaag 480
cggcggcaga aacagatcca gtacggtaaa aacaccagcg gctaccagaa ctacctgcag 540
caagtcccca aacatatgag ggacgccaaa ctccacccgt ccacccccaa caagtacagg 600
aagtacagcc ggcgctcctg ggacatgcag gtgcgtctgt ggaggcgagc gctgcacctt 660
tgggaccctc catctgagag ccagccggac gccaccgaca cacatgaccc agtggagcaa 720
ctgcagagcc agctggcgaa gatgacctcc gacctgtgtg aggacggaga agacaagcag 780
agagagaagg agactccaga agcctctaaa gcctcctctg tgtctcctct gtcggctgtg 840
atgtcgctgg agctgcctgg atcctggaac gtcccgctgt caccggaggc tgagatgaac 900
ctcaggacac tgcgctctcc tccaggcctc agccagctga ccaacgacaa caacaacatg 960
actgactggc tccgccttct gctggaggct gacaacgacc aagatttcgg ctccgatgac 1020
cagcaggttc ctgtgttttc tgaccagctc ttttggaacc cgtactgaat gtcagcagat 1080
ctccactgac ctgaaacaaa cgacgttcag ccgtctgtca acatcataaa ctcctcgatc 1140
atcatcaagg agacgtcgtt ggtcctgaag gtgtcagagt aaagtttgtg tgtttccagt 1200
acgtttgact ttttaagatg gttgaaaatt tactataacg acagcaggga tgtgattggt 1260
ccttgatcta ccccccccac cctccacgag gaggaactac cctccgctcc tgcaggggtg 1320
ttgaggtttc ccagctgctc ttgaaagtgt cctctggtcg gacagctgga cactttgacc 1380
tgagcatggt actgtagttt gcacgttgta tatttctgtt gacctgcgtc agatggagca 1440
cttctcacct gcatcatgtt ttagttttag gaatcctgca ctgatggaaa gctgctaatt 1500
tattttattt gaagtcacaa atttatttaa caaacccatg tggtgtcact tcatggcctc 1560
tctgcaggct gttgtctttg gtccaccatc accgtcatgc tctgccgtct gtctgtctgt 1620
ctgtctgtct gtccggatca ggctccagct cctcctctct acctcatgtt ttttctaaaa 1680
aacagaaacc ctgattgtcg gagggaaaca gctgtcactt tgtgttgtcg gttttctttt 1740
actttttctc aatttgtcat tttgcgctgc tcgaatatcg agaccaaagc tgaaagatgt 1800
gattaataaa gatgtaaata aagtgttata aattcacaca aaaaaaaaaa aaaaaaaaaa 1860
aaaaaa 1866
<210> 2
<211> 346
<212> PRT
<213>Stem ring binding protein (stem loop binding protein)
<400> 2
Met Ser Thr Ser Arg Val Glu Thr Ala Ala His Ser Pro Leu Leu Ser
1 5 10 15
Ser Ser Leu Cys Phe Ser Pro Trp Ser Cys Val Cys Val Lys Gly Trp
20 25 30
Ser Ala Ala Met Trp Asn Gly Leu Pro Asp Pro Leu Leu Thr Ala Ala
35 40 45
Asn Ser Ser Arg Cys Ser Ala Pro Glu Pro Trp Leu Leu Pro Gly Cys
50 55 60
Ser Ser Val Phe Asp Ser Leu Val Ser Asn Thr Ser Pro Thr Pro Ser
65 70 75 80
Pro Pro Ala Ala Ser Gly Leu Arg Gly Arg Glu Arg Ala Val Ser Asn
85 90 95
Lys Pro Arg Arg Pro Ser Ile Leu Glu Arg Cys Ile Leu Lys Val Ser
100 105 110
Thr Ser Ser Val Ala Val Gly Thr Glu Asp Leu Asp Asn Lys Arg Pro
115 120 125
Pro Ile Gly Arg Cys Tyr Pro Arg Leu Pro Asp Pro Ala Asn Thr Glu
130 135 140
Thr Asn Gly Ala Val Leu Lys Arg Arg Gln Lys Gln Ile Gln Tyr Gly
145 150 155 160
Lys Asn Thr Ser Gly Tyr Gln Asn Tyr Leu Gln Gln Val Pro Lys His
165 170 175
Met Arg Asp Ala Lys Leu His Pro Ser Thr Pro Asn Lys Tyr Arg Lys
180 185 190
Tyr Ser Arg Arg Ser Trp Asp Met Gln Val Arg Leu Trp Arg Arg Ala
195 200 205
Leu His Leu Trp Asp Pro Pro Ser Glu Ser Gln Pro Asp Ala Thr Asp
210 215 220
Thr His Asp Pro Val Glu Gln Leu Gln Ser Gln Leu Ala Lys Met Thr
225 230 235 240
Ser Asp Leu Cys Glu Asp Gly Glu Asp Lys Gln Arg Glu Lys Glu Thr
245 250 255
Pro Glu Ala Ser Lys Ala Ser Ser Val Ser Pro Leu Ser Ala Val Met
260 265 270
Ser Leu Glu Leu Pro Gly Ser Trp Asn Val Pro Leu Ser Pro Glu Ala
275 280 285
Glu Met Asn Leu Arg Thr Leu Arg Ser Pro Pro Gly Leu Ser Gln Leu
290 295 300
Thr Asn Asp Asn Asn Asn Met Thr Asp Trp Leu Arg Leu Leu Leu Glu
305 310 315 320
Ala Asp Asn Asp Gln Asp Phe Gly Ser Asp Asp Gln Gln Val Pro Val
325 330 335
Phe Ser Asp Gln Leu Phe Trp Asn Pro Tyr
340 345
<210> 3
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
cggcgacaga aacagata 18
<210> 4
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
gtacagtcgt cgctcttg 18
<210> 5
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
acaccaccac cttcttcc 18
<210> 6
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
tctcatcatc ttccacctg 19
<210> 7
<211> 666
<212> DNA
<213>Stem ring binding protein (stem loop binding protein)
<400> 7
cagcaacaaa cctcgaaggc cgtccatcct ggagcgatgt atcctcaaag tgtccaccag 60
cagtgtcgct gtggggacag aagatctgga caacaagcgg ccccctatcg gccgctgcta 120
cccccgcctc ccggacccgg ccaacaccga gaccaacggt gcggttctga agcggcggca 180
gaaacagatc cagtacggta aaaacaccag cggctaccag aactacctgc agcaagtccc 240
caaacatatg agggacgcca aactccaccc gtccaccccc aacaagtaca ggaagtacag 300
ccggcgctcc tgggacatgc aggtgcgtct gtggaggcga gcgctgcacc tttgggaccc 360
tccatctgag agccagccgg acgccaccga cacacatgac ccagtggagc aactgcagag 420
ccagctggcg aagatgacct ccgacctgtg tgaggacgga gaagacaagc agagagagaa 480
ggagacacca gaagcctcta aagcctcctc tgtgtctcct ctgtcggctg tgatgtcgct 540
ggagctgcct ggatcctgga acgtcccgct gtcaccggag gctgagatga acctcaggac 600
tctgcgctct cctccaggcc taagccagct gaccaacgac aacaacaaca tgactgactg 660
gctccg 666
<210> 8
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 8
cagcaacaaa cctcgaaggc 20
<210> 9
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 9
cggagccagt cagtcatgtt 20
Claims (8)
1. the cDNA of the egg mother cell marker gene slbp2 of Epinephelus coioides a kind of, it is characterized in that：Its nucleotide sequence is such as
SEQ ID NO：Shown in 1.
2. the coding albumen of the egg mother cell marker gene slbp2 of Epinephelus coioides described in claim 1, it is characterized in that：It
Amino acid sequence such as SEQ ID NO：Shown in 2.
3. the preparation method of the cDNA of the egg mother cell marker gene slbp2 of Epinephelus coioides described in claim 1, feature
It is to include the following steps：
(1) Epinephelus coioides sexual gland total serum IgE is extracted；
(2) by the total serum IgE SMART of extractionTMPCR cDNA synthetic agent box reverse transcriptions go out the template for RACE；
(3) two pairs of special upstream and downstream primers are designed, is expanded by RACE, obtains the egg mother cell marker gene of Epinephelus coioides
The cDNA of slbp2.
4. the preparation method of the cDNA of the egg mother cell marker gene slbp2 of Epinephelus coioides according to claim 3,
It is characterized in：The specific upstream and downstream primer of two couple described in step (3), the nucleosides of the upstream and downstream primer of one pair of which specificity
Acid sequence is respectively such as SEQ ID NO：3~SEQ ID NO：Shown in 4, the nucleotide sequence of the upstream and downstream primer of another pair specificity
Respectively such as SEQ ID NO：5~SEQ ID NO：6.
5. the specific probe of the egg mother cell marker gene slbp2 of Epinephelus coioides a kind of, it is characterized in that：Its nucleotides sequence
Row such as SEQ ID NO：Shown in 7.
6. the preparation method of the specific probe of the egg mother cell marker gene slbp2 of the Epinephelus coioides described in claim 5,
It is characterized in that including the following steps：
(1) Epinephelus coioides sexual gland total serum IgE is extracted；
(2) by the total serum IgE SMART of extractionTMPCR cDNA synthetic agent box reverse transcriptions go out the template for RACE；
(3) two pairs of special upstream and downstream primers are designed, is expanded by RACE, obtains the egg mother cell marker gene of Epinephelus coioides
The cDNA of slbp2；
(4) choose in the cDNA of slbp2 than more conservative segment, design upstream and downstream primer, carry out PCR amplification, products therefrom into
Row electrophoresis recycles purpose product, target fragment is carried out construction of recombinant plasmid, screening positive clone extracts plasmid, uses restriction endonuclease
It cuts glue after plasmid obtains target fragment to recycle, the segment of glue recycling prepares Epinephelus coioides with DIG probe reagent boxes
The specific probe of egg mother cell marker gene slbp2.
7. the preparation method of the specific probe of the egg mother cell marker gene slbp2 of the Epinephelus coioides described in claim 6,
It is characterized in that：The nucleotide sequence of upstream and downstream primer such as SEQ ID NO described in step (4)：8~SEQ ID NO：Shown in 9.
8. the specific probe of the egg mother cell marker gene slbp2 of the Epinephelus coioides described in claim 5 is marked in specificity
Remember egg mother cell and identifies the application in egg mother cell type.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810397763.2A CN108676801B (en) | 2018-04-28 | 2018-04-28 | cDNA of oocyte marker gene slbp2 of Epinephelus coioides and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810397763.2A CN108676801B (en) | 2018-04-28 | 2018-04-28 | cDNA of oocyte marker gene slbp2 of Epinephelus coioides and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108676801A true CN108676801A (en) | 2018-10-19 |
| CN108676801B CN108676801B (en) | 2023-06-13 |
Family
ID=63801805
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810397763.2A Active CN108676801B (en) | 2018-04-28 | 2018-04-28 | cDNA of oocyte marker gene slbp2 of Epinephelus coioides and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108676801B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109852710A (en) * | 2019-04-11 | 2019-06-07 | 深圳华大海洋科技有限公司 | One kind SNP marker relevant to grouper ammonia tolerance and application thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060147900A1 (en) * | 2004-10-15 | 2006-07-06 | Northwestern University | Compositions and methods for determining oocyte development potential |
| EP2450456A2 (en) * | 2006-11-02 | 2012-05-09 | Yale University | Assessment of oocyte competence |
| WO2013056252A1 (en) * | 2011-10-14 | 2013-04-18 | Gema Diagnostics, Inc. | Assessment of oocyte competence by detecting spsb2 and/or tp53i3 gene expression |
| CN103342742A (en) * | 2013-06-09 | 2013-10-09 | 北京市水产科学研究所 | Sturgeon oocyte maturation associated proteins and correlation biomaterials thereof |
| CN103724415A (en) * | 2013-12-31 | 2014-04-16 | 中山大学 | Epinephelus coioides sex control gene Rspo1 and preparation method and application thereof |
| CN107267536A (en) * | 2017-07-10 | 2017-10-20 | 山西大学 | Sinopotamon henanense reproduction marker gene vasa and its application |
-
2018
- 2018-04-28 CN CN201810397763.2A patent/CN108676801B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060147900A1 (en) * | 2004-10-15 | 2006-07-06 | Northwestern University | Compositions and methods for determining oocyte development potential |
| EP2450456A2 (en) * | 2006-11-02 | 2012-05-09 | Yale University | Assessment of oocyte competence |
| WO2013056252A1 (en) * | 2011-10-14 | 2013-04-18 | Gema Diagnostics, Inc. | Assessment of oocyte competence by detecting spsb2 and/or tp53i3 gene expression |
| CN103342742A (en) * | 2013-06-09 | 2013-10-09 | 北京市水产科学研究所 | Sturgeon oocyte maturation associated proteins and correlation biomaterials thereof |
| CN103724415A (en) * | 2013-12-31 | 2014-04-16 | 中山大学 | Epinephelus coioides sex control gene Rspo1 and preparation method and application thereof |
| CN107267536A (en) * | 2017-07-10 | 2017-10-20 | 山西大学 | Sinopotamon henanense reproduction marker gene vasa and its application |
Non-Patent Citations (5)
| Title |
|---|
| AURORE THELIE ET AL: "An oocyte-preferential histone mRNA stem-loop-binding protein like is expressed in several mammalian species", 《MOL REPROD DEV》 * |
| Z F WANG ET AL: "Two Xenopus proteins that bind the 3" end of histone mRNA: implications for translational control of histone synthesis during oogenesis", 《MOL CELL BIOL》 * |
| ZHEN LIU ET AL: "Molecular characterization and expression of an oocyte-specific histone stem-loop binding protein in Carassius gibelio", 《COMP BIOCHEM PHYSIOL B BIOCHEM MOL BIOL》 * |
| 吴茜 等: "斜带石斑鱼slbp基因克隆、鉴定及表达模式分析", 《第八届全国石斑鱼类繁育与养殖产业化论坛第二届鱼类工业化养殖学术研讨会论文集》 * |
| 张进隆: "哺乳动物卵母细胞发育相关基因研究进展", 《国外畜牧学(猪与禽)》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109852710A (en) * | 2019-04-11 | 2019-06-07 | 深圳华大海洋科技有限公司 | One kind SNP marker relevant to grouper ammonia tolerance and application thereof |
| CN109852710B (en) * | 2019-04-11 | 2022-06-21 | 深圳华大海洋科技有限公司 | SNP marker related to ammonia tolerance of grouper and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108676801B (en) | 2023-06-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Nishiyama et al. | Cloning and characterization of human CIRP (cold-inducible RNA-binding protein) cDNA and chromosomal assignment of the gene | |
| Li et al. | Cloning and expression of a pivotal calcium metabolism regulator: calmodulin involved in shell formation from pearl oyster (Pinctada fucata) | |
| VON DARL et al. | cDNA cloning and deduced amino acid sequence of two ferritins: soma ferritin and yolk ferritin, from the snail Lymnaea stagnalis L. | |
| Unuma et al. | Cloning of cDNA encoding vitellogenin and its expression in red sea urchin, Pseudocentrotus depressus | |
| de la Peña et al. | Molecular characterization of two ferritins of the scallop Argopecten purpuratus and gene expressions in association with early development, immune response and growth rate | |
| Lee et al. | Molt-inhibiting hormone from the tropical land crab, Gecarcinus lateralis: cloning, tissue expression, and expression of biologically active recombinant peptide in yeast | |
| CN107937406A (en) | A kind of application of Portunus trituberculatus Miers novel C rustin genes and its recombinant protein | |
| CN108676801A (en) | The cDNA of the egg mother cell marker gene slbp2 of Epinephelus coioides a kind of and its application | |
| CN112575000B (en) | Freshwater shrimp SDHB gene, protein coded by same and application thereof | |
| Trinchella et al. | Metallothionein primary structure in amphibians: Insights from comparative evolutionary analysis in vertebrates | |
| CN106831972B (en) | Full-length sequence of mudskipper pleomorphic vitellogenin Vtg gene and cloning method thereof | |
| Khoo et al. | Metallothionein cDNA, promoter, and genomic sequences of the tropical green mussel, Perna viridis | |
| Wang et al. | Molecular characterization and expression of the feminization-1c (fem-1c) in the freshwater mussel (Hyriopsis cumingii) | |
| Nakkrasae et al. | A vasa‐like gene in the giant freshwater prawn, Macrobrachium rosenbergii | |
| Carlo et al. | Analysis of the sequence and expression during sea urchin development of two members of a multigenic family, coding for butanol‐extractable proteins | |
| Mali et al. | A polymorphic, thrombospondin domain-containing lectin is an oocyte marker in Hydractinia: implications for germ cell specification and sex determination | |
| JP2009254234A (en) | Gene that regulates color of shell of pearl oyster and pearl and protein encoded by the same | |
| CN107586327A (en) | Tiger spot cuttlefish neuropeptide FMRFamide genital regulating agent | |
| Yu et al. | Molecular cloning, sequence analysis and phylogeny of first caudata g-type lysozyme in axolotl (Ambystoma mexicanum) | |
| CN110257409B (en) | Red swamp crayfish hatching enzyme gene and application thereof | |
| Kim et al. | Isolation and cDNA cloning of ovarian cortical rod protein in kuruma prawn Marsupenaeus japonicus (Crustacea: Decapoda: Penaeidae) | |
| CN109207482B (en) | Freshwater shrimp GEM gene and encoding protein and application thereof | |
| CN111560378A (en) | Epinephelus lanceolatus gsdf gene and application thereof | |
| Wu et al. | Molecular characterization and expression patterns of stem-loop binding protein (SLBP) genes in protogynous hermaphroditic grouper, Epinephelus coioides | |
| CN108715851B (en) | Epinephelus coioides ingestion regulation related gene AgRP1 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Liu Xiaochun Inventor after: Wu Qian Inventor after: Tang Haipei Inventor after: Li Shuisheng Inventor after: Meng Zining Inventor after: Cai Chunyou Inventor after: Li Bo Inventor after: Lin Haoran Inventor before: Liu Xiaochun Inventor before: Wu Qian Inventor before: Li Shuisheng Inventor before: Meng Zining Inventor before: Cai Chunyou Inventor before: Li Bo Inventor before: Lin Haoran |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |