CN108504738B - Prostate cancer detection probe sequence and application thereof - Google Patents

Prostate cancer detection probe sequence and application thereof Download PDF

Info

Publication number
CN108504738B
CN108504738B CN201810391659.2A CN201810391659A CN108504738B CN 108504738 B CN108504738 B CN 108504738B CN 201810391659 A CN201810391659 A CN 201810391659A CN 108504738 B CN108504738 B CN 108504738B
Authority
CN
China
Prior art keywords
artificial sequence
probe
sequence
dna
kit
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201810391659.2A
Other languages
Chinese (zh)
Other versions
CN108504738A (en
Inventor
李先坤
李鑫
孟歌
何丽
郭曙光
苏芹
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhengzhou Kodia Biotechnology Co ltd
Original Assignee
Zhengzhou Kodia Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhengzhou Kodia Biotechnology Co ltd filed Critical Zhengzhou Kodia Biotechnology Co ltd
Priority to CN201810391659.2A priority Critical patent/CN108504738B/en
Publication of CN108504738A publication Critical patent/CN108504738A/en
Application granted granted Critical
Publication of CN108504738B publication Critical patent/CN108504738B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/682—Signal amplification

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)

Abstract

The invention relates to the technical field of genetic engineering, and discloses a prostate cancer detection probe sequence and application thereof. The probe sequence comprises a capture extension probe, a K-type label extension probe and a blocking probe. The invention aims at the PCA3 of the prostate cancer to carry out the design and artificial optimization of a capture extension probe, a K-type labeled probe and a closed probe, further improves the specificity of detection of the prostate cancer cells based on similar bDNA and QuantiMAT technologies, shows better quantitative limit, detection limit and sensitivity, and can be applied to the preparation of the kit.

Description

Prostate cancer detection probe sequence and application thereof
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a prostate cancer detection probe sequence and application thereof.
Background
PCA3, a novel prostate cancer antigen 3, PCA3, was discovered in 1995 by a cooperative study of Johns Hopkins Hospital (Baltimore) and Radboud University (Nijmegen, Netherlands), originally named DD3(differential display clone, 3) because of the high specific expression of an mRNA compared to the mRNA expression pattern of normal vs cancerous prostate tissue using differential display analysis (which at that time is a new descriptive method for identifying gene expression in different tissues).
PCA3 was overexpressed in 95% of all prostate cancers detected, and was determined harmlessly from cancerous prostate cells with an accuracy approaching 100%. In addition, PCA3 transcription has not been detected in extraprostatic tissues (benign and malignant), demonstrating that PCA3 is currently the most specific PCA marker known for prostate cancer. Unlike serum PSA, PCA3 is not affected by age, prostate volume or other prostatosis (prostatitis).
The analysis of normal prostate, benign prostatic hyperplasia and prostate cancer cells and their metastases by the Northern blot method of BUSSEMAKERS et al shows that the PCA3 gene is specifically highly expressed in human prostate cancer cells and metastatic necrotic foci, and is not expressed or is lowly expressed in normal prostate and benign prostatic hyperplasia cells. And the expression level of PCA3mRNA is related to the Gleason pathological grade of the prostatic cancer. In contrast, PSA mRNA levels were not significantly different between patients with benign and malignant prostate disease. Busemakers et al also found that PCA3 gene expression was not detectable in normal humans, 18 tissue organs except prostate. HES-SELS et al also performed prostate biopsy on 108 patients with PSA >3ng/mL, and detected PCA3mRNA in the prostate biopsy tissue by time-resolved fluorescence quantitative RT-PCR, and found that the PCA3mRNA has no significant difference between non-malignant prostate tissue and benign prostatic hyperplasia tissue. In prostate cancer, the copy number of PCA3mRNA of prostate cancer specimens with cancer cell numbers greater than 10% is 66 times that of non-malignant prostate tissue. PCA3mRNA copy number of prostate cancer specimens with less than 10% cancer cells was 11-fold higher than that of non-malignant prostate tissue. LANDERS et al detected PCA3mRNA expression in prostate cancer tissue by real-time quantitative PCR, confirming that DD3 is 140-fold higher in prostate cancer tissue than benign prostatic hyperplasia tissue. Thus, PCA3 was specifically highly expressed in prostate cancer cells, and was not expressed or was underexpressed in normal prostate or benign prostatic hyperplastic tissue. PCA3 is therefore suitable as a prostate cancer specific marker.
The prior patent CN105861669A discloses a detection method for rapidly capturing hybrid target substance branched chain DNA signal amplification (QuantiMAT technology), and the sensitivity and the time consumption of the detection method are superior to those of bDNA technology. Related assays for detecting the high risk Human Papillomavirus (HPV) type 16E 6E7 region are provided in the examples thereof. However, the specificity of different QuantiMAT probe sequences on various cancers such as prostate cancer and cervical cancer is most directly influenced, and the QuantiMAT probe sequence aiming at PCA3 designed according to the ProbeDesigner V1.0 tool cannot ensure high specificity when detecting prostate cancer, so that the limit of quantitation (LOQ), the limit of detection (LOD) and the sensitivity are influenced.
Disclosure of Invention
In view of the above, the present invention aims to provide a probe sequence for detecting prostate cancer and an application thereof, so that the probe sequence can detect prostate cancer, has high specificity, and can be applied to applications related to prostate cancer detection.
In order to achieve the above purpose, the invention provides the following technical scheme:
a prostate cancer detection probe sequence, which comprises a capture extension probe, a K-type label extension probe and a blocking probe; wherein, the capture extension probe sequence is shown as SEQ ID No.1-14 and SEQ ID No.78-85, the K-type label extension probe is shown as SEQ ID No.15-64 and SEQ ID No.86-131, and the blocking probe is shown as SEQ ID No.65-77 and SEQ ID No. 132-148.
Aiming at the problem that the specificity of related probes in the bDNA and QuantiMAT technologies is poor when detecting prostate cancer, the invention provides a group of artificially optimized high-specificity probes, which have excellent effects in terms of quantitative Limit (LOQ), detection Limit (LOD) and sensitivity, and have excellent linear relation between detection signals and positive cells. Therefore, the invention provides the application of the probe sequence in the preparation of a kit for detecting prostate cancer.
According to the application, the invention provides a kit for detecting prostate cancer, which comprises the probe sequence.
More specifically, the kit further comprises one or more than two of a signal amplification precursor, a signal amplification body, an Alkaline Phosphatase (AP) labeled reporter probe, a chemiluminescent substrate and a carrier coupled with a universal probe;
wherein the universal probe is complementary paired with a partial sequence of the capture extension probe of the invention;
the signal amplification precursor comprises an amplification precursor leader sequence and a multiply repeated amplicon leader complement sequence;
the signal amplifier comprises an amplifier preposition guide region sequence and a repeated reporting probe complementary sequence;
the sequence of the pre-boot region of the amplification precursor is complementary and matched with the partial sequence of the K-type labeled extension probe;
the magnifying glass pre-guide region sequence is complementarily paired with the repeated magnifying glass pre-guide region complementary sequence;
and the alkaline phosphatase-labeled report probe is complementarily paired with the repeated region complementary sequence of the repeated report probe.
According to various carrier forms commonly used in the art, the carrier of the present invention is preferably a magnetic bead or a cell culture plate, and the universal probe can be either coupled to a group on the surface of the magnetic bead or coated on the cell culture plate through some modification, such as amino modification.
In a specific embodiment of the present invention, the present invention provides a specific universal probe, the sequence of which is shown in SEQ ID No. 149.
In the selection of luminescent substrates, the invention selects adamantane derivatives as luminescent substrates for AP reporter probes for detection in a chemiluminescent analyzer.
The signal amplification precursors, signal amplification entities, Alkaline Phosphatase (AP) -labeled reporter probes of the present invention may correspond to those described or specifically designed in the primary signal amplification strand, secondary signal amplification strand and AP-conjugated reporter probes disclosed in patent CN 105861669A.
Preferably, the plurality of repetitions of the present invention is 20 repetitions.
Preferably, the universal probe is complementary and matched with a partial sequence of the capture extension probe, wherein the partial sequence is a 16bp sequence from the 3 'end to the 5' direction of the capture extension probe; in a specific embodiment of the invention, all probes with terminal 16bp sequence CTCTTGGAAAGAAAGT belong to the capture extension probes, which are capable of complementary paired binding to the universal probe shown in SEQ ID No. 149.
Preferably, the pre-amplification leader sequence is complementary and paired with a partial sequence of the K-type labeled extension probe, wherein the partial sequence is a 14bp sequence from the 3 'end to the 5' direction of the K-type labeled extension probe; in a specific embodiment of the present invention, all probes having terminal 14bp sequences of ctgagtcaaagcat or gaagttaccgtttt belong to the class K-type labeled extension probes, which are capable of complementary pairing with the pre-amplimer leader sequence, and thus the pre-amplimer leader sequence can also be designed.
A set of QuanntiMAT probe sequences aiming at prostate cancer PCA3 is designed as a control by a ProbeDesigner V1.0 tool (http:// www.probedesigner.cn /), in order to ensure the comparability, all probes with the terminal 16bp sequence of CTCTTGGAAAGAAAGT in the control probes belong to capture extension probes (CE), all probes with the terminal 14bp sequence of ctgagtcaaagcat or gaagttaccgtttt belong to K-type labeled extension probes (LE), and the rest are blocking probes (BL), which is as follows:
capture extension probe:
p0-CE：AGGGCACTCTTGTGAGCCACtttttCTCTTGGAAAGAAAGT；p640-CE：AAGAACTCTGAGTGATATCAACATTAGGtttttCTCTTGGAAAGAAAGT；p701-CE：GGTCAAAAGGAACCAAGATACAAAGAACtttttCTCTTGGAAAGAAAGT；p870-CE：TCTCCTCTTGACACATATTAGCTTCTAGtttttCTCTTGGAAAGAAAGT；p973-CE：TTCCCCACAAGAATTTCAACGACTCtttttCTCTTGGAAAGAAAGT；p1141-CE：ATTATCTTCTCTTTCTTTCACCTCCCTGtttttCTCTTGGAAAGAAAGT；p1217-CE：TAGCCATGCAAATGAGAAACCCAGtttttCTCTTGGAAAGAAAGT；p1286-CE：ATGACTGATTACGCCTCATGGGTGtttttCTCTTGGAAAGAAAGT；p1758-CE：GAGGGAGAGCATTAGGACAAATACtttttCTCTTGGAAAGAAAGT；
labeled extension probes of type K:
p20-LE：TTTAGGGTTCACTCCTGGCAATAAAGTTTTTgaagttaccgtttt；p46-LE：AATTTACAAAGAGCTACTCAGGACCAGTTTTTctgagtcaaagcat；p73-LE：TTGTTAAGAGCTCTGTGTGTGTGTGTTTTTgaagttaccgtttt；p98-LE：TGTGTGTGTGAGTGTACATGCCAATTTTTctgagtcaaagcat；p145-LE：CATTATTTCAGACTTAAAAACAAGCATGTTTTCTTTTTgaagttaccgtttt；p178-LE：AAATGGCACTATGAGCTGCCAATGTTTTTctgagtcaaagcat；p202-LE：ATGTATCACCACCATATCTCATTATTCTCTTTTTgaagttaccgtttt；p231-LE：C A G TAAATGTGATAATAATGTCATCTGTTAACATTTTTctgagtcaaagcat；p264-LE：TAAAAAAAGTTTGACTTCACAAAAGCAGCTGTTTTTgaagttaccgtttt；p295-LE：GAAATGGACAACCACAATATGCATAAATCTTTTTctgagtcaaagcat；p324-LE：TAACTCCTACCATCAGCTACACACTTTTTgaagttaccgtttt；p348-LE：TGCTTGACATATATTGTTAGAAGCACCTTTTTTctgagtcaaagcat；p400-LE：AAATACTTGCATTAGGTCTCAGCTGGTTTTTgaagttaccgtttt；p426-LE：GGCTGTGCATCAGGCGGTTTTTTTTctgagtcaaagcat；p446-LE：GAGAAATATTCAATTCTCAGCAGAAGCCTTTTTgaagttaccgtttt；p474-LE：AGAATTTGAATTCCCTCATCTTTTAGGAATCTTTTTctgagtcaaagcat；p579-LE：TGTTCATGGATAGTCCAATAAATAATGTTATCTTTTTTgaagttaccgtttt；p612-LE：TTGAACTGATGCTCATAGGAGAGAATATTTTTTctgagtcaaagcat；p729-LE：TCTGAGCTGTCATCGTCCCCTTTTTgaagttaccgtttt；p749-LE：ATCTCTGTGAGCCACAACCAACAGTTTTTctgagtcaaagcat；p821-LE：ATGAGTTGAATTCTCCTATTATGGATGCTTTTTgaagttaccgtttt；p849-LE：TAGCTTCTGGCCATCTCTGGCTTTTTctgagtcaaagcat；p898-LE：CCTTTGCTTCCACGACTTTTATCTTTTCTTTTTgaagttaccgtttt；p926-LE：TCCAACACATCGCTTACCAATCCTTTTTTctgagtcaaagcat；p998-LE：TCAAGTCTTTTCTTCCATCCCCACTTTTTgaagttaccgtttt；p1022-LE：CACTAACCTGAATGCCTAGACCCTTTTTctgagtcaaagcat；p1045-LE：TTATTTTTATTAATTTCCAATAGATGCTGCCTATGTTTTTgaagttaccgtttt；p1080-LE：GGCTATATTGCTTTAGATGAACATTAGATATTTTTTTTctgagtcaaagcat；p1169-LE：CTCCTCTCCCTATATTACTGATTGCTTTTTgaagttaccgtttt；p1194-LE：ACTGAACAGCATGGTCCCCAATGTTTTTctgagtcaaagcat；p1241-LE：TGGCTCCTTGTGGTACATGCATGTTTTTgaagttaccgtttt；p1264-LE：CAAGACTGCTGAAGCCAGAAGGTTTTTctgagtcaaagcat；p1328-LE：CCTTCGTGATTGTCAGGAGCAAGTTTTTgaagttaccgtttt；p1351-LE：ACCTGAGATGCTCCCTGCCTTTTTTctgagtcaaagcat；p1371-LE：T CAGTGTCCTCTGCATCTCCCTTTTTgaagttaccgtttt；p1392-LE：CTTTCTAATGAAGATCCATAGAATTTGCTACTTTTTctgagtcaaagcat；p1423-LE：ATTTGAGAATTCCAATTAGGAACTCACATGTTTTTgaagttaccgtttt；p1453-LE：TTTTATCTGCCCTATCAATTTTTTAAACTTGCTTTTTTctgagtcaaagcat；p1551-LE：ATATCAACTTTGATTCTTTGTTACAACTTTTCTTACTTTTTgaagttaccgtttt；p1587-LE：TCTTTTATCACCAAAGTGGCTTTTATTCTCTTTTTctgagtcaaagcat；p1617-LE：TTTATTATTATTATTTTCTTTTACTACTATATTACGTTGTTATTATTTTTTgaagttaccgtttt；p1663-LE：TTTGTTCTCTATAGTATCAATTTATTTGATTTAGTTTCTTTTTctgagtcaaagcat；p1782-LE：CTAATGCATGTGGGACTTAAAACCTAGTTTTTgaagttaccgtttt；p1809-LE：ATGATGGGTTGATAGGTGCAGCAATTTTTctgagtcaaagcat；p1857-LE：TGTAACAAACCTACACATTCTGCACATGTTTTTgaagttaccgtttt；p1885-LE：TATCCCAGAACGTAAAGTAAAATTTAAAAAAAAGTGTTTTTctgagtcaaagcat；
and (3) sealing the probe:
p122-BL：AGTGTGCCTCTCTCTCTTTGACC；p376-BL：CGCATTTGTGGGTTCTCTTAAGCA；p505-BL：ATTTACCAGGTTTGGAGAGGATTCAG；p531-BL：ACAGCTCAGGTGCTTTCACTAATG；p555-BL：TCTCTGAACTTCTGTCCCTCTTTG；p668-BL：GATTCAAAGAAATATTAGATTTAAGCTCACACT；p773-BL：CAGGACCCAACGCATGTCTG；p793-BL：AGATCCTTAAATCAAGGAAACCAGTGTC；p950-BL：CTCTCTGCTCTGTTGCTTTGGAC；p1113-BL：AAAGCTCAAGAGGTTCAAAATCCAACTC；p1141-BL：ATTATCTTCTCTTTCTTTCACCTCCCTG；p1310-BL：GAGGGGACCACTCCTGGG；p1486-BL：GAAAATTAAGTTTTTTCAAAATCTGTCCTTGTAAATT；p1523-BL：ACTTTTTCTTACAGTGTCTTGGCATACT；p1701-BL：AATTTATTTTTATTGCTGACTTTTAAAATAAGTGATTCG；p1740-BL：GGGGGTGGGAGAACAGGG；p1833-BL：ACCACTATGGCACACGTATACCTG；
on the premise that other universal probes, luminescent substrates, signal amplification precursors, signal amplification bodies and AP report probes are consistent, the prostate cancer positive cells with different concentrations are used as test objects for carrying out chemiluminescence detection, and the result shows that the signal value of a positive cell sample with the same concentration, which is detected by adopting the probe sequence disclosed by the invention, is obviously higher than that of a control probe sequence, so that the probe sequence disclosed by the invention has high specificity for detecting prostate cancer cells, and the limit of quantitation (LOQ), the limit of detection (LOD) and the sensitivity of detection can be improved.
According to the technical scheme, the design and artificial optimization of the capture extension probe, the K-type labeled probe and the blocking probe are carried out aiming at the PCA3 of the prostate cancer, the specificity of the detection of the prostate cancer cells based on similar bDNA and QuantiMAT technologies is further improved, a better quantitative limit, a detection limit and sensitivity are shown, and the kit can be applied to the preparation of the kit.
Drawings
FIG. 1 is a schematic diagram of the working principle of the kit according to the present invention (the carrier is magnetic beads); wherein 1 represents a universal probe, 2 represents a capture extension probe, 3 represents a target RNA, 4 represents a K-type labeled probe, 5 represents a signal amplification precursor, 6 represents a signal amplification body, 7 represents an AP reporter probe, and 8 represents a blocking probe;
FIG. 2 is a schematic view showing the working principle of the kit according to the present invention (the carrier is a cell culture plate); wherein 1 represents a universal probe, 2 represents a capture extension probe, 3 represents a target RNA, 4 represents a K-type labeled probe, 5 represents a signal amplification precursor, 6 represents a signal amplification body, 7 represents an AP report probe, 8 represents a blocking probe, and 9 represents a cell culture plate;
FIG. 3 shows the results of the luminescence detection tests of the probe sequences of the present invention and the probe sequences of the control group.
Detailed Description
The invention discloses a prostate cancer detection probe sequence and application thereof, and can be realized by appropriately improving process parameters by referring to the content in the text by a person skilled in the art. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. The probe sequences and applications of the present invention have been described by way of example, and it will be apparent to those skilled in the art that the present technology can be implemented and applied by modifying or appropriately changing or combining the probe sequences and applications of the present invention without departing from the spirit and scope of the present invention.
According to the sequence probe and other kit components provided by the invention, the working steps and principles of the specific detection are as follows:
cracking a sample to be detected to release target RNA;
then adding the probe sequence of the invention, combining a part of the capture extension probe with a universal probe of a coupling carrier (magnetic beads or a cell culture plate similar to a 96-well plate), and combining the other part with the target RNA; binding the K-type labeled extension probe with the target RNA; the blocking probe is used for blocking some sites to improve the specificity;
after the probe sets are hybridized, a signal amplification precursor, an amplifier, an alkaline phosphatase-labeled probe and a chemiluminescent substrate are gradually added. According to the principle, a set of K-type labeled extension probes can amplify signals 400 times, and generally one target RNA will bind to 20 sets of K-type labeled extension probes, so that one RNA target will be amplified 8000 times. Finally, detecting with a chemiluminescence analyzer, and the schematic diagram is shown in figure 1 and figure 2.
The quantitative detection can obtain the actual multiple difference, and the result is more direct and accurate than the change result of CT in the conventional method TaqMan, and the sensitivity is 100-1000 times higher than that of TaqMan.
Unless otherwise stated, the test environment and conditions in the comparative test of the invention are consistent except for the differences of technical characteristics.
The prostate cancer detection probe sequence and the application thereof provided by the invention are further explained below.
Example 1: the invention relates to a kit for detecting prostate cancer
1. Probe sequence
The capture extension probe sequence is shown as SEQ ID No.1-14 and SEQ ID No.78-85, the K-type label extension probe is shown as SEQ ID No.15-64 and SEQ ID No.86-131, and the blocking probe is shown as SEQ ID No.65-77 and SEQ ID No. 132-148;
2. kit matching components
Universal probes coupled to carriers such as magnetic beads or cell culture plates: SEQ ID No. 149;
signal amplification precursor: ATGCTTTGACTCAG/AAAACGGTAACTTC (magnified prepro leader sequence, two) + AGGATCGTAAGTAACTAAGGACTACC (magnified prepro leader complement) +19 times magnified prepro leader complement (SEQ ID Nos. 150-151);
the signal amplification is general: GGTAGTCCTTAGTTACTTACGATCCT (magnified preposition leader sequence) + GAATCCATTGAATCCTGTGATT (reporter repeat complement) +19 reporter repeat complements (SEQ ID No. 152);
AP-labeled probe: AATCACAGGATTCAATGGATTC-AP (represented by SEQ ID No. 153);
an adamantane derivative.
Example 2: specificity comparison test
1. Test method
Adopting prostate cancer PC3 positive cells, preparing four cell sample solutions with the concentration of 26/mL, 78/mL, 150/mL and 300/mL by using cell sample preserving fluid produced by Ketjian company;
and (3) specimen lysis:
after the cell specimen liquid is centrifuged, cell clusters are precipitated, and the following mixed liquid is added: 200. mu.l of lysate (lysate is placed in an incubator at 37 ℃ C. for 20 minutes in advance) and 400. mu.l of test water (mixing ratio 1: 2). The cell pellet was blown with a pipette to disperse and suspend the cells, and 5. mu.l of proteinase K was added. Standing for 1 hour at 65 ℃, and oscillating for 2-3 times in the cracking process. After 1 hour, the sample was taken out and the supernatant was used for detection.
Preparing a detection buffer solution:
taking out the detection probe, putting the closed reaction solution on ice for melting, and uniformly mixing and centrifuging after melting.
The specimen detection buffer was 50 ul/well. The configuration method comprises the following steps: 1ul of blocking reaction solution +17ul of lysis solution +31ul of test water +1ul of detection probe.
Preparing a probe: the concentration of each component requires that the CE probe in the probe group is as follows: LE probe: the approximate ratio of BL probes is 1:4: 2. The final concentration of each probe of each component is 1fmol/ul required by CE, 4fmol/ul required by LE and 2fmol/ul required by BL respectively.
Plate distribution:
and taking the 96-hole capture coating plate coated with the universal probe out of a 4-degree refrigerator, and rewarming at normal temperature. And (3) respectively adding the buffer solution and the supernatant to be detected into a 96-hole capture coated plate:
blank control wells: 98ul of blank buffer +2ul of water for the assay.
Test wells: 98ul of blank control buffer +2ul of test supernatant.
And (3) heat preservation conditions and time: the whole block was sealed with a sealing plate with paper and placed in a 55 ℃ incubator for 3.5 hours.
Signal amplification:
preheating the diluent and 10 Xeluent at 37 deg.C for 20 min; amplifying the precursor, taking out the signal amplifier, thawing on ice, shaking, mixing, and centrifuging.
Preparing required liquid: 1 × eluent: collecting 10 × eluate, and purifying with DDH2Diluting with O to 1 × eluent, wherein the volume ratio of the eluent to the DDH is 10 ×2O＝1:9。
Signal amplification precursor: the volume ratio of the solution is that of the signal amplification precursor: adding the signal amplification precursor prepared by the kit into a proper amount of diluent when the diluent is 1: 1000;
the signal amplification is general: the volume ratio of the solution is signal amplification volume: taking a signal prepared by the kit, amplifying and adding the signal into a proper amount of diluent when the diluent is 1: 1000;
AP-labeled probe: the volume ratio of the solution is AP labeled probe: adding the probe marker prepared by the kit into a proper amount of diluent when the diluent is 1: 1000;
(1) the 96-well capture coated plate was removed from the incubator, the seal plate sticker was lifted, the plate was emptied of liquid, and the plate was washed 3 times with 1 × 200ul of eluent per well. 100ul of the prepared signal amplification precursor was added to each well, and the mixture was placed in a 55 ℃ incubator and incubated for 40 minutes.
(2) The 96-well capture coated plate was removed from the incubator, the seal plate sticker was lifted, the plate was emptied of liquid, and the plate was washed 3 times with 1 × 200ul of eluent per well. The prepared signal is amplified to be 100ul per hole, and the mixture is placed into a 55-DEG C incubator for heat preservation for 40 minutes.
(3) The 96-well capture coated plate was removed from the incubator, the seal plate sticker was lifted, the plate was emptied of liquid, and the plate was washed 3 times with 1 × 200ul of eluent per well. 100ul of the prepared AP-labeled probe was added to each well, and the mixture was placed in a 50 ℃ incubator and incubated for 40 minutes.
Reading a plate:
the substrate adamantane derivative was taken out from the 4 ℃ refrigerator and allowed to rewet. Adding a substrate catalyst after rewarming, wherein the ratio of the substrate to the substrate catalyst is 1000:3, shaking and uniformly mixing, and blowing and uniformly mixing by a pipette again before use.
The 96-well capture coated plate was removed from the incubator, the seal plate sticker was lifted, the plate was emptied of liquid, and the plate was washed 3 times with 1 × 200ul of eluent per well. Adding 100ul of the prepared substrate into each hole, putting the substrate into a 46-DEG C incubator, preserving the heat for 20 minutes, taking the substrate out, and detecting the substrate by a cold light instrument.
2. Test object
The invention comprises the following steps: example 1 sequence probes and kit components thereof;
control group: the invention provides the reference sequence probe and the matching components of the reagent kit in the embodiment 1;
3. results
TABLE 1
Number of positive cells (number/ml) Mean value detection according to the invention Control group detection mean value
26.00 6.79 2.12
78.00 15.68 4.15
150.00 32.85 8.83
300.00 65.95 16.36
Comparative bar graphs were plotted against the data in table 1, see figure 3. According to the test results, it is obvious that the probe sequence of the invention can obtain higher detection signals, which indicates that the probe sequence of the invention has higher detection specificity.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Zhengzhou Ketuya Biotechnology Co., Ltd
<120> prostate cancer detection probe sequence and application thereof
<130> MP1730590
<160> 153
<170> SIPOSequenceListing 1.0
<210> 1
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 1
acagaagaaa tagcaagtgc cgagtttttc tcttggaaag aaagt 45
<210> 2
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 2
cgagggagac caggaagatc tttttctctt ggaaagaaag t 41
<210> 3
<211> 54
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 3
tgtttcaatg aacaccaaga taaataagtg aagtttttct cttggaaaga aagt 54
<210> 4
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 4
tcaccatcga cggcactttc tgtttttctc ttggaaagaa agt 43
<210> 5
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 5
tgagaaataa gaaaggctgc tgactttatt tttctcttgg aaagaaagt 49
<210> 6
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 6
atgagaggaa aacagacgag aaaatctttt tttctcttgg aaagaaagt 49
<210> 7
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 7
agataaccac ggggcagagg tttttctctt ggaaagaaag t 41
<210> 8
<211> 54
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 8
aatcatttca tatttctaac cctcaaaaca aagtttttct cttggaaaga aagt 54
<210> 9
<211> 54
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 9
atatatccag ccacactcat ttttaatatt tagtttttct cttggaaaga aagt 54
<210> 10
<211> 40
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 10
gagtgttctg gcccaggggt ttttctcttg gaaagaaagt 40
<210> 11
<211> 46
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 11
actagcacac agcatgatca ttacgttttt ctcttggaaa gaaagt 46
<210> 12
<211> 48
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 12
ttcatgcaaa gaagggacac atatgagttt ttctcttgga aagaaagt 48
<210> 13
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 13
cccaaaggta acctttatcc atttcatgtt tttctcttgg aaagaaagt 49
<210> 14
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 14
gtgagtgcgc tttagaattt tggctttttc tcttggaaag aaagt 45
<210> 15
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 15
aagctggcat cagaaaaaca gaggtttttg aagttaccgt ttt 43
<210> 16
<211> 40
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 16
ggagatttgt gtggctgcag ctttttctga gtcaaagcat 40
<210> 17
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 17
tgcatggtgg gaaggacctg tttttgaagt taccgtttt 39
<210> 18
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 18
atgatacaga ggaattacaa cacatatact tagtttttct gagtcaaagc at 52
<210> 19
<211> 40
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 19
agctagtccg ctgtgagtct ctttttgaag ttaccgtttt 40
<210> 20
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 20
ctcagtgaca cagggctgga tttttctgag tcaaagcat 39
<210> 21
<211> 40
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 21
ccatctgagg ccacacatct gtttttgaag ttaccgtttt 40
<210> 22
<211> 51
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 22
ctgaaatgga gataattaac atcactagaa actttttctg agtcaaagca t 51
<210> 23
<211> 50
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 23
agcaagatga caatataatg tctaagtagt gtttttgaag ttaccgtttt 50
<210> 24
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 24
acatgttttt gcacatttcc agcccttttt ctgagtcaaa gcat 44
<210> 25
<211> 46
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 25
ctttaaatat ccacacacac aggaagcttt ttgaagttac cgtttt 46
<210> 26
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 26
acaaaaggaa gcacagagat cccttttttc tgagtcaaag cat 43
<210> 27
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 27
ccgcttgtga gggaaggaca tttttgaagt taccgtttt 39
<210> 28
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 28
ttagaaaatg aattgatgtg ttccttaaag gattttttct gagtcaaagc at 52
<210> 29
<211> 51
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 29
tggatattta tttgaacggg attacagatt tgtttttgaa gttaccgttt t 51
<210> 30
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 30
aaatgaagtc acaaagtgag cattaccatt tttctgagtc aaagcat 47
<210> 31
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 31
gtcaggattc tggccctgct tttttgaagt taccgtttt 39
<210> 32
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 32
gcctaaactg tgcgttcata accatttttc tgagtcaaag cat 43
<210> 33
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 33
ctgttgtaat atctgatctc tacggttctt tttgaagtta ccgtttt 47
<210> 34
<211> 40
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 34
cttctgggcc caacattctc ctttttctga gtcaaagcat 40
<210> 35
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 35
ttcccagatc tgtactgtga cctttttttg aagttaccgt ttt 43
<210> 36
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 36
tctacactgt agaataacat tactcatttt gtttttttct gagtcaaagc at 52
<210> 37
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 37
caaagaccct tcgtgttgct gctttttgaa gttaccgttt t 41
<210> 38
<211> 48
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 38
ctaatatgta gctgactgtt tttcctaagt ttttctgagt caaagcat 48
<210> 39
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 39
atctgtgaac aggctgggaa gctttttgaa gttaccgttt t 41
<210> 40
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 40
atctcaagat ctttccaggg ttatactttt tttctgagtc aaagcat 47
<210> 41
<211> 48
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 41
gagtgaatta tctaatcaac atcatcctct ttttgaagtt accgtttt 48
<210> 42
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 42
agtgtctttg cccatactga aattcatttt tttctgagtc aaagcat 47
<210> 43
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 43
tcccactttt gtgcccattc tcaatttttg aagttaccgt ttt 43
<210> 44
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 44
gacctcaaaa tgtcattcca ttaatatcac tttttctgag tcaaagcat 49
<210> 45
<211> 51
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 45
aatgttacat gcagctatgg gaatttaatt actttttgaa gttaccgttt t 51
<210> 46
<211> 51
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 46
atattttgtt ttccagtgca aagatgacta agtttttctg agtcaaagca t 51
<210> 47
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 47
tcctttatcc ctcccctttg tttgtttttg aagttaccgt ttt 43
<210> 48
<211> 54
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 48
attttttttc cagtataaag ttaaaatgct tagccttttt ctgagtcaaa gcat 54
<210> 49
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 49
ttgtactgag gctgtataca gccatttttg aagttaccgt ttt 43
<210> 50
<211> 38
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 50
cagcctctcc ccatccctct ttttctgagt caaagcat 38
<210> 51
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 51
cagccttatc tgtcatcacc atcatttttg aagttaccgt ttt 43
<210> 52
<211> 40
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 52
acccctccca tgcacctaaa ctttttctga gtcaaagcat 40
<210> 53
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 53
aaaatctaac ttgtaattcc ttgaacatgt cagtttttga agttaccgtt tt 52
<210> 54
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 54
gcatacatta ttccttctgc ctgagttttt ctgagtcaaa gcat 44
<210> 55
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 55
attcatcatc acatgagaca gcaaatactt tttgaagtta ccgtttt 47
<210> 56
<211> 60
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 56
taaaagtgta atttgattat aagagtttag ataaatatat gtttttctga gtcaaagcat 60
<210> 57
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 57
aaatgcaaga gccacagagg gaattttttg aagttaccgt ttt 43
<210> 58
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 58
gtttatgggg cacgtttgta agcctttttc tgagtcaaag cat 43
<210> 59
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 59
tgggatgtga agcaaaggca ggtttttgaa gttaccgttt t 41
<210> 60
<211> 55
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 60
gaacctcata gtatcttata taatatactt catttctttt tctgagtcaa agcat 55
<210> 61
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 61
tctatctcta tcacaatatc caacaagctt tttgaagtta ccgtttt 47
<210> 62
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 62
ttttcacaga attcatgcag tgcaaatctt tttctgagtc aaagcat 47
<210> 63
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 63
aaatcatact ggtcacttat ctcaactttg tttttgaagt taccgtttt 49
<210> 64
<211> 50
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 64
agatgtgttt gtccttgtag ttaattgaaa gtttttctga gtcaaagcat 50
<210> 65
<211> 25
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 65
agtactcagt gcagcaaaga aagac 25
<210> 66
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 66
tacagacatc tcaatggcag ggg 23
<210> 67
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 67
gggagaaatg cccggccg 18
<210> 68
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 68
ccatcttggg tcatcgatga gc 22
<210> 69
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 69
ctcgccctgt gcctggtc 18
<210> 70
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 70
gggcaggaaa acagatcctg ttg 23
<210> 71
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 71
gatggcttca caagacatgc aaca 24
<210> 72
<211> 29
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 72
aacaaaatgg aatactgtga tgacatgag 29
<210> 73
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 73
gcagccaagc tggggagg 18
<210> 74
<211> 34
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 74
aggattaact ttttttttta acctggaaga attc 34
<210> 75
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 75
aagctcttcc ttgtctctta aatctaga 28
<210> 76
<211> 35
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 76
atgatgtaaa gttttgaata agttgactat cttac 35
<210> 77
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 77
agggcactct tgtgagccac tttttctctt ggaaagaaag t 41
<210> 78
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 78
aagaactctg agtgatatca acattaggtt tttctcttgg aaagaaagt 49
<210> 79
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 79
ggtcaaaagg aaccaagata caaagaactt tttctcttgg aaagaaagt 49
<210> 80
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 80
tctcctcttg acacatatta gcttctagtt tttctcttgg aaagaaagt 49
<210> 81
<211> 46
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 81
ttccccacaa gaatttcaac gactcttttt ctcttggaaa gaaagt 46
<210> 82
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 82
attatcttct ctttctttca cctccctgtt tttctcttgg aaagaaagt 49
<210> 83
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 83
tagccatgca aatgagaaac ccagtttttc tcttggaaag aaagt 45
<210> 84
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 84
atgactgatt acgcctcatg ggtgtttttc tcttggaaag aaagt 45
<210> 85
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 85
gagggagagc attaggacaa atactttttc tcttggaaag aaagt 45
<210> 86
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 86
tttagggttc actcctggca ataaagtttt tgaagttacc gtttt 45
<210> 87
<211> 46
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 87
aatttacaaa gagctactca ggaccagttt ttctgagtca aagcat 46
<210> 88
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 88
ttgttaagag ctctgtgtgt gtgtgttttt gaagttaccg tttt 44
<210> 89
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 89
tgtgtgtgtg agtgtacatg ccaatttttc tgagtcaaag cat 43
<210> 90
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 90
cattatttca gacttaaaaa caagcatgtt ttctttttga agttaccgtt tt 52
<210> 91
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 91
aaatggcact atgagctgcc aatgtttttc tgagtcaaag cat 43
<210> 92
<211> 48
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 92
atgtatcacc accatatctc attattctct ttttgaagtt accgtttt 48
<210> 93
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 93
cagtaaatgt gataataatg tcatctgtta acatttttct gagtcaaagc at 52
<210> 94
<211> 50
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 94
taaaaaaagt ttgacttcac aaaagcagct gtttttgaag ttaccgtttt 50
<210> 95
<211> 48
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 95
gaaatggaca accacaatat gcataaatct ttttctgagt caaagcat 48
<210> 96
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 96
taactcctac catcagctac acactttttg aagttaccgt ttt 43
<210> 97
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 97
tgcttgacat atattgttag aagcaccttt tttctgagtc aaagcat 47
<210> 98
<211> 45
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 98
aaatacttgc attaggtctc agctggtttt tgaagttacc gtttt 45
<210> 99
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 99
ggctgtgcat caggcggttt tttttctgag tcaaagcat 39
<210> 100
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 100
gagaaatatt caattctcag cagaagcctt tttgaagtta ccgtttt 47
<210> 101
<211> 50
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 101
agaatttgaa ttccctcatc ttttaggaat ctttttctga gtcaaagcat 50
<210> 102
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 102
tgttcatgga tagtccaata aataatgtta tcttttttga agttaccgtt tt 52
<210> 103
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 103
ttgaactgat gctcatagga gagaatattt tttctgagtc aaagcat 47
<210> 104
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 104
tctgagctgt catcgtcccc tttttgaagt taccgtttt 39
<210> 105
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 105
atctctgtga gccacaacca acagtttttc tgagtcaaag cat 43
<210> 106
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 106
atgagttgaa ttctcctatt atggatgctt tttgaagtta ccgtttt 47
<210> 107
<211> 40
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 107
tagcttctgg ccatctctgg ctttttctga gtcaaagcat 40
<210> 108
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 108
cctttgcttc cacgactttt atcttttctt tttgaagtta ccgtttt 47
<210> 109
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 109
tccaacacat cgcttaccaa tccttttttc tgagtcaaag cat 43
<210> 110
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 110
tcaagtcttt tcttccatcc ccactttttg aagttaccgt ttt 43
<210> 111
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 111
cactaacctg aatgcctaga ccctttttct gagtcaaagc at 42
<210> 112
<211> 54
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 112
ttatttttat taatttccaa tagatgctgc ctatgttttt gaagttaccg tttt 54
<210> 113
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 113
ggctatattg ctttagatga acattagata ttttttttct gagtcaaagc at 52
<210> 114
<211> 44
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 114
ctcctctccc tatattactg attgcttttt gaagttaccg tttt 44
<210> 115
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 115
actgaacagc atggtcccca atgtttttct gagtcaaagc at 42
<210> 116
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 116
tggctccttg tggtacatgc atgtttttga agttaccgtt tt 42
<210> 117
<211> 41
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 117
caagactgct gaagccagaa ggtttttctg agtcaaagca t 41
<210> 118
<211> 42
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 118
ccttcgtgat tgtcaggagc aagtttttga agttaccgtt tt 42
<210> 119
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 119
acctgagatg ctccctgcct tttttctgag tcaaagcat 39
<210> 120
<211> 40
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 120
tcagtgtcct ctgcatctcc ctttttgaag ttaccgtttt 40
<210> 121
<211> 50
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 121
ctttctaatg aagatccata gaatttgcta ctttttctga gtcaaagcat 50
<210> 122
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 122
atttgagaat tccaattagg aactcacatg tttttgaagt taccgtttt 49
<210> 123
<211> 52
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 123
ttttatctgc cctatcaatt ttttaaactt gcttttttct gagtcaaagc at 52
<210> 124
<211> 55
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 124
atatcaactt tgattctttg ttacaacttt tcttactttt tgaagttacc gtttt 55
<210> 125
<211> 49
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 125
tcttttatca ccaaagtggc ttttattctc tttttctgag tcaaagcat 49
<210> 126
<211> 65
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 126
tttattatta ttattttctt ttactactat attacgttgt tattattttt tgaagttacc 60
gtttt 65
<210> 127
<211> 57
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 127
tttgttctct atagtatcaa tttatttgat ttagtttctt tttctgagtc aaagcat 57
<210> 128
<211> 46
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 128
ctaatgcatg tgggacttaa aacctagttt ttgaagttac cgtttt 46
<210> 129
<211> 43
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 129
atgatgggtt gataggtgca gcaatttttc tgagtcaaag cat 43
<210> 130
<211> 47
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 130
tgtaacaaac ctacacattc tgcacatgtt tttgaagtta ccgtttt 47
<210> 131
<211> 55
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 131
tatcccagaa cgtaaagtaa aatttaaaaa aaagtgtttt tctgagtcaa agcat 55
<210> 132
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 132
agtgtgcctc tctctctttg acc 23
<210> 133
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 133
cgcatttgtg ggttctctta agca 24
<210> 134
<211> 26
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 134
atttaccagg tttggagagg attcag 26
<210> 135
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 135
acagctcagg tgctttcact aatg 24
<210> 136
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 136
tctctgaact tctgtccctc tttg 24
<210> 137
<211> 33
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 137
gattcaaaga aatattagat ttaagctcac act 33
<210> 138
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 138
caggacccaa cgcatgtctg 20
<210> 139
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 139
agatccttaa atcaaggaaa ccagtgtc 28
<210> 140
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 140
ctctctgctc tgttgctttg gac 23
<210> 141
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 141
aaagctcaag aggttcaaaa tccaactc 28
<210> 142
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 142
attatcttct ctttctttca cctccctg 28
<210> 143
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 143
gaggggacca ctcctggg 18
<210> 144
<211> 37
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 144
gaaaattaag ttttttcaaa atctgtcctt gtaaatt 37
<210> 145
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 145
actttttctt acagtgtctt ggcatact 28
<210> 146
<211> 39
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 146
aatttatttt tattgctgac ttttaaaata agtgattcg 39
<210> 147
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 147
gggggtggga gaacaggg 18
<210> 148
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 148
accactatgg cacacgtata cctg 24
<210> 149
<211> 16
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 149
actttctttc caagag 16
<210> 150
<211> 534
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 150
atgctttgac tcagaggatc gtaagtaact aaggactacc aggatcgtaa gtaactaagg 60
actaccagga tcgtaagtaa ctaaggacta ccaggatcgt aagtaactaa ggactaccag 120
gatcgtaagt aactaaggac taccaggatc gtaagtaact aaggactacc aggatcgtaa 180
gtaactaagg actaccagga tcgtaagtaa ctaaggacta ccaggatcgt aagtaactaa 240
ggactaccag gatcgtaagt aactaaggac taccaggatc gtaagtaact aaggactacc 300
aggatcgtaa gtaactaagg actaccagga tcgtaagtaa ctaaggacta ccaggatcgt 360
aagtaactaa ggactaccag gatcgtaagt aactaaggac taccaggatc gtaagtaact 420
aaggactacc aggatcgtaa gtaactaagg actaccagga tcgtaagtaa ctaaggacta 480
ccaggatcgt aagtaactaa ggactaccag gatcgtaagt aactaaggac tacc 534
<210> 151
<211> 534
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 151
aaaacggtaa cttcaggatc gtaagtaact aaggactacc aggatcgtaa gtaactaagg 60
actaccagga tcgtaagtaa ctaaggacta ccaggatcgt aagtaactaa ggactaccag 120
gatcgtaagt aactaaggac taccaggatc gtaagtaact aaggactacc aggatcgtaa 180
gtaactaagg actaccagga tcgtaagtaa ctaaggacta ccaggatcgt aagtaactaa 240
ggactaccag gatcgtaagt aactaaggac taccaggatc gtaagtaact aaggactacc 300
aggatcgtaa gtaactaagg actaccagga tcgtaagtaa ctaaggacta ccaggatcgt 360
aagtaactaa ggactaccag gatcgtaagt aactaaggac taccaggatc gtaagtaact 420
aaggactacc aggatcgtaa gtaactaagg actaccagga tcgtaagtaa ctaaggacta 480
ccaggatcgt aagtaactaa ggactaccag gatcgtaagt aactaaggac tacc 534
<210> 152
<211> 466
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 152
ggtagtcctt agttacttac gatcctgaat ccattgaatc ctgtgattga atccattgaa 60
tcctgtgatt gaatccattg aatcctgtga ttgaatccat tgaatcctgt gattgaatcc 120
attgaatcct gtgattgaat ccattgaatc ctgtgattga atccattgaa tcctgtgatt 180
gaatccattg aatcctgtga ttgaatccat tgaatcctgt gattgaatcc attgaatcct 240
gtgattgaat ccattgaatc ctgtgattga atccattgaa tcctgtgatt gaatccattg 300
aatcctgtga ttgaatccat tgaatcctgt gattgaatcc attgaatcct gtgattgaat 360
ccattgaatc ctgtgattga atccattgaa tcctgtgatt gaatccattg aatcctgtga 420
ttgaatccat tgaatcctgt gattgaatcc attgaatcct gtgatt 466
<210> 153
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 153
aatcacagga ttcaatggat tc 22

Claims (10)

1. A prostate cancer detection probe is characterized by comprising a capture extension probe, a K-type label extension probe and a blocking probe; wherein, the capture extension probe sequence is shown as SEQ ID No.1-14 and SEQ ID No.78-85, the K-type label extension probe sequence is shown as SEQ ID No.15-64 and SEQ ID No.86-131, and the blocking probe sequence is shown as SEQ ID No.65-77 and SEQ ID No. 132-148.
2. Use of the probe of claim 1 in the preparation of a kit for detecting prostate cancer.
3. A kit for detecting prostate cancer, comprising the probe according to claim 1.
4. The kit of claim 3, further comprising one or more of a signal amplification precursor, a signal amplification entity, an Alkaline Phosphatase (AP) -labeled reporter probe, a chemiluminescent substrate, and a universal probe-coupled carrier;
wherein the universal probe is complementary paired to the partial sequence of the capture extension probe of claim 1;
the signal amplification precursor comprises an amplification precursor leader sequence and a multiply repeated amplicon leader complement sequence;
the signal amplifier comprises an amplifier preposition guide region sequence and a repeated reporting probe complementary sequence;
the pre-amplification leader sequence is complementary paired with the sequence of the K-type labelled extension probe moiety of claim 1;
the magnifying glass pre-guide region sequence is complementarily paired with the repeated magnifying glass pre-guide region complementary sequence;
and the alkaline phosphatase-labeled report probe is complementarily paired with the repeated report probe complementary sequence.
5. The kit of claim 4, wherein the carrier is a magnetic bead or a cell culture plate.
6. The kit according to claim 4, wherein the sequence of the universal probe is shown in SEQ ID No. 149.
7. The kit of claim 4, wherein the chemiluminescent substrate is an adamantane derivative.
8. The kit of claim 4, wherein the plurality of repeats is 20 repeats.
9. The kit of claim 4, wherein the universal probe is complementary paired with a partial sequence of the capture extension probe of claim 1, wherein the partial sequence is a 16bp sequence from the 3 'end to the 5' end of the capture extension probe of claim 1.
10. The kit of claim 4, wherein the pre-amplification leader sequence is complementary to a partial sequence of the K-type labeled extension probe of claim 1, wherein the partial sequence is a 14bp sequence from the 3 'end to the 5' end of the K-type labeled extension probe of claim 1.
CN201810391659.2A 2018-04-27 2018-04-27 Prostate cancer detection probe sequence and application thereof Active CN108504738B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810391659.2A CN108504738B (en) 2018-04-27 2018-04-27 Prostate cancer detection probe sequence and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810391659.2A CN108504738B (en) 2018-04-27 2018-04-27 Prostate cancer detection probe sequence and application thereof

Publications (2)

Publication Number Publication Date
CN108504738A CN108504738A (en) 2018-09-07
CN108504738B true CN108504738B (en) 2021-09-10

Family

ID=63399100

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810391659.2A Active CN108504738B (en) 2018-04-27 2018-04-27 Prostate cancer detection probe sequence and application thereof

Country Status (1)

Country Link
CN (1) CN108504738B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111748621A (en) * 2020-03-11 2020-10-09 重庆大学附属肿瘤医院 Probe library and kit for detecting 41 genes related to lung cancer and application of probe library and kit
CN114062681A (en) * 2021-11-01 2022-02-18 无锡学院 Screening method and application of cell targeting molecular probe

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013028788A1 (en) * 2011-08-22 2013-02-28 Exosome Diagnostics, Inc. Urine biomarkers
CN103436594A (en) * 2012-10-16 2013-12-11 科蒂亚(新乡)生物技术有限公司 Application of BDNA for detecting PCA3 in urine
CN105861669A (en) * 2016-04-22 2016-08-17 科蒂亚(新乡)生物技术有限公司 Amplificatory detection method for quickly capturing branched-chain DNA (Deoxyribonucleic Acid) signal of hybrid target substance
CN105886501A (en) * 2016-04-26 2016-08-24 科蒂亚(新乡)生物技术有限公司 Nucleic acid signal amplification sequence and method
CN106701984A (en) * 2017-02-07 2017-05-24 华南师范大学 Electrochemical luminescence nucleic acid detection method and kit based on branched DNA (Deoxyribonucleic Acid) amplification signal

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013028788A1 (en) * 2011-08-22 2013-02-28 Exosome Diagnostics, Inc. Urine biomarkers
CN103436594A (en) * 2012-10-16 2013-12-11 科蒂亚(新乡)生物技术有限公司 Application of BDNA for detecting PCA3 in urine
CN105861669A (en) * 2016-04-22 2016-08-17 科蒂亚(新乡)生物技术有限公司 Amplificatory detection method for quickly capturing branched-chain DNA (Deoxyribonucleic Acid) signal of hybrid target substance
CN105886501A (en) * 2016-04-26 2016-08-24 科蒂亚(新乡)生物技术有限公司 Nucleic acid signal amplification sequence and method
CN106701984A (en) * 2017-02-07 2017-05-24 华南师范大学 Electrochemical luminescence nucleic acid detection method and kit based on branched DNA (Deoxyribonucleic Acid) amplification signal

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
"PCA3 Molecular Urine Assay for Prostate Cancer in Men Undergoing Repeat Biopsy";Leonard S. Marks et al.;《UROLOGY》;20071231;第69卷(第3期);第532-535页 *
"Urine TMPRSS2:ERG Plus PCA3 for Individualized Prostate Cancer Risk Assessment";Scott A. Tomlins;《Eur Urol》;20161231;第70卷(第1期);第43-53页 *
"前列腺癌特异性基因DD3PCA3的研究进展";陈占国;《国外医学临床生物化学与检验学分册》;20040930;第25卷(第5期);第435-438页 *
"荧光实时定量PCR检测前列腺癌抗原3评分方法的建立";罗冰等;《医学研究生学报》;20110630;第24卷(第6期);第569-572页 *

Also Published As

Publication number Publication date
CN108504738A (en) 2018-09-07

Similar Documents

Publication Publication Date Title
US10006092B2 (en) Method to detect prostate cancer in a sample
KR101569498B1 (en) Method for Detecting Gastric Polyp and Gastric Cancer Using Gastric Polyp and Gastric Cancer Specific Methylation Marker Gene
AU2010247321B2 (en) A method and kit for detecting antibiotic resistant bacteria
Miyamae et al. Mutation detection of epidermal growth factor receptor and KRAS genes using the smart amplification process version 2 from formalin-fixed, paraffin-embedded lung cancer tissue
CN108504738B (en) Prostate cancer detection probe sequence and application thereof
US20140342933A1 (en) Methods and compositions for multiplexed and ultrasensitive microrna detection
CN109593847B (en) Primer pair, kit and method for detecting stability of NR24 locus of microsatellite
KR101825117B1 (en) Methods and kits for the BRAF mutant detection using PNA mediated Real-time PCR clamping
KR20170030746A (en) Primers used for LAMP reaction for the detection of Salmonella and its use
US8673563B2 (en) Amplification method of methylated or unmethylated nucleic acid
CN112226485A (en) Nucleic acid detection method
KR101498705B1 (en) Primer and probe for diagnosing tuberculosis, a kit comprising the same and a tu-berculosis-diagnosing method using the kit
US11130988B2 (en) Method for detecting a plurality of short-chain nucleic acid in sample, combinatorial analysis kit, analysis kit supply management method
EP1530644B1 (en) Probes for detecting tumor cells
AU2016256302A1 (en) Method, sequences, compositions and kit for detection of mutations in the Htert gene promoter
JP3683913B2 (en) Nucleic acid quantification method by PCR, method of measuring the number of microorganisms or cells, the number of specific genes and the number of specific gene copies by PCR, and a measurement kit used for these methods
WO2022102726A1 (en) Method of diagnosing fusarium oxysporum soil by pathogen genomics
US20170081713A1 (en) Multivalent probes having single nucleotide resolution
CN110684847B (en) Application of biomarker related to breast cancer occurrence and development
CN113005199B (en) Primer composition for detecting microsatellite instability, kit and application
CN106987622A (en) Pyrosequencing joint amplification block technique detection KRAS genes 12 and 13 codon low frequency mutant primers and its application
RU2378383C1 (en) Set of synthetic oligonucleotides to detect dna of agent of vegetable desease - gram-negative bacterium pseudomonas syringae pv lachrymans by polymerase chain reaction
US20140093872A1 (en) Method of Mutation Detection in Blood Cell-Free DNA Using Primer Extension (PE) and PCR
JPH11243995A (en) Detection of urinary bladder cancer in urine sample
KR20150039540A (en) Method and device for analyzing nucleotide variation using with capture probes and oligonucleotides associated nucleic acid variation

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB03 Change of inventor or designer information
CB03 Change of inventor or designer information

Inventor after: Zhang Lulu

Inventor after: He Li

Inventor after: Han Ran

Inventor after: Guo Shuguang

Inventor after: Su Qin

Inventor after: Zhang Huijian

Inventor after: Huang Jin

Inventor after: Li Xiankun

Inventor after: Tian Xiaoqiang

Inventor after: Xu Wenru

Inventor after: Li Xin

Inventor after: Li Xiaolei

Inventor after: Meng Ge

Inventor before: Zhang Lulu

Inventor before: He Li

Inventor before: Han Ran

Inventor before: Guo Shuguang

Inventor before: Su Qin

Inventor before: Zhang Huijian

Inventor before: Huang Jin

Inventor before: Li Xiankun

Inventor before: Tian Xiaoqiang

Inventor before: Xu Wenru

Inventor before: Li Xin

Inventor before: Li Xiaolei

Inventor before: Meng Ge

CB03 Change of inventor or designer information
CB03 Change of inventor or designer information

Inventor after: Li Xiankun

Inventor after: Li Xin

Inventor after: Meng Ge

Inventor after: He Li

Inventor after: Guo Shuguang

Inventor after: Su Qin

Inventor before: Zhang Lulu

Inventor before: He Li

Inventor before: Han Ran

Inventor before: Guo Shuguang

Inventor before: Su Qin

Inventor before: Zhang Huijian

Inventor before: Huang Jin

Inventor before: Li Xiankun

Inventor before: Tian Xiaoqiang

Inventor before: Xu Wenru

Inventor before: Li Xin

Inventor before: Li Xiaolei

Inventor before: Meng Ge

GR01 Patent grant
GR01 Patent grant