CN108486154A - A kind of construction method of sialidase gene knock-out mice model and its application - Google Patents

A kind of construction method of sialidase gene knock-out mice model and its application Download PDF

Info

Publication number
CN108486154A
CN108486154A CN201810293790.5A CN201810293790A CN108486154A CN 108486154 A CN108486154 A CN 108486154A CN 201810293790 A CN201810293790 A CN 201810293790A CN 108486154 A CN108486154 A CN 108486154A
Authority
CN
China
Prior art keywords
npl
out mice
sgrna
construction method
gene knock
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201810293790.5A
Other languages
Chinese (zh)
Inventor
邵敬伟
张冰晨
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fuzhou University
Original Assignee
Fuzhou University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fuzhou University filed Critical Fuzhou University
Priority to CN201810293790.5A priority Critical patent/CN108486154A/en
Publication of CN108486154A publication Critical patent/CN108486154A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0276—Knock-out vertebrates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01018—Exo-alpha-sialidase (3.2.1.18), i.e. trans-sialidase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01129—Endo-alpha-sialidase (3.2.1.129)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0331—Animal model for proliferative diseases

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Veterinary Medicine (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Environmental Sciences (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to biotechnologies, construction method and its application of a kind of sialidase gene knock-out mice model are provided, plasmid vector is knocked out using a kind of inside and outside targeting mouse genome NPL genetic recombination CRISPR, being successfully established diploid pair by fertilized eggs microinjection technique strikes NPL mouse knockout model.NPL plays an important role in the pathophysiological process of body, and the vicious transformation of tumour cell is frequently accompanied by the overexpression of sialic acid, nowadays has become one of vicious transformation and transfer important symbol object of tumour.The model is that new research platform has been built in the process study of research cell carcinogenesis, is conducive to the committed step for studying generation and the transfer of tumour, while providing the foundation for the research and development of new type antineoplastic medicine.

Description

A kind of construction method of sialidase gene knock-out mice model and its application
Technical field
The invention belongs to gene editing technical fields, are related to the researchs sides such as molecular biology, cell biology and science of heredity Method, and in particular to a kind of construction method of sialidase gene knock-out mice model and its application.
Background technology
The foundation of gene knock-out mice model creates possibility for accurately research gene with human diseases interactively. It since transgenic animals are born, have just obtained people and has greatly paid attention to, with continuing to develop in recent years and perfect, transgenosis is dynamic Object gradually starts to play among multiple fields and its huge effect, for entire society, these transgenosis Animal greatly promotes the development of social economy and scientific research.Build transgenic animal model, especially gene knockout and The animal model knocked in is to study most intuitive and reliable one of the approach of gene function, and the occurrence and development research especially for tumour is opened New platform and direction are warded off.Knock out mice structure knockout technique be developed so far, mainly have ES cell targetings technology, The methods of TALEN technologies and Cre/loxP conditions knockout, with the development of CRISPR/Cas9 technologies, the targeting having by it By force, the advantages that efficient and easy to operate is knocked out, thus is very suitable for the preparation of target gene knock-out mice.
Microinjection technique, microinjection are that relatively early development is moved for foreign gene to be imported into structure transgenosis in cell One of method of object, if but exogenous dna fragment is integrated into host genome by way of non-homogeneous recombination, integration Randomness is very big and less efficient.Using the combination of CRISPR/Cas9 technologies and microinjection technique, can solve to strike significantly Except the puzzlement that mouse manufacturing cycle is long, while realizing the needs that fertilized eggs and embryo are reached with accurate gene editing.
Sialic acid occurs and deteriorates have great relationship with tumour, studies have shown that the vicious transformation of cell is often associated with The overexpression of sialic acid.Effectively build a kind of stabilization, the mouse that NPL genes knock out completely will greatly facilitate and explore NPL bases Because and its related pathways key effect for reaching in tumor adhesion transfer, promote NPL correlation interacting genes the study found that being New research platform has been built in the research and related drugs screening of tumor progression transfer.
Invention content
The present invention is intended to provide construction method and its application of a kind of sialidase gene knock-out mice model.It is included in mouse The effective targeting NPL genes sgRNA recombinations of source cell verification knock out CRISPR plasmid vectors, pass through microinjection recombinant target NPL gene C RISPR systems feed back fallopian tubal and obtain newborn mice to fertilized eggs, pass through rat-tail sequence verification NPL clpp genes Except positive mice.
In order to realize the purpose of the present invention, using following experimental technique scheme：
It is Px459 vector, design targeting NPL genes that the knockout plasmid of CRISPR/Cas9 gene editing systems can be expressed by, which choosing, SgRNA connects to obtain recombination Px459 plasmids by digestion.
As above-mentioned recombination ICAM-1 knocks out the construction method of recombination Px459 plasmid vectors, following steps：
1）According to NPL gene C DS region sequences（Chromosome 1 - NC_000067.6）, design targeting NPL gene sgRNA, Obtain NPL-sgRNA, sequence GGTGTCCGCGGCGGAATCCG；
2）It synthesizes that NPL-sgRNA is positive and reverse oligonucleotide sequence, adds BbsI restriction enzyme sites at both ends when synthesis；Pass through ladder Degree annealing forms double chain oligonucleotide；
NPL-sgRNA is positive and reverse oligonucleotide sequence is：
Normal chain F:CACCGGGTGTCCGCGGCGGAATCCG ；
Anti-chain R:AAACCCGGATTCCGCCGCGGACACC；
3）By the Px459 plasmid vectors recycling after BbsI digestions, it connect to form recombination with double-strand NPL-gRNA by T4 ligases Gene knockout carrier；Transformed competence colibacillus strain monoclonal picking is sequenced to obtain required NPL-gRNA/Cas9 recombinations knockout CRISPR Carrier recombinates Px459 plasmids.
A kind of method that mouse knocks out NPL genes at fiber L929 cells and knocks out verification, concrete operations are as follows：
1）Using lipo 3000, plasmid and lipo mass ratios 1:2.5, above-mentioned gained is recombinated and knocks out six orifice plate of plasmid transfection Middle L929 cells.After for 24 hours, screened using puromycin antibiotic.
2）Continuous medicine sieves three days, is changed to normal culture solution culture, waits growing up to new individual cells group.
3）Using pancreatin digestion monoclonal cell group, cell is resuspended.It keeps regularly changing liquid after adherent.Ensure Dan Ke The proliferation of grand cell is grown, and extracts cellular genome.
4）Using the verification primer PCR of synthesis, recycle to obtain target fragment DNA by glue, sequencing compares wild type gene Group detects the genetic modification of sgRNA sequences.
5）If there are bimodal or sgRNA sequence areas and sequence change occurs in Sequencing chromatogram（See Fig. 1）.It is then with life Object activity sgRNA.
A kind of microinjection method for building up, concrete operations are as follows：
1) female rat of successful fertilization, operation obtain fertilized eggs.
2) electronic microinjection instrument is used, targeting NPL gene C RISPR plasmids are injected into fertilized eggs.
3) fertilized eggs for successfully injecting plasmid, carry out fallopian tubal embryo transfer.Wait for that mouse revives after suture.
The method of positive knock-out mice verification, the specific method is as follows：
1）After mouse is born at least one week, Mouse Tail-tip part can be cut.
2）Rat-tail is ground for extracting genome.
3）PCR amplification is carried out using the verification primer of design, and it includes sgRNA sequence target fragments to recycle.
4）Sequencing comparison wild type gene group, the sequence variation of the double copies of T-A cloning analysis diploids（See Fig. 2）.
The advantage of the invention is that：
1. CRISPR/Cas9 technologies are combined the structure for knock-out mice with microinjection technique, more rapidly and efficiently.
2. experimental period is shorter, experimental cost is saved.
3.NPL knock-out mices, are applied to the research of tumour generation and deterioration etc., and effect is more direct notable.NPL's Dependent interaction gene, makes it possible its real-time monitoring in vivo.
Description of the drawings
Fig. 1 L929 cellular level sequence verifications are bimodal and sequence alignment figure.
When the bis- copies of T-A cloning knock out proof diagram to Fig. 2 rat-tail sequence verifications sequence pair.
Fig. 3 NPL knock-out mices and wild-type mice subcutaneous implantation tumor comparison diagram.
Specific implementation mode
Embodiment 1 recombinates the structure that NPL knocks out CRISPR system plasmids
（1）The design of sgRNA
The genome sequence for finding mouse NPL genes by NCBI first designs website http in Zhang Feng seminars sgRNA:// The sgRNA of crispr.mit.edu/ design targeting NPL genes（Sequence is GGTGTCCGCGGCGGAATCCG）, reverse complemental obtains To reversed chain-ordering.Residue of the BbsI restriction enzyme sites after digestion is added respectively at both ends, and is synthesized.
Two segments difference after synthesis is as follows：
F：CACCG GGTGTCCGCGGCGGAATCCG；
R：AAAC CGGATTCCGCCGCGGACACC C；
（2）SgRNA anneals,
Annealing reaction system：
Prepared liquid is uniformly mixed, grads PCR instrument is placed after of short duration centrifugation, runs program：95 DEG C, 10min；85℃- 65 DEG C of 0.1 DEG C of reductions per second, form double chain oligonucleotide by 25 DEG C；
Normal chain F:CACCGGGTGTCCGCGGCGGAATCCG ；
Anti-chain R:AAACCCGGATTCCGCCGCGGACACC.
（3）Use BbsI digestions
Restriction enzyme BbsI carries out Px459 carriers the reaction system of digestion：
Gently mixing, 37 DEG C, warm bath 10min can be used to connect.
（4）Carrier is connect with sgRNA
T4 DNA Ligase kit reaction systems：
It mixes well, PCR instrument program：16 DEG C, 3 h；65℃, 10 min；4 DEG C, ∞.
（5）Convert DH5 α competent cells
50 μ L+ recombinant plasmids of competent cell, 3 μ L, mixing are added in 1.5mL EP pipes；Ice bath 30min；42 DEG C of water-bath 45s；Ice Bathe 3min；800 μ L LB are added；37 DEG C of shaking table culture 1h；4000 rpm at room temperature centrifuges 2min；Supernatant is abandoned, general 80ul is stayed Mixing coated plate is resuspended；Sealing, 37 DEG C are inverted overnight.
（6）Sequencing and conservation
Each tablet 3 monoclonals of picking carry out shaking bacterium, and bacterium solution is taken to be sequenced；Sequencing result alignment shows carrier recombination to construct Success, extraction plasmid are tested for subsequent cell and animal body.
The verification of 2 knockout carrier of embodiment on a cellular level
Before before being prepared for knock-out mice using CRISPR system knockout carriers, whether the sgRNA that need to first verify design is effective, Knockout verification can be carried out prior to mouse source cell system.Steps are as follows：
Cell transfecting
1）Logarithmic growth phase cell is inoculated in six orifice plates.Experimental group and control group are established, waits for that plating cells rate reaches 75- 80%。
2）Take two EP pipes, I pipes plus MEM（50μl）+lipo3000（3.75μl）, II pipe plus MEM（50μl）+DNA（2.5 μg）+ P3000（5μl）.
3）Liquid in II is added in I, 5min is stood after mixing, is then added in six orifice plates, is placed in cell incubator Culture.
Genome extracts and verification
Design primer expands the sites NPL gene sgRNA upper and lower ends respectively about 300bp, in total the segment of about 600bp；To amplifying The segment come is sequenced and is compared.It is said with the genomic sequence comparison of wild type if being changed in the sites sgRNA The CRISPR recombinant vectors of bright design have bioactivity, on the contrary then invalid.
Primer sequence is：Forward: GAGTGACGTGCGCGCTTTTA；
Reverse: TGATGAGCGGGAGCGGA；
PCR reaction systems are as follows：
PCR conditions：72 DEG C of 98 DEG C of 3min --- [98 DEG C of 10s, 55 DEG C of 30s, 72 DEG C of 1min] × 35 cycles --- 7min——4℃ ∞
Embodiment 3
The acquisition of fertilized eggs
（1）0.1ml is injected intraperitoneally in ovum donors female rat（5U）Pregnant mare serum gonadotrop(h)in (PMSG) PMSG, to promote female rat ovum at It is ripe.
（2）Receptor female rat and the public mouse of ligation are mated after injection, by normally mating, are at pseudopregnant；
（3）After pseudopregnant, female rat injects human chorionic gonadotrophin hCG 0.1ml（5U）, later with normal public mouse with 1:1 ratio carries out mating mating.
（4）Pregnant bolt inspection was carried out to donor mouse and receptor mouse in second day, bolt mouse of being pregnant is for ovum collecting of being fertilized.
Microinjection concrete operations are as follows：
（1）Fertilized egg cell is drawn using egg apparatus is moved, is placed in the M2 culture mediums on glass slide；
（2）It is drawn with fixed pin and fixes ready fertilized eggs, injection needle is penetrated into cytoplasm, it quickly will about using syringe pump 1pl injections inject, while quickly extracting injection needle out, and the fertilized egg cell injected is transferred to clean region；
（3）Injection finishes, and observation fertilized eggs variation, goes out if there is fertilized egg cell's mass flow or fertilized eggs form is damaged, that is, notes It is lost to lose, it need to inject again.
（4）It collects the successful fertilized eggs transfer of injection to be placed in the organ culture ware containing fresh M16 culture solutions, and is put in Carbon dioxide incubator culture.
Embryo transfer in fallopian tubal
（1）Receptor female rat anesthesia rear side is lain and is positioned under microscope.After 70% alcohol disinfecting, along dorsal line from last rib cage Start to cut an osculum on the skin with scissors, by the defeated ovum that can touch both sides perpendicular to a midline incision of backbone Pipe and ovary.Sliding skin is so as to which permeation body standing motionless as if facing a wall observes ovary around（It is orange）Or fat pad（White）.Then it uses Clock and watch tweezer plays body wall, and an osculum is cut where ovary.
（2）A small amount of M2 culture solutions are first sucked in grafts before sucking embryo, then suck a small bubble, are then inhaled again Enter M2 culture solutions, suck second minute bubbles again later, so repeats that until reducing siphonage liquid can be controlled well Disengaging until.
（3）Fat pad, which is clamped, with tweezers pulls out subsidiary left ovary, fallopian tubal and uterus.Fat is clamped with little spring clip Fat pad, to make ovary, fallopian tubal be exposed in visual range.By under microscope, adjusting receptor female rat fallopian tubal position, with Convenient for grafts are pierced into fallopian tubal.Ovary is pulled out using soft folder and is fixed in vitro, with fine-pointed forceps in fimbriae tubae portion An osculum is torn on ovarian bursa, finds fimbriae tubae.Fimbriae tubae is carefully clamped with tweezers, grafts are inserted into fallopian tubal Opening, is then blown into ampulla of uterine tube by embryo and bubble.
（4）Little spring clip is unclamped, fat pad is picked up with blunt tweezers, uterus, fallopian tubal, ovary etc. is put back into body cavity.First Suture body wall, then skin suture wound.If necessary, above step is repeated, it can be by embryo transfer to right side fallopian tubal.Art Mouse is positioned in clean mouse cage afterwards, mouse cage is placed on 37 DEG C of heating cushions, until its revival.
The identification of NPL knock-out mices
After mouse is born at least one week, Mouse Tail-tip part can be cut for extracting genome and carry out PCR amplification and sequencing. Operation is identical as cellular level genome verification method.
The difference that knock-out mice generates and deteriorates in tumour with wild-type mice
1）Cell prepares：By taking the lung cancer A549 cell of people source as an example.Conventional digestion, centrifugation, HBSS-/- washing, HBSS-/- and After Matrigel is by equal proportion mixing, cell suspension is made.
2）Animal Anesthesia instrument anesthetized mice, right hind shaving, along subcutaneous slowly injection cell suspension.
3）70% alcohol disinfecting is put into 37 DEG C of heating plates or other equipment, until mouse revives.
After 30d, the tumor size difference of wild-type mice and NPL knock-out mices, NPL knock-out mice gross tumor volumes are observed 2.16cm3, wild-type mice gross tumor volume 5.37cm3.It can be found that NPL knock-out mice tumours are less than wild-type mice（Such as figure 3）, verify NPL and play an important role in tumour generation.Therefore, NPL knock-out mices can be used as study tumour occur and Develop the model deteriorated, and provides convenience for the screening of related drugs.
The foregoing is merely presently preferred embodiments of the present invention, all equivalent changes done according to scope of the present invention patent with Modification should all belong to the covering scope of the present invention.
SEQUENCE LISTING
<110>University of Fuzhou
<120>A kind of construction method of sialidase gene knock-out mice model and its application
<130> 7
<160> 7
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence
<400> 1
ggtgtccgcg gcggaatccg 20
<210> 2
<211> 25
<212> DNA
<213>Artificial sequence
<400> 2
caccgggtgt ccgcggcgga atccg 25
<210> 3
<211> 25
<212> DNA
<213>Artificial sequence
<400> 3
aaacccggat tccgccgcgg acacc 25
<210> 4
<211> 25
<212> DNA
<213>Artificial sequence
<400> 4
caccgggtgt ccgcggcgga atccg 25
<210> 5
<211> 25
<212> DNA
<213>Artificial sequence
<400> 5
aaaccggatt ccgccgcgga caccc 25
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence
<400> 6
gagtgacgtg cgcgctttta 20
<210> 7
<211> 17
<212> DNA
<213>Artificial sequence
<400> 7
tgatgagcgg gagcgga 17

Claims (6)

1. a kind of construction method of sialidase gene knock-out mice model, which is characterized in that CRISPR/Cas9 technologies are based on, Px459 vector, design targeting NPL gene sgRNA are chosen, connects to obtain recombination Px459 plasmids by digestion, then will recombination Plasmid is injected into fertilized eggs, obtains sialidase gene knock-out mice.
2. a kind of construction method of sialidase gene knock-out mice model according to claim 1, which is characterized in that institute State recombination Px459 plasmids construction method be：
1）According to NPL gene C DS region sequences, design targeting NPL gene sgRNA obtain NPL-sgRNA；
2）It synthesizes that NPL-sgRNA is positive and reverse oligonucleotide sequence, adds BbsI restriction enzyme sites at both ends when synthesis；Pass through ladder Degree annealing forms double chain oligonucleotide；
3）By the Px459 plasmid vectors recycling after BbsI digestions, it connect to form recombination with double-strand NPL-gRNA by T4 ligases Gene knockout carrier；Transformed competence colibacillus strain monoclonal picking is sequenced to obtain required NPL-gRNA/Cas9 recombinations knockout CRISPR Carrier recombinates Px459 plasmids.
3. a kind of construction method of sialidase gene knock-out mice model according to claim 2, which is characterized in that institute The NPL-sgRNA sequences stated are：GGTGTCCGCGGCGGAATCCG.
4. a kind of construction method of sialidase gene knock-out mice model according to claim 2, which is characterized in that NPL-sgRNA is positive and reverse oligonucleotide sequence is：
Normal chain F:CACCGGGTGTCCGCGGCGGAATCCG ；
Anti-chain R:AAACCCGGATTCCGCCGCGGACACC.
5. the sialidase gene knock-out mice that the method as described in claim 1 structure obtains.
6. sialidase gene knock-out mice application in preparation of anti-tumor drugs as described in claim 1.
CN201810293790.5A 2018-04-04 2018-04-04 A kind of construction method of sialidase gene knock-out mice model and its application Pending CN108486154A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810293790.5A CN108486154A (en) 2018-04-04 2018-04-04 A kind of construction method of sialidase gene knock-out mice model and its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810293790.5A CN108486154A (en) 2018-04-04 2018-04-04 A kind of construction method of sialidase gene knock-out mice model and its application

Publications (1)

Publication Number Publication Date
CN108486154A true CN108486154A (en) 2018-09-04

Family

ID=63317909

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810293790.5A Pending CN108486154A (en) 2018-04-04 2018-04-04 A kind of construction method of sialidase gene knock-out mice model and its application

Country Status (1)

Country Link
CN (1) CN108486154A (en)

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108624677A (en) * 2018-06-26 2018-10-09 北京泱深生物信息技术有限公司 Applications of the NPL in preeclampsia diagnosing and treating
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
CN113699152A (en) * 2021-09-15 2021-11-26 南方医科大学皮肤病医院（广东省皮肤病医院、广东省皮肤性病防治中心、中国麻风防治研究中心） Construction method and application of SLC35E2B gene knockout mouse animal model
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013028871A1 (en) * 2011-08-23 2013-02-28 University Of South Florida Inducible mouse models of lung injury and lung diseases
CN104293831A (en) * 2014-09-28 2015-01-21 上海云舜生物技术有限公司 Method for establishing hypertension mouse model and application of hypertension mouse model

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013028871A1 (en) * 2011-08-23 2013-02-28 University Of South Florida Inducible mouse models of lung injury and lung diseases
CN104293831A (en) * 2014-09-28 2015-01-21 上海云舜生物技术有限公司 Method for establishing hypertension mouse model and application of hypertension mouse model

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
NATALIE DE GEEST等: "Systemic and neurologic abnormalities distinguish the lysosomal disorders sialidosis and galactosialidosis in mice", 《HUMAN MOLECULAR GENETICS》 *
郑全辉: "《肿瘤免疫学研究进展》", 28 February 2018 *

Cited By (37)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
CN108624677A (en) * 2018-06-26 2018-10-09 北京泱深生物信息技术有限公司 Applications of the NPL in preeclampsia diagnosing and treating
CN108624677B (en) * 2018-06-26 2020-08-04 青岛泱深生物医药有限公司 Use of NP L in the diagnosis and treatment of preeclampsia
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
CN113699152A (en) * 2021-09-15 2021-11-26 南方医科大学皮肤病医院（广东省皮肤病医院、广东省皮肤性病防治中心、中国麻风防治研究中心） Construction method and application of SLC35E2B gene knockout mouse animal model

Similar Documents

Publication Publication Date Title
CN108486154A (en) A kind of construction method of sialidase gene knock-out mice model and its application
CN106191113A (en) A kind of preparation method of MC3R gene knock-out pig
CN109640645A (en) For treating the cell, tissue and organ of the genetic modification of disease
CN109943593B (en) Construction method and application of Mir3061 gene Rosa26 fixed-point knock-in heterozygote mouse model
CN104531704A (en) Method for knocking off animal FGF5 gene by using CRISPR-Cas9 system
CN111304258B (en) Ndufs2 gene conditional point mutation mouse model and construction method and application thereof
CN106119284A (en) A kind of product for building immunodeficient animals model and application thereof
AU2017101108A4 (en) Construction method of animal model of mucopolysaccharidosis type II and use thereof
CN101985628B (en) Method for building special microRNA knock-down mouse model of heart
Ratzan et al. Generation of a Xenopus laevis F1 albino J strain by genome editing and oocyte host-transfer
CN102051380B (en) Method for establishing arrhythmia animal model
CN113088521A (en) Construction method of Ahnak2 gene knockout animal model based on CRISPR/Cas9 technology
CN105002215A (en) Expression vector containing regulatably expressible cre recombinase gene and reporter gene LacZ, construction method and application thereof
CN110862988B (en) sgRNA and CREBRF point mutant Bama pig constructed by same and application thereof
CN109868285A (en) A kind of construction method of immunodeficient rats animal model and application
CN110115248A (en) A kind of immunodeficient mouse, the Its Preparation Method And Use of somatostatin gene defect
CN111778278A (en) Construction method and application of Slfn 4-deleted atherosclerosis model mouse
CN113549637B (en) SNP locus of mouse PHEX gene and application thereof
WO2021121321A1 (en) Fusion protein that improves gene editing efficiency and application thereof
CN103952424B (en) Method for producing double-muscular trait somatic cell cloned pig with MSTN (myostatin) bilateral gene knockout
CN113604502A (en) Gene editing system of pAPN gene 16 th exon and application thereof
CN111778288A (en) Method, composition and application for constructing HBV transgenic mouse model
CN111019972A (en) Construction method and application of CD27 humanized mouse model
CN110511962A (en) A method of it is cut by double site and realizes that pig Gjb2 gene coded sequence is precisely edited
CN110438155A (en) Modify composition, application, cell and the preparation method of gene editing pig of the 561st amino acids of CD163 gene

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20180904

RJ01 Rejection of invention patent application after publication