CN108624622A - A kind of genetically engineered cell strain that can secrete mouse interleukin -6 based on CRISPR-Cas9 systems structure - Google Patents
A kind of genetically engineered cell strain that can secrete mouse interleukin -6 based on CRISPR-Cas9 systems structure Download PDFInfo
- Publication number
- CN108624622A CN108624622A CN201810467123.4A CN201810467123A CN108624622A CN 108624622 A CN108624622 A CN 108624622A CN 201810467123 A CN201810467123 A CN 201810467123A CN 108624622 A CN108624622 A CN 108624622A
- Authority
- CN
- China
- Prior art keywords
- cell
- mouse
- genetically engineered
- interleukin
- cell strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/02—Preparation of hybrid cells by fusion of two or more cells, e.g. protoplast fusion
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0693—Tumour cells; Cancer cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
- C12N2510/02—Cells for production
Abstract
The present invention provides a kind of genetically engineered cell strains that can secrete mouse interleukin 6 based on CRISPR Cas9 systems structure.Present invention firstly provides the sgRNA of selectively targeted mouse rosa 26 gene, target sequence builds the fixed point cut vector that can express sgRNA the and Cas9 albumen simultaneously as shown in SEQ ID NO.1；The present invention also constructs the donor carriers containing mouse interleukin 6 and ROSA26 DNA homolog sequences, in the sites the ROSA26 site-directed integration mouse interleukin 6 of mouse cell SP2/0, and it is screened by selection markers and obtains homozygous cell lines, obtain the genetically engineered cell strain of high expression mouse interleukin 6, the cell strain of the present invention can be used for producing the hybridoma with high proportion secretion capacity, have broad application prospects in monoclonal antibody preparation field.
Description
Technical field
The invention belongs to genetic engineerings and gene genetic to modify field, specifically, being related to being based on CRISPR-Cas9 systems
The genetically engineered cell strain that can secrete mouse interleukin -6 of structure.
Background technology
CRISPR(clustered regularly interspaced short palindromic repeats)/Cas
(CRISPR-associated) system is a kind of distinctive immune system for exogenous genetic material of prokaryotes, is passed through
The RNA of sequence specific is mediated, the exogenous DNA of cutting degradation, including bacteriophage and exogenous plasmid, causes lacking for target gene function
Mistake or excalation.CRISPR/Cas systems can be maximum as a kind of gene editing system with locus specificity
Feature is that easy to operate, at low cost, effect is efficient, is new discovery over the past two years and to be widely used in the gene editing of basic research new
Technology.In CRISPR/Cas9 systems, crRNA (CRISPR-derived RNA) passes through base pairing and tracrRNA
(trans-activating RNA) is combined and is formed tracrRNA/crRNA compounds, this compound can guide nuclease Cas9
Albumen shears double-stranded DNA in the sequence target site matched with crRNA.By artificially designing, crRNA and tracrRNA can be changed
It makes, forms the single rna with guiding function, i.e. sgRNA (single guide RNA).It is demonstrated experimentally that sgRNA is enough to guide
Cas9 cuts the fixed point of DNA.
CRISPR/Cas is the strong tools for carrying out gene editing, can carry out accurate edits to gene.If will contain
The plasmid and sgRNA expression plasmids of Cas9 protein coding genes are transferred in cell together, and sgRNA can target target sequence,
Cas9 albumen then can be such that corresponding DNA double chain is broken.And organism itself is there is the acknowledgement mechanism of DNA damage reparation,
The sequence for being broken upstream and downstream both ends can be connected, to realize the knockout of target gene in cell.If on this basis
The template plasmid (donor DNA molecule, i.e. donor carriers) of a reparation is introduced for cell, cell will be according to the template of offer
Segment or rite-directed mutagenesis are introduced in repair process, and the replacement or mutation of gene thus may be implemented.
The sites ROSA26 are located at No. 6 chromosome of mouse genome, and the gene energy normal table expression which is transferred to is
Most-often used site-directed integration site in mouse cell.The CRISPR/Cas9 systems in the sites special target ROSA26 can be in mouse
Generate DNA double chain fracture on the sites ROSA26 on No. 6 chromosome, trigger the DNA repair mechanisms of cell, induced gene group with
Homologous recombination (HR) occurs for ROSA26 donor plasmid quality inspections, and the DNA fragmentation on donor plasmid is integrated on genome
The sites ROSA26.
Monoclonal antibody has titre high, and high specificity, the uniform feature of quality, it is not only largely used to basic research,
It is additionally operable to the fields such as clinical diagnosis, internal Image Location, food product environment monitoring, interior therapeutic and targeted therapy.With biological skill
The development of art, effect of the monoclonal antibody in terms of disease diagnosis and therapy are increasingly valued by people.
Currently, monoclonal antibody is typically to be prepared by hybridoma technology.But conventional hybridoma technology prepares list
Clonal antibody is a complicated and time-consuming work.It needs to undergo antigen preparation, animal immune, myeloma cell and feeder cells system
A series of flows such as standby, cell fusion, fused cell screening, positive hybridoma cell strain screening and cloning, it is six months average
One or more of monoclonal antibodies could be developed, and success rate is low, of high cost, limits the development of antibody industry.Improve system
One improvement direction that can be for reference of standby monoclonal antibody efficiency be how to obtain it is a high proportion of being capable of secrete monoclonal antibody
Hybridoma
Have studies have shown that white by being overexpressed a factor-mouse in common mouse myeloma cell line SP2/0
Cytokine -6 and obtain genetically engineered cell strain SP2/mIL-6 can increase shared by the hybridoma with secrete monoclonal antibody
Ratio, and the hybridoma obtained has the ability of higher adaptive immune globulin.Usually used SP2/ currently on the market
MIL-6 cell strains are to carry the retrovirus of mIL-6 by infection by obtain, and built based on CRISPR/Cas9 technologies
The cell line of overexpression mIL-6 be not reported so far.Retrovirus does not have accurate edits ability, and viral components are random
Be integrated into cellular genome, it is possible to be integrated into functional area (be such as incorporated into the exon of some gene, promoter region,
Will influence the function of this gene), and then influence the function of cell.Therefore, there is an urgent need to it is a kind of can be accurate by foreign gene
Ground is integrated into the carrier of specific site, effectively to evade the risk that viral original paper random integration is brought.
Invention content
Mouse interleukin -6 can be secreted based on CRISPR-Cas9 systems structure the object of the present invention is to provide a kind of
Genetically engineered cell strain.
Present invention firstly provides a kind of bases that can secrete mouse interleukin -6 based on CRISPR-Cas9 systems structure
Because of the preparation method of engineering cell strain, include the following steps：
(1) structure can express the fixed point cut vector of sgRNA and Cas9 albumen simultaneously；
(2) the donor carriers containing -6 gene of mouse interleukin and ROSA26 DNA homolog sequences are constructed；
(3) fixed point cut vector and donor carriers are transferred to mouse cell SP2/0 myeloma cell, screening positive clone,
It identifies to obtain the final product.
Fixed point cut vector described in step (1), it is preferable that in the initial carrier of selection by crRNA and
TracrRNA is transformed to form sgRNA.
The target sequence of the sgRNA is 5`-CTCCAGTCTTTCTAGAAGAT-3`.
The fixed point cut vector contains selection markers, and preferably selection markers are fluorescent marker.Such as EGFP, RFP, EBFP
Deng.The individual cells that fixed point cut vector has been transferred to can be obtained by airflow classification.
In the donor carriers, the nucleotide sequence of -6 gene of mouse interleukin is as shown in SEQ ID NO.2.
In the donor carriers, the nucleotide sequence such as SEQ ID NO.3 of the homologous left arm of ROSA26 DNA homolog sequences
It is shown, nucleotide sequence carrier as shown in SEQ ID NO.4 of homologous right arm can site-directed integration to mouse cell ROSA26
Site.
Donor carriers of the present invention also contain antibiotic-screening and mark, and the preferably described antibiotic-screening is labeled as purine
Mycin resistant gene.
It is highly preferred that donor carriers of the present invention contain the protein-coding region (mIL-6) of mouse interleukin -6 and
Puromycin resistance gene.Wherein, pass through member between -6 protein-coding region of mouse interleukin and puromycin resistance gene
Part T2A is attached.In addition, donor carriers of the present invention further include constitutive promoter or the tissue spy positioned at upstream
Specific Promoters, and the terminator positioned at downstream.Preferably, the donor carriers contain EF1 promoters.
The present invention provides application of the above-mentioned preparation method in the cell for preparing the raising of expression of interleukin-6 amount.
The present invention provides the genetically engineered cell strains built using above-mentioned preparation method.
The present invention provides application of the genetically engineered cell strain in preparing the high hybridoma of monoclonal antibody secrete amount.
The present invention provides application of the genetically engineered cell strain in preparing monoclonal antibody.The present invention combines
CRISPR/Cas9 technologies and homologous recombination technique will be outer using the donor carriers with specific fragment (such as sites Rosa26)
Source sequence is accurately integrated into specific site, can effectively evade the risk that viral components random integration is brought.In mouse cell
The safe port site of SP2/0 --- the sites ROSA26 site-directed integration mouse interleukin-6, and obtained by selection markers screening
Homozygous cell lines are obtained, the genetically engineered cell strain of high expression mouse interleukin -6 is obtained, and then can be obtained more
Hybridoma with secretion monoclonal antibody ability.Therefore, cell strain of the invention, which can be used for producing, has secretion monoclonal antibody ability
Hybridoma, efficient, cost reduction have broad application prospects in monoclonal antibody preparation field.
Description of the drawings
Fig. 1 is the element skeleton schematic diagram for being integrated into mouse SP2/0 cells.
Fig. 2 is that (cell proportion with fluorescence is higher, then by the efficiency chart of Cas9 Protein cleavages for different sgRNA target sequences
SgRNA is easier by Cas9 Protein cleavages).
Fig. 3 is the fixed point cut vector collection of illustrative plates for designing and building.
Fig. 4 is the donor Vector maps of structure.
Fig. 5 is the SP2/0 cell transfecting figures of transfection fixed point cut vector and donor carriers.
Fig. 6 is the unicellular aspect graph of selected by flow cytometry apoptosis acquisition after puromycin screening.
Fig. 7 is the monoclonal cell subbreed figure for the unicellular formation that airflow classification obtains.
Fig. 8 is the Genomic PCR qualification figure of positive cell.
Fig. 9 is the Q-PCR qualification figures of mIL-6 gene expressions.
Figure 10 is the MTT block diagrams for identifying different cell strain mIL-6 expression quantity.
Specific implementation mode
The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..Without departing substantially from spirit of that invention
In the case of essence, to modifications or substitutions made by the method for the present invention, step or condition, all belong to the scope of the present invention.
Unless otherwise specified, material used in embodiment, biological chemical reagent are conventional commercial reagent, in embodiment
Technological means used is the known conventional means of those skilled in the art.
Embodiment 1 designs and builds suitable fixed point cut vector
1.1 extraction cut vector original plasmids
Using the small extraction reagent kit of plasmid (it is century, article No. CW0511C to buy from health), walked according to the experiment of product description
Rapid a small amount of extraction cut vector original plasmids (buying from addgene, article No. plasmid#48138).
1.2 digestion cut vector original plasmids
It (is bought from Neb, article No. R0539L) using restriction endonuclease, is extracted according to the experimental procedure pair 1.1 of product description
Plasmid carries out digestion, and recycles digestion products.
The 1.3 suitable sgRNA target sequences segments of screening
1.3.1 selecting sgRNA target sites.
According to mouse rosa 26 locus gene group sequence (the NCBI Reference Sequence provided on the websites NCBI:
NC_000072.6), select multiple target sites to be tested, only record the test case of wherein 3 target sites below.Sequence is such as
Under：
sg1：5`-3`CTCCAGTCTTTCTAGAAGAT
sg2：5`-3`:AAGATGGGCGGGAGTCTTCT
sg3：5`-3`:AGTCTTCTGGGCAGGCTTAA
1.3.2 sgRNA target sites screen
It (is bought from Beijing symphysis gene, article No. HS-SR-0001A) using gRNA active fluoros detection kit, according to production
Product specification operating procedure structure detection carrier, and carry out cell experiment.Experimental result is as shown in Fig. 2, No. 1 target sequence selected
Fluorescence Ratio highest in the cell experiment of progress.According to the testing principle of the gRNA active fluoro detection kits used, fluorescence
Ratio is higher, and illustrating the cell proportion that target sequence is cut, higher (target sequence is then carried out homologous heavy by Cas9 Protein cleavages
Group, cell can just express fluorescence), therefore target sequence is easier by Cas9 Protein cleavages.
According to experiment screening as a result, the application selects sgRNA target sites sg1：5`-3`CTCCAGTCTTTCTAGAAGAT
(SEQ ID NO.1) carries out subsequent experimental.
1.4 structure sgRNA target sequence segments
SgRNA target sequence primers are synthesized, and annealing reaction is carried out by PCR instrument.
1.4.1 the sgRNA target sequences designed：
sg-F：5`-3`:CACCCTCCAGTCTTTCTAGAAGAT
sg-R：5`-3`:AAACATCTTCTAGAAAGACTGGAG
1.4.2 annealing reaction uses program：
95℃5min
25℃20min
1.4.3 product dilution annealing completed is used for subsequent experimental at 10uM.
1.5 structure cut vector
1.5.1 T4 ligases (purchase from Neb, article No. M0202S) are used, according to product description, by good original of digestion
Plasmid and the sgRNA target sequences diluted are attached reaction.
1.5.2 use feeling state cell (buying from Bo Maide, article No. BC102-02), according to product description, will connect
The mixture of completion carries out transformation experiment.
1.5.3 picking monoclonal is sequenced, and compares sequencing result, and selection structure successfully pinpoints cut vector.Figure
Spectrum is shown in Fig. 3.
Donor of the structure of embodiment 2 with mouse interleukin -6 and antibiotic-screening label (puromycin) is carried
Body
2.1 extraction donor (donor) carrier original plasmids
Using the small extraction reagent kit of plasmid (it is century, article No. CW0511C to buy from health), walked according to the experiment of product description
Rapid a small amount of extraction donor (donor) carrier original plasmids (buying from addgene, article No. plasmid#37200).
2.2 digestion donor (donor) carrier original plasmids
It (is bought from Neb, article No. R3103S and R0146S) using restriction endonuclease, according to the experimental procedure pair of product description
The plasmid of 2.1 extractions carries out double digestion, and recycles digestion products.
2.3 Cloning of mouse's interleukin-6 encoding histone region sequences
2.3.1 mouse SP2/0 cells are collected；
2.3.2 Trizol methods are used to extract mRNA；
2.3.3 mRNA Reverse Transcriptase kits (buying from Thermo, article No. K1622) are used, according to the reality of product description
It tests the mRNA that step extracts 2.3.2 and carries out reverse transcription；
2.3.4 Cloning of mouse's interleukin-6 protein-coding region
2.3.4.1 cloning primer is designed；
donor-f2:5`-3`:CGCCTACACTAGTGCCACCatgaagttcctctctgcaa
donor-r2：5`-3`:GAAGACTTCCTCTGCCCTCggtttgccgagtagatctc
2.3.4.2 expanding -6 protein-coding region of mouse interleukin；
2.3.4.3 amplified fragments are recycled and the segment of amplification are sequenced, nucleotide sequence such as SEQ ID NO.2 institutes
Show.
2.4 synthesizing core element region
2.4.1 cloning EF1 promoter regions
2.4.1.1 cloning primer is designed；
donor-f1：5`-3`:TCTTTCTAGAGaattcAAGGATCTGCGATCGCTCCGGT
donor-r1：5`-3`:ttgcagagaggaacttcatGGTGGCACTAGTGTAGGCG
2.4.1.2 expanding EF1 promoter regions；
2.4.1.3 amplified fragments are recycled.
2.4.2 cloning antibiotic-screening area
2.4.2.1 cloning primer is designed；
donor-f3：5`-3`:gagatctactcggcaaaccGAGGGCAGAGGAAGTCTTC
donor-r3：5`-3`:tttaaacctcgagGCGGGGAGGCGGCCCAAAGGGAGAT
2.4.2.2 expanding antibiotic-screening area；
2.4.2.3 amplified fragments are recycled.
2.5 structure donor carriers
It 2.5.1, will according to product description step using enzyme (section's biology, article No. TSV-S2 are held up in purchase certainly) is seamlessly connected
The recovery product of 2.2,2.3,2.4.1 and 2.4.2 is attached；
2.5.2 use feeling state cell (buying from Bo Maide, article No. BC102-02) will according to product description step
The mixture that connection is completed carries out transformation experiment.
2.5.3 picking monoclonal is sequenced, and compares sequencing result, and selection builds successful donor carriers.Collection of illustrative plates is shown in
Fig. 4.
3 electricity of embodiment turns fixed point cut vector and donor carriers enter mouse and Sp2/0 myeloma cell
3.1 culture mouse SP2/0 myeloma cells
It recovers and cultivates mouse SP2/0 myeloma cell (buying from ATCC, article No. CRL-1581).Cell culture medium is seen below
Table.
1 murine myeloma cell complete medium component list of table
3.2 setting electroporation parameter
The present invention is used using the new and effective cell electrotransfection instrument of H1 (purchase reaches bio tech ltd from Suzhou one)
Following experiment parameter carries out electricity and turns experiment.
2 H1 electroporation electricity of table turns SP2/0 parameter lists
Note:Electricity swivel product is 60ul, 5 multiple holes of every group of setting.
3.3 electricity turn SP2/0 cells
3.3.1 cell count
Microscopically observation cell collects cell, counts, and according to 2 conditional of table, take required cell quantity.
3.3.2 Plasmid DNA is added
According to 2 conditional of table, buffer and plasmid (donor plasmid 2ug, cut vector plasmid 1ug) is added, gently blows and beats
Mixing.
3.3.3 electricity turns fixed point cut vector and donor carriers enter mouse and Sp2/0 myeloma cell.
3.3.4 third day (after 72 hours) after electricity turns, the cell proportion of observation band green fluorescence are green in field of microscope
The cell that color Fluorescence Ratio is positive is more, and green fluorescence is stronger, indicates that electric transfer efficient is higher.(see Fig. 5), is used in combination fluidic cell
Sorter sorts green fluorescence positive SP2/0 cells.
4 puromycin screening positive clone of embodiment
4.1 use streaming in the 3.3.4 of normal murine myeloma cell complete medium (being shown in Table 1) amplification embodiment 3
Sort the GFP+ cells obtained.
4.2 are added puromycin in normal murine myeloma cell complete medium (being shown in Table 1), carry out cell sieve
Choosing.The puromycin screening concentration that the present invention uses is 0.03ug/ml, and screening time is 3 days.Screening changes into normal after 3 days
Murine myeloma cell complete medium culture one week carries out postsearch screening.The puromycin screening concentration that postsearch screening uses
For 0.05ug/ml, screening time is 3 days.Screening changes normal murine myeloma cell complete medium culture one into after 3 days
Week.
4.3 carry out unicellular sorting using the cell obtained after two-wheeled is screened in flow cell sorter pair 4.2, it is ensured that every
1 cell is contained only in a hole (see Fig. 6).
4.4 is unicellular using being obtained in normal murine myeloma cell medium culture 4.3, until growing up to unicellular
The monoclonal cell subbreed (see Fig. 7) in source, and be named as CSP2/mIL-6 (CRISPR/Cas9 derived SP2/mIL-6,
CSP2/mIL-6).The Cell subline of 8 single cell sources of picking is enlarged culture, is respectively designated as CSP2/mIL-6-1 ﹑
CSP2/mIL-6-2、CSP2/mIL-6-3、CSP2/mIL-6-4、CSP2/mIL-6-5、CSP2/mIL-6-6、CSP2/mIL-6-7
And CSP2/mIL-6-8.
Embodiment 5 is obtained by molecular biology experiment identification can secrete mouse based on what CRISPR/Cas9 systems were built
The genetically engineered cell strain of interleukin-6
5.1 Genomic PCRs identify positive colony
5.1.1 8 plants of subclonal cell lines for collecting embodiment 4 respectively, (are bought from day using genome extracts kit
Root, article No. DP304-03) genome is extracted respectively.
5.1.2 genome identification primer is designed, PCR amplification is carried out to the genome of extraction.
F：agccagacctccatcgcgca
R：tgtagttttgctgcataaaa
Then, qualification figure, which is shown in 8, to be identified to the DNA product of amplification by gel electrophoresis.
As shown in the figure：Subclonal cell line 1 (CSP2/mIL-6-1) is identified as false positive, is not integrated in genome
mIL-6；Subclonal cell line 2-8 is positive colony, wherein subclonal cell line 2, and 3,4,6,8 be heterozygote, clone 5 and 7
(CSP2/mIL-6-5 and CSP2/mIL-6-7) is homozygote.Therefore, selection subclonal cell line CSP2/mIL-6-5 and CSP2/
MIL-6-7 carries out following further verifications as target cell system.
5.2 Q-PCR identify mIL-6 gene expression amounts
5.2.1 collecting mouse relevant cell
Select mouse SP2/0 cells as negative cells respectively, selecting SP2/mIL-6, (purchase is certainly as positive cell
ATCC, article No. CRL-2016), it selects CSP2/mIL-6-5 and CSP2/mIL-6-7 as target cell system, collects cell.
5.2.2 Trizol methods are used to extract mRNA；
5.2.3 mRNA Reverse Transcriptase kits (buying from Thermo, article No. K1622) are used, according to the reality of product description
It tests the mRNA that step extracts 5.2.2 and carries out reverse transcription；
5.2.4 design primer carries out Q-PCR amplifications to the cDNA of 5.2.3 reverse transcriptions.
Q-F：AGAAAAGAGTTGTGCAATG
Q-R：CCAGAAGACCAGAGGAAA
5.2.5 Q-PCR experimental datas are shown in Table 3, Q-PCR interpretations of result and see Fig. 9.
Expression data of the table 3 Q-PCR detection IL-6 genes in murine myeloma cell sample
| SP2/mIL-6 | CSP2/mIL-6-5 | CSP2/mIL-6-7 | SP2/0 | |
| IL-6 | 1.0061±0.1643 | 1.2613±0.0454 | 1.4762±0.1758 | 0.0001±0.0000 |
The result shows that：The base of overexpression mouse interleukin -6 produced by the present invention based on CRISPR/Cas9 structures
Because mIL-6 gene expression amounts are higher than the cell strain that ATCC is sold in engineering cell strain CSP2/mIL-6-5 and CSP2/mIL-6-7
SP2/mIL-6。
Embodiment 6 by cell function experimental identification based on CRISPR/Cas9 systems build to secrete mouse thin in vain
The genetically engineered cell strain of born of the same parents' interleukin -6
6.1 cell line selection
Select mouse SP2/0 cells as negative cells respectively, selecting SP2/mIL-6, (purchase is certainly as positive cell
ATCC, article No. CRL-2016), select CSP2/mIL-6-5 and CSP2/mIL-6-7 as target cell system.IL-6 is selected to rely on
Cell strain 7TD1 is as test cell.
6.2 to be checked groups of preparation of samples
SP2/0 cells, SP/2mIL-6, CSP/2mIL-6-5, CSP/2mIL-6-7 recovery, adjust cell state, through cell
2 × 10 are pressed after counting6It is seeded in 100mm Tissue Culture Dish, after persistently cultivating 35 hours, changes liquid, each cell is placed
10ml RPMI-10%FBS culture mediums, cultivate and collect within 24 hours each group supernatant, and 2000rpm is centrifuged 5 minutes, 0.22 μM of filter
Filtering, is configured to 20% myeloma supernatant-RPMI-10%FBS culture mediums, as to be checked group of sample.It is labeled as：Supernatant group 1
(SP2/0), supernatant group 2 (SP/2mIL-6), supernatant group 3 (CSP/2mIL-6-5), supernatant group 4 (CSP/2mIL-6-7).
6.3 cell pretreatment
Culture cell 7TD1 to 80~90% expires ware, and 7TD1 cells are collected in serum-free RPMI washings.RPMI-10%FBS tune
Whole cell density is 2 × 104A/ml.
6.4MTT experiment
Two time points of 48h, 72h are set, takes two piece of 96 porocyte culture plates, measuring samples group is added on 96 orifice plates,
Per 100 μ l of hole, 5 multiple holes are arranged in each sample, and wherein negative control group is RPMI-10%FBS, IL-6 (0.5ng/ml)-
RPMI-10%FBS groups are positive controls；
100 μ l 7TD1 cell suspensions (2 × 10 are added per hole3A/hole), edge hole is filled with sterile PBS to eliminate edge
Effect spreads 2 blocks of plates altogether；
96 orifice plates are placed in 5%CO2,48h is cultivated in 37 DEG C of incubators, the 1st block of plate is taken out and is detected；
20 μ l of MTT solution are added per hole, is put into cell incubator and continues to cultivate 4h；
Culture solution in hole carefully is sucked, 100 μ l DMSO are added per hole, crystal is made fully to dissolve；It is each with microplate reader detection
Light absorption value of the hole at 570nm wavelength；72h is cultivated in 37 DEG C of incubators, is taken out the 2nd block of plate and is detected；Using Graphpad
Statistics, analysis data.Experimental data is shown in Table 4, and analysis result is shown in Figure 10.
4 MTT result datas of table
The result shows that：The base of overexpression mouse interleukin -6 of the present invention based on CRISPR/Cas9 structures
Because mIL-6 secretory volumes pass through reverse transcription disease higher than what ATCC was sold in engineering cell strain CSP2/mIL-6-5 and CSP2/mIL-6-7
The mIL-6 secretory volumes of the cell strain SP2/mIL-6 secretions of the overexpression mIL-6 of poison structure.
Although above having used general explanation, specific implementation mode and experiment, the present invention is made to retouch in detail
It states, but on the basis of the present invention, it can be made some modifications or improvements, this is apparent to those skilled in the art
's.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, belong to claimed
Range.
Sequence table
<110>The Hunan biotech inc Ai Jia
<120>A kind of genetically engineered cell strain that can secrete mouse interleukin -6 based on CRISPR-Cas9 systems structure
<130> KHP181112204.0
<160> 18
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
ctccagtctt tctagaagat 20
<210> 2
<211> 636
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
atgaagttcc tctctgcaag agacttccat ccagttgcct tcttgggact gatgctggtg 60
acaaccacgg ccttccctac ttcacaagtc cggagaggag acttcacaga ggataccact 120
cccaacagac ctgtctatac cacttcacaa gtcggaggct taattacaca tgttctctgg 180
gaaatcgtgg aaatgagaaa agagttgtgc aatggcaatt ctgattgtat gaacaacgat 240
gatgcacttg cagaaaacaa tctgaaactt ccagagatac aaagaaatga tggatgctac 300
caaactggat ataatcagga aatttgccta ttgaaaattt cctctggtct tctggagtac 360
catagctacc tggagtacat gaagaacaac ttaaaagata acaagaaaga caaagccaga 420
gtccttcaga gagatacaga aactctaatt catatcttca accaagaggt aaaagattta 480
cataaaatag tccttcctac cccaatttcc aatgctctcc taacagataa gctggagtca 540
cagaaggagt ggctaaggac caagaccatc caattcatct tgaaatcact tgaagaattt 600
ctaaaagtca ctttgagatc tactcggcaa acctag 636
<210> 3
<211> 794
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
cagttaacgg cagccggagt gcgcagccgc cggcagcctc gctctgccca ctgggtgggg 60
cgggaggtag gtggggtgag gcgagctgga cgtgcgggcg cggtcggcct ctggcggggc 120
gggggagggg agggagggtc agcgaaagta gctcgcgcgc gagcggccgc ccaccctccc 180
cttcctctgg gggagtcgtt ttacccgccg ccggccgggc ctcgtcgtct gattggctct 240
cggggcccag aaaactggcc cttgccattg gctcgtgttc gtgcaagttg agtccatccg 300
ccggccagcg ggggcggcga ggaggcgctc ccaggttccg gccctcccct cggctccgcg 360
ccgcagagtc tggccgcgcg cccctgcgca acgtggcagg aagcgcgcgc tgggggcggg 420
gacgggcagt agggctgagc ggctgcgggg cgggtgcaag cacgtttccg acttgagttg 480
cctcaagagg ggcgtgctga gccagacctc catcgcgcac tccggggagt ggagggaagg 540
agcgagggct cagttgggct gttttggagg caggaagcac ttgctctccc aaagtcgctc 600
tgagttgtta tcagtaaggg agctgcagtg gagtaggcgg ggagaaggcc gcacccttct 660
ccggaggggg gaggggagtg ttgcaatacc tttctgggag ttctctgctg cctcctggct 720
tctgaggacc gccctgggcc tgggagaatc ccttccccct cttccctcgt gatctgcaac 780
tccagtcttt ctag 794
<210> 4
<211> 811
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
agatgggcgg gagtcttctg ggcaggctta aaggctaacc tggtgtgtgg gcgttgtcct 60
gcaggggaat tgaacaggtg taaaattgga gggacaagac ttcccacaga ttttcggttt 120
tgtcgggaag ttttttaata ggggcaaata aggaaaatgg gaggataggt agtcatctgg 180
ggttttatgc agcaaaacta caggttatta ttgcttgtga tccgcctcgg agtattttcc 240
atcgaggtag attaaagaca tgctcacccg agttttatac tctcctgctt gagatcctta 300
ctacagtatg aaattacagt gtcgcgagtt agactatgta agcagaattt taatcatttt 360
taaagagccc agtacttcat atccatttct cccgctcctt ctgcagcctt atcaaaaggt 420
attttagaac actcatttta gccccatttt catttattat actggcttat ccaaccccta 480
gacagagcat tggcattttc cctttcctga tcttagaagt ctgatgactc atgaaaccag 540
acagattagt tacatacacc acaaatcgag gctgtagctg gggcctcaac actgcagttc 600
ttttataact ccttagtaca ctttttgttg atcctttgcc ttgatcctta attttcagtg 660
tctatcacct ctcccgtcag gtggtgttcc acatttgggc ctattctcag tccagggagt 720
tttacaacaa tagatgtatt gagaatccaa cctaaagctt aactttccac tcccatgaat 780
gcctctctcc tttttctcca tttataaact g 811
<210> 5
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
aagatgggcg ggagtcttct 20
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
agtcttctgg gcaggcttaa 20
<210> 7
<211> 24
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
caccctccag tctttctaga agat 24
<210> 8
<211> 24
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 8
aaacatcttc tagaaagact ggag 24
<210> 9
<211> 38
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 9
cgcctacact agtgccacca tgaagttcct ctctgcaa 38
<210> 10
<211> 38
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 10
gaagacttcc tctgccctcg gtttgccgag tagatctc 38
<210> 11
<211> 38
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 11
tctttctaga gaattcaagg atctgcgatc gctccggt 38
<210> 12
<211> 38
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 12
ttgcagagag gaacttcatg gtggcactag tgtaggcg 38
<210> 13
<211> 38
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 13
gagatctact cggcaaaccg agggcagagg aagtcttc 38
<210> 14
<211> 38
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 14
tttaaacctc gaggcgggga ggcggcccaa agggagat 38
<210> 15
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 15
agccagacct ccatcgcgca 20
<210> 16
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 16
tgtagttttg ctgcataaaa 20
<210> 17
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 17
agaaaagagt tgtgcaatg 19
<210> 18
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 18
ccagaagacc agaggaaa 18
Claims (10)
1. a kind of system of the genetically engineered cell strain that can secrete mouse interleukin -6 based on CRISPR-Cas9 systems structure
Preparation Method includes the following steps：
(1) structure can express the fixed point cut vector of sgRNA and Cas9 albumen simultaneously；
(2) the donor carriers containing -6 gene of mouse interleukin and ROSA26 DNA homolog sequences are constructed；
(3) fixed point cut vector and donor carriers are transferred to mouse cell SP2/0 myeloma cell, screening positive clone, identification
To obtain the final product.
2. preparation method as described in claim 1, which is characterized in that the target sequence of the sgRNA is 5`-
CTCCAGTCTTTCTAGAAGAT-3`。
3. preparation method as described in claim 1, which is characterized in that the fixed point cut vector contains selection markers, preferably
Selection markers are fluorescent marker.
4. preparation method as described in any one of claims 1-3, which is characterized in that in the donor carriers, murine interleukin is situated between
The nucleotide sequence of plain -6 genes is as shown in SEQ ID NO.2.
5. preparation method as described in any one of claims 1-3, which is characterized in that in the donor carriers, ROSA26 genes are same
The nucleotide sequence of the homologous left arm of source sequence is as shown in SEQ ID NO.3, the nucleotide sequence such as SEQ ID of homologous right arm
Shown in NO.4.
6. preparation method as described in any one of claims 1-3, which is characterized in that the donor carriers also contain antibiotic and sieve
Choosing label, the preferably described antibiotic-screening are labeled as puromycin resistance gene.
7. application of any preparation methods of claim 1-6 in the cell for preparing the raising of expression of interleukin-6 amount.
8. the genetically engineered cell strain that any preparation methods of claim 1-6 are built.
9. application of the genetically engineered cell strain in preparing the high hybridoma of monoclonal antibody secrete amount described in claim 7.
10. application of the genetically engineered cell strain in preparing monoclonal antibody described in claim 7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810467123.4A CN108624622A (en) | 2018-05-16 | 2018-05-16 | A kind of genetically engineered cell strain that can secrete mouse interleukin -6 based on CRISPR-Cas9 systems structure |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810467123.4A CN108624622A (en) | 2018-05-16 | 2018-05-16 | A kind of genetically engineered cell strain that can secrete mouse interleukin -6 based on CRISPR-Cas9 systems structure |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108624622A true CN108624622A (en) | 2018-10-09 |
Family
ID=63693588
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810467123.4A Pending CN108624622A (en) | 2018-05-16 | 2018-05-16 | A kind of genetically engineered cell strain that can secrete mouse interleukin -6 based on CRISPR-Cas9 systems structure |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108624622A (en) |
Cited By (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110272875A (en) * | 2019-07-09 | 2019-09-24 | 广州华腾生物医药科技有限公司 | A kind of method for building up of suspension cell KBM5 high efficiency gene editor's stable cell lines |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| CN110951782A (en) * | 2019-12-23 | 2020-04-03 | 湖南普拉特网络科技有限公司 | Cell strain capable of stably expressing Cas9 protein and preparation method and application thereof |
| CN111254165A (en) * | 2018-12-01 | 2020-06-09 | 复旦大学 | Method for generating protein sequence diversity screening library by CRISPR system |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100311162A1 (en) * | 2004-07-23 | 2010-12-09 | Immunomedics, Inc. | Mammalian Cell Lines for Increasing Longevity and Protein Yield from a Cell Culture |
| CN102123582A (en) * | 2008-06-27 | 2011-07-13 | 莫鲁斯有限公司 | Antibody producing non-human mammals |
| WO2015033343A1 (en) * | 2013-09-03 | 2015-03-12 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | Compositions and methods for expressing recombinant polypeptides |
| WO2015167959A1 (en) * | 2014-04-28 | 2015-11-05 | Sigma-Aldrich Co. Llc | Epigenetic modification of mammalian genomes using targeted endonucleases |
| CN105142669A (en) * | 2012-12-06 | 2015-12-09 | 西格马-奥尔德里奇有限责任公司 | Crispr-based genome modification and regulation |
| CN105153305A (en) * | 2015-06-26 | 2015-12-16 | 安泰吉（北京）生物技术有限公司 | Fully human monoclonal antibody against tetanus toxin and derivative thereof, and preparation method and application thereof |
| CN105462934A (en) * | 2016-01-05 | 2016-04-06 | 同昕生物技术（北京）有限公司 | Additive used for increasing clone number of hybridoma cells and preparation method of additive |
| US20170204430A1 (en) * | 2013-04-16 | 2017-07-20 | Regeneron Pharmaceuticals, Inc. | Targeted modification of rat genome |
-
2018
- 2018-05-16 CN CN201810467123.4A patent/CN108624622A/en active Pending
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100311162A1 (en) * | 2004-07-23 | 2010-12-09 | Immunomedics, Inc. | Mammalian Cell Lines for Increasing Longevity and Protein Yield from a Cell Culture |
| CN102123582A (en) * | 2008-06-27 | 2011-07-13 | 莫鲁斯有限公司 | Antibody producing non-human mammals |
| CN105142669A (en) * | 2012-12-06 | 2015-12-09 | 西格马-奥尔德里奇有限责任公司 | Crispr-based genome modification and regulation |
| US20170204430A1 (en) * | 2013-04-16 | 2017-07-20 | Regeneron Pharmaceuticals, Inc. | Targeted modification of rat genome |
| WO2015033343A1 (en) * | 2013-09-03 | 2015-03-12 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | Compositions and methods for expressing recombinant polypeptides |
| WO2015167959A1 (en) * | 2014-04-28 | 2015-11-05 | Sigma-Aldrich Co. Llc | Epigenetic modification of mammalian genomes using targeted endonucleases |
| CN105153305A (en) * | 2015-06-26 | 2015-12-16 | 安泰吉（北京）生物技术有限公司 | Fully human monoclonal antibody against tetanus toxin and derivative thereof, and preparation method and application thereof |
| CN105462934A (en) * | 2016-01-05 | 2016-04-06 | 同昕生物技术（北京）有限公司 | Additive used for increasing clone number of hybridoma cells and preparation method of additive |
Non-Patent Citations (5)
| Title |
|---|
| J D CHUNG 等: "Extension of Sp2/0 hybridoma cell viability through interleukin‐6 supplementation", 《BIOTECHNOL BIOENG》 * |
| M S ZHU 等: "Expresion of exogenous NF-IL6 induces apoptosis in Sp2/0-Ag14 myeloma cells", 《DNA CELL BIOL》 * |
| SCOTT K DESSAIN 等: "High efficiency creation of human monoclonal antibody-producing hybridomas, Journal of Immunological Methods", 《J IMMUNOL METHODS》 * |
| VAN TRUNG CHU 等: "Efficient generation of Rosa26 knock-in mice using CRISPR/Cas9 in C57BL/6 zygotes", 《BMC BIOTECHNOL》 * |
| 邹石泉 等: "应用持续表达重组IL-6的骨髓瘤亲本细胞提高产生总的和特异性单抗杂交瘤的频率", 《细胞与分子免疫学杂志》 * |
Cited By (37)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| CN111254165A (en) * | 2018-12-01 | 2020-06-09 | 复旦大学 | Method for generating protein sequence diversity screening library by CRISPR system |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| CN110272875A (en) * | 2019-07-09 | 2019-09-24 | 广州华腾生物医药科技有限公司 | A kind of method for building up of suspension cell KBM5 high efficiency gene editor's stable cell lines |
| CN110951782A (en) * | 2019-12-23 | 2020-04-03 | 湖南普拉特网络科技有限公司 | Cell strain capable of stably expressing Cas9 protein and preparation method and application thereof |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108624622A (en) | A kind of genetically engineered cell strain that can secrete mouse interleukin -6 based on CRISPR-Cas9 systems structure | |
| CN108342480A (en) | A kind of genetic mutation detection Quality Control object and preparation method thereof | |
| CN106916820B (en) | SgRNA and its application of porcine ROSA 26 gene can effectively be edited | |
| CN106191116B (en) | Foreign gene based on CRISPR/Cas9 knocks in integration system and its method for building up and application | |
| CN106047877B (en) | A kind of sgRNA and CRISPR/Cas9 slow virus system of targeting knockout FTO gene and application | |
| CN109266680B (en) | Method for preparing CKO/KI animal model by using Cas9 technology | |
| CN109880851B (en) | Screening report vector and screening method for enriching CRISPR/Cas 9-mediated homologous recombination repair cells | |
| CN109136248A (en) | Multiple target point editor carrier and its construction method and application | |
| US20200339974A1 (en) | Cell labelling, tracking and retrieval | |
| CN103834686B (en) | High-efficient cloning screening expression vector, Preparation Method And The Use | |
| CN111254164A (en) | Method for rapidly establishing CRISPR gene editing liver cancer cell strain and cell strain | |
| CN106086031A (en) | Pig flesh chalone gene editing site and application thereof | |
| WO2016105185A1 (en) | Plant callus populations | |
| CN109486814A (en) | A kind of gRNA for repairing HBB1 point mutation, gene editing system, expression vector and gene editing kit | |
| CN113046385A (en) | Single-double-impurity high-throughput screening method for liquid yeast and application thereof | |
| CN105950656A (en) | Method for rapidly obtaining gene knockout cell strains | |
| Südfeld et al. | The nucleolus as a genomic safe harbor for strong gene expression in Nannochloropsis oceanica | |
| CN108949743A (en) | A kind of full-length genome hybridizing clones method | |
| CN108239620A (en) | The mdck cell strain of 1 encoding gene of IFN-β missing and its construction method and application | |
| CN109628493A (en) | It is a kind of be used to prepare can heteroplastic transplantation T cell gene editing system | |
| Decker et al. | Gene targeting for precision glyco-engineering: production of biopharmaceuticals devoid of plant-typical glycosylation in moss bioreactors | |
| CN105814207A (en) | Zea mays regulatory elements and uses thereof | |
| CN106399370A (en) | Method for establishing stable transgenic flounder embryo cell strain | |
| CN108130314B (en) | Monoclonal cell culture method | |
| CN111647618A (en) | Novel genome editing tool (Lb2Cas12a-RVR) and construction method and application method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |