CN108486039B

CN108486039B - Method for inducing human adipose-derived stem cells to differentiate into testicular interstitial cells by using small molecules

Info

Publication number: CN108486039B
Application number: CN201810299979.5A
Authority: CN
Inventors: 郭晓令; 葛仁山; 李超; 林振坤; 李晓珩; 洪婷婷; 陈显武; 陈勇
Original assignee: Second Affiliated Hospital and Yuying Childrens Hospital of Wenzhou Medical University
Current assignee: Second Affiliated Hospital and Yuying Childrens Hospital of Wenzhou Medical University
Priority date: 2018-04-04
Filing date: 2018-04-04
Publication date: 2021-07-27
Anticipated expiration: 2038-04-04
Also published as: CN108486039A

Abstract

The invention discloses a method for inducing human adipose-derived stem cells to differentiate into testicular mesenchymal cells (LCs) by completely utilizing small molecules. The method comprises the following steps of firstly, separating and extracting human adipose-derived stem cells and completing identification; then adopting a specific culture medium to induce the differentiation of the human adipose-derived stem cells, and adding a certain amount of small molecules into the culture medium at different time points, wherein the method comprises the following steps: SAG,22OHC, Li, PDGF-AA, FGF2, Androgen and LH promote differentiation; and finally, manually removing non-testicular interstitial cells (ALCs) like cells to enrich and differentiate target cells (ADSC-ALCs), and completing identification. The human adipose-derived stem cells can be successfully differentiated into the testicular interstitial cells by the method, so that a cell source is provided for treating the testosterone deficiency by cell transplantation.

Description

Method for inducing human adipose-derived stem cells to differentiate into testicular interstitial cells by using small molecules

Technical Field

The invention belongs to the technical field of biotechnology, and particularly relates to a method for inducing human adipose-derived stem cells to differentiate into testicular interstitial cells by completely utilizing small molecules.

Background

The male reproductive health can not keep the function of the reproductive system healthy. Currently, the treatment of androgen deficiency has only stayed on androgen replacement therapy. However, long-term androgen therapy can cause complications such as liver and kidney function impairment, immunity reduction, water and sodium retention and the like, and is not regulated and controlled by the circadian rhythm of the patient. Currently, a major focus of medical research is cell replacement therapy. Although transplantation of Leydig Cells (LCs) may avoid some complications caused by exogenous androgen replacement therapy, the clinical application of Leydig Cells (LCs) is limited due to insufficient sources of Leydig Cells (LCs) and possible host immune rejection caused by xenotransplantation. At present, induced stem cells (totipotent stem cells and adult stem cells) differentiate into leydig cells, and transplantation as a donor is expected to be a breakthrough to solve the problem.

In recent years, biologists have made great breakthrough and development in the research on adipose-derived mesenchymal stem cells. For example, the Chinese patent authorization publication number is: in "2001" disclosed in CN104357387B, "a method for separating human adipose-derived stem cells from adipose tissue", cytobiologists obtained a first separation of multi-directionally differentiated stem cells from an aspirated human adipose suspension by liposuction, and found that it can differentiate into cells such as fat, bone, cartilage, muscle, vascular endothelium, liver, pancreas, nerve, etc.; such adult stem cells having differentiation potential found in human adipose tissue are called human adipose stem cells ". For example, Chinese patent publication numbers are: CN104611290A document "method for inducing adipose-derived stem cells to differentiate into epidermal cells", chinese patent publication No.: CN104805051A document "method for inducing adipose-derived stem cells to differentiate into fibroblasts", chinese patent publication No.: CN106350483A, a culture method for inducing differentiation of adipose-derived stem cells into chondrocytes, as disclosed in chinese patent publication No.: the document CN 103805566B, "method for differentiating human adipose-derived stem cells into neural-like stem cells after three-dimensional culture", discloses that adipose-derived stem cells (ADSCs) themselves have multi-directional differentiation potential, and under certain conditions, can be induced to differentiate into various cells, including osteoblasts, chondrocytes, adipocytes, neural cells, and hepatocytes. And the adipose-derived stem cells (ADSCs) are not limited by time, can be obtained by autologous liposuction separation of patients of any age group, avoids immunological rejection, is relatively easy to obtain materials and does not form tumors. After years of research, adipose-derived stem cells (ADSCs) can be induced to differentiate into various cells, but a technology for inducing human adipose-derived stem cells to differentiate into testicular interstitial cells by small molecules is not disclosed; therefore, the patent can adopt human adipose-derived stem cells (hADSCs) based on the basis, and induce the adipose-derived stem cells (ADSCs) to differentiate into functional mature testicular mesenchymal cells (LCs) (ALCs) by adopting a small molecule rather than a gene introduction method, thereby providing scientific basis for treating androgen deficiency by transplanting the testicular mesenchymal cells (ALC) differentiated from autologous adipose-derived stem cells (ADSCs) of patients in the future.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention provides a method for inducing human adipose-derived stem cells to be differentiated into testicular interstitial cells by micromolecules, and the method breaks through the technical blank of inducing human adipose-derived stem cells to be differentiated into testicular interstitial cells in the prior art; and the induction completely adopts small molecules, does not depend on the introduction of exogenous genes, and improves the safety for clinical application in the future.

In order to achieve the purpose, the invention adopts the technical scheme that: a method for inducing human adipose-derived stem cells to differentiate into testicular interstitial cells by small molecules is characterized by comprising the following steps: separating adipose-derived stem cells from the obtained human adipose tissues by type I collagenase, adding the type I collagenase into a DMEM low-sugar (DMEM-LG) culture medium according to the mass-volume ratio of 0.1%, and digesting by pancreatin containing EDTA (ethylene diamine tetraacetic acid) with the mass-volume ratio of 0.25% to obtain subcultured adipose-derived stem cells; analyzing and identifying the obtained subcultured adipose-derived stem cells by flow cytometry; inducing the adipose-derived stem cells by using an adipogenic induction culture medium to complete adipogenic differentiation identification; fourthly, inducing the adipose-derived stem cells by adopting an osteogenic induction culture medium to complete osteogenic differentiation identification; fifthly, after the fat stem cells are identified and processed in the second step and the third step, performing immunofluorescence processing on the fat stem cells: performing membrane permeation treatment at room temperature, directly adding primary antibody for overnight incubation at 4 ℃, then adding secondary antibody for incubation at room temperature, and then performing staining for incubation at room temperature; sixthly, inoculating and culturing the adipose-derived stem cells for 5 days, performing differentiation culture, adding small molecules to promote the adipose-derived stem cells to be differentiated into testicular interstitial cells in the differentiation culture process, wherein the small molecules comprise SAG,22OHC, Li, PDGF-AA, FGF2, android and LH, manually removing non-testicular interstitial cell (ALCs) like cells, enriching differentiated target cells (ADSC-ALCs), and completing immunofluorescence identification and reverse transcription PCR detection identification analysis of the target cells.

Furthermore, in the differentiation culture process of the adipose-derived stem cells in the step (c), when the inoculation culture medium is changed into a differentiation culture medium, the time point is defined as the day 0 of differentiation, then 0.5 μ M SAG,2 μ M22 OHC and 10mM Li are added into the differentiation culture medium every 2 days to promote differentiation, in the day 7 to 14 of differentiation, proliferation promoting factors 10ng/mL PDGF-AA and 10ng/mL FGF2 are added into the differentiation culture medium every 2 days, and differentiation promoting factors 20 μ M android are added, in the day 14 to 18 of differentiation, maturation promoting factors 50/mL LH and 0.5 μ M SAG are added into the differentiation culture medium every 2 days; the adipose-derived stem cells are induced in a differentiation medium ADSC-DIM for 18 days, and the differentiation medium is changed 1 time every 2 days.

Still further, after induced differentiation for 18 days, self-made glass cells are scraped under a microscope to manually remove non-testicular interstitial-like cells, the rest adherent cells are digested by EDTA with the mass-volume ratio of 0.25%, centrifuged for 5 minutes at 1000 rpm, resuspended by an Enrichment Medium, and transferred to a 6-well plate which is treated by 1% by volume of Matrigel Coating in advance, i.e., incubated at 37 ℃ for more than 1 hour, for Enrichment culture for 7 days, i.e., day 25, wherein the Enrichment Medium comprises DMEM-F12, 1% by volume of FBS, Sodiumpyrolvate and Glutamax.

Further, the differentiation medium adopted in the differentiation culture in the step (sixty) comprises DMEM-F12, ITS, 10ng/mL LH, 0.2 mu M SAG,2 mu M22 OHC and 5mM Li.

Still further, the adipogenic induction medium in step (c) comprises DMEM/LG containing 100U/mL P/S and 10% FBS by volume, 10. mu.M insulin, 0.5mM isobutylmethylxanthine, 1. mu.M dexamethasone, and 200. mu.M indomethacin.

Further, the adipogenic induction medium in step (c) comprises DMEM/LG containing 100U/mL P/S and 10% FBS, 10 μ M insulin, 0.5mM isobutylmethylxanthine, 1 μ M dexamethasone, and 200 μ M indomethacin.

Further, the osteogenic induction medium of step (iv) comprises DMEM/LG containing 100U/mL double antibody (P/S) and 10% Fetal Bovine Serum (FBS) by volume, 50 μ M ascorbyl phosphate, 1 μ M dexamethasone, and 100 μ M glycerophosphate. Further, in the fifth step, the primary antibody comprises a rabbit monoclonal CYP11A1 antibody, a rabbit polyclonal CYP17A1 antibody, a rabbit polyclonal HSD3B1 antibody and a mouse monoclonal CD29 antibody, the rabbit monoclonal CYP11A1 antibody and a diluent are diluted according to a volume ratio of 1:350, the rabbit polyclonal CYP17A1 antibody and the diluent are diluted according to a volume ratio of 1:100, the rabbit polyclonal HSD3B1 antibody and the diluent are diluted according to a volume ratio of 1:500, and the mouse monoclonal CD29 antibody and the diluent are diluted according to a volume ratio of 1: 500; the secondary antibody comprises a Cy 3-labeled goat anti-rabbit IgG antibody, a Cy 3-labeled goat anti-mouse IgG antibody and a FITC-labeled goat anti-rabbit IgG antibody, the Cy 3-labeled goat anti-rabbit IgG antibody is diluted with a diluent according to the volume ratio of 1:500, the Cy 3-labeled goat anti-mouse IgG antibody is diluted with the diluent according to the volume ratio of 1:500, and the FITC-labeled goat anti-rabbit IgG antibody is diluted with the diluent according to the volume ratio of 1: 500.

By adopting the scheme, the reaction mechanism of the invention is as follows: 1) separating to obtain high-purity human adipose-derived stem cells; 2) the optimal induction differentiation is carried out according to the proportioning scheme disclosed by the patent. The invention adopts micromolecules to induce differentiation, and has the following beneficial effects: 1) the adipose-derived mesenchymal stem cells are used as induction seed cells, have a wide and large source compared with other stem cells, and can be obtained from autologous tissues, so that immune rejection reaction is avoided; 2) exogenous genes are not introduced in the differentiation process, and micromolecule induction is completely adopted, so that the safety of future clinical application is improved; 3) the small molecule induction process is flexible and controllable, excessive induction is avoided, and the induction efficiency is improved; 4) the induction method has strong operability and good repeatability, and can stably induce a large amount of testicular interstitial cells capable of secreting testosterone, thereby being more suitable for future clinical application.

The invention is further described below with reference to the accompanying drawings.

Drawings

FIG. 1 shows isolated and cultured adipose-derived stem cells (ADSCs); wherein (A) is ADSCs (P0) of primary culture; (B) ADSCs cultured for one generation (P1); (C) ADSCs cultured for the second generation (P2); (D) ADSCs cultured for the third generation (P3);

FIG. 2 shows the flow assay of adipose-derived stem cells (ADSCs); wherein, the (A) is the expression condition of surface antigen of the flow analysis adipose-derived stem cells (ADSCs); (B) statistical streaming data graphs for the histograms;

FIG. 3 shows the identification of adipogenic osteogenesis induced Adipose Derived Stem Cells (ADSCs); wherein (A) is an adipose-derived stem cell (ADSCs) negative control group which is not treated by a adipogenic induction medium; (B) the ADSCs which are subjected to differentiation treatment by the adipogenic induction culture medium are stained with oil red O to be positive (black arrows); (C) the ADSCs are negative control groups of ADSCs which are not treated by osteogenesis induction culture medium; (D) the ADSCs treated by the osteogenesis induction medium differentiation are stained positive by alkaline phosphatase (black arrows);

FIG. 4 shows that adipose-derived stem cells (ADSCs) are induced to differentiate into mesenchymal cells (ALCs) in a differentiation medium (ADSC-DIM); wherein (A) is a schematic diagram of induced differentiation; (B) targeting cell bright field morphology for induced differentiation at different time points; (C) measuring testosterone level in culture medium supernatant of ADSCs (negative control), ADSCs-ALCs (differentiation group) and ALCs (positive control) after LH stimulation for 3 hours by a radioimmunoassay;

FIG. 5 shows target cells (ADSC-ALCs) induced to differentiate by immunofluorescence assay; wherein, the expression of ADSCs (negative control), LCs (positive control) and ADSC-ALCs (experimental group) marker proteins CYP11A1, CYP17A1, HSD17B3 and CD29 is detected by immunofluorescence.

Detailed Description

The present invention is not limited to the following embodiments, and those skilled in the art can implement the present invention in other embodiments according to the disclosure of the present invention, or make simple changes or modifications on the design structure and idea of the present invention, and fall into the protection scope of the present invention.

The specific embodiment of the invention is a method for inducing adipose-derived stem cells to differentiate into testicular interstitial cells by using small molecules as shown in FIGS. 1-4, which comprises the following steps,

firstly, obtaining human adipose-derived stem cells: according to the strict requirement of aseptic operation, fat extracted from the abdomen of six women (or extracted from the existing fat bank) is sequentially transferred into a 50mL centrifuge tube in an ultra-clean workbench, and after the tissue fluid and the fat are layered after standing for 10 minutes, the tissue fluid at the bottom layer of the centrifuge tube is removed by using a Pasteur tube. Then adding the fat tissue according to the volume ratio of 1:1, and diluting with DMEM low sugar (DMEM-LG) to obtain the mass volumeCollagenase type I, in a ratio of 0.1%, was incubated for 45 minutes at a constant temperature of 37 ℃ with a shaker at 100 rpm. After centrifugation at 300g for 15 minutes for stratification, the upper layer of the digest was carefully removed, and to further remove a large amount of blood cells mixed in the adipocytes, 10mL of 0.3 vol.% physiological saline was added, and incubated at a constant temperature of 37 ℃ for 15 minutes in a shaker at 100 rpm, and repeated 2-3 times until no red precipitate was visible after centrifugation. Then adding 5mL PBS buffer solution, filtering with 100 mesh steel net after resuspending cells, taking 300g filtrate, centrifuging for 5 minutes, depositing cells at the bottom of a centrifuge tube due to centrifugal force, then adding an ADSC culture solution prepared in advance, namely ADSC Medium resuspended cells, wherein the ADSC culture solution comprises DMEM-LG, 10% Fetal Bovine Serum (FBS) by volume percentage and 1% double antibody (P/S) by volume percentage, counting cells, and then counting with 5 × 10⁴The density of each/mL is inoculated in a culture flask. The flask was transferred to a constant temperature of 37 ℃ with 5% CO by volume₂The culture box is used for culturing, after 3 days, the liquid is changed for cells, and impurities, dead cells and blood cells which can not adhere to the wall are further removed. And then replacing the culture medium for 1 time every 3 days, digesting by using EDTA pancreatin with the mass volume ratio of 0.25% when the cells are proliferated and fused to 80% -90%, and then carrying out subculture to obtain the adipose-derived stem cells.

Experimental results show that the ADSCs can be successfully extracted from the liposuction adipose tissues by a collagenase I digestion method. In general, on day 5 post-culture, most of the adherently grown primary ADSCs (P0) exhibited good long spindle cell morphology by continuously removing suspended blood cells every 2 days (fig. 1A). The cells are cultured continuously and can quickly proliferate to reach 80-90% fusion state. The subcultured first generation ADSCs (P1) (FIG. 1B), second generation ADSCs (P2) (FIG. 1C) and third generation ADSCs (P3) (FIG. 1D) were obtained by trypsinization with EDTA at 0.25% by mass/volume.

② flow cytometric analysis of adipose-derived stem cells (ADSCs): adipose-derived stem cells were cultured at 1X 10⁶The density of each well was inoculated onto 6-well culture plates until the cells were full. Digesting the cells by using EDTA trypsin with the mass volume ratio of 0.25%, and centrifuging at 1500 rpm for 5 minutes to collect the ADSCs. PBS wash 1 time, then add 500. mu.L volume percent 4% polyFormaldehyde was fixed overnight at 4 ℃, the fixative was discarded, 2mL PBS was shaken for resuspension, centrifuged and the supernatant discarded. Blocking with 2mL of 5% by volume FBS-PBS for 10 min at room temperature, centrifuging and discarding the supernatant, and simultaneously setting the isotype control group. According to the volume ratio of 1:50 fluorescent antibodies FITC-CD29, FITC-CD44, FITC-CD59, PE-CD105, PE-CD34, PE-CD45 and 100. mu.l of PE-HLA-DR working solution (5. mu.L of antibody per 100. mu.L of cell volume) were added, incubated at room temperature for 20 minutes in the absence of light, centrifuged to remove the supernatant, washed 3 times with 500. mu.L of PBS, finally resuspended in 200. mu.L of PBS, filtered and tested on the machine.

The results show that the flow surface antigen detection results of the ADSCs of the P1 generation show that the isolated ADSCs can positively express CD44, CD59 and CD29, express CD105 and CD34 at low level, and negatively express CD45 and HLA-DR (FIG. 2A), and the data are quantitatively analyzed and then mapped (FIG. 2B).

③ adipogenic differentiation of the adipose-derived stem cells: adipose-derived stem cells were cultured at 1X 10⁶Inoculating the cells/hole density to a 6-hole culture plate, adding a adipogenic induction culture medium for induction for 2 weeks after the cells adhere to the wall, wherein the adipogenic induction culture medium mainly comprises the following components: 100U/mL double antibody (P/S), 10% by volume Fetal Bovine Serum (FBS) DMEM/LG, 10. mu.M insulin, 0.5mM isobutylmethylxanthine, 1. mu.M dexamethasone and 200. mu.M indomethacin. The adipose stem cells were then washed 3 times with PBS and fixed for 30 minutes at room temperature by adding 10% formaldehyde. The adipose stem cells were then washed 3 times with PBS and stained with 2% oil red O solution for 10 minutes at room temperature. Finally, the staining solution is washed by ethanol with the volume percentage of 70 percent and observed and photographed under an inverted microscope.

The results showed that after 2 weeks of adipogenic induction, the fat particles formed after induction were stained red by oil red O (fig. 3B), indicating that the ADSCs were successfully induced to differentiate into adipocytes.

Osteogenic differentiation of adipose-derived stem cells: adipose-derived stem cells were cultured at 1X 10⁶Inoculating the cells/hole density to a 6-hole culture plate, adding an osteogenic induction culture medium for induction for 2 weeks after the cells adhere to the wall, wherein the osteogenic induction culture medium mainly comprises the following components: DMEM/LG with 100U/mL diabody (P/S) and 10% Fetal Bovine Serum (FBS) by volume, 50 μ M ascorbyl phosphate, 1 μ M dexamethasone, 100 μ M glycerophosphate. Then theThe adipose stem cells were washed 3 times with PBS and fixed for 10 minutes at room temperature by adding 4% by volume of paraformaldehyde. The adipose-derived stem cells were then washed 3 times with PBS, and stained with alkaline phosphatase solution at 37 ℃ for 15 minutes. Finally, the staining solution is washed by deionized water and observed and photographed under an inverted microscope.

The results showed that after 2 weeks of osteogenic induction, the cells secreted calcified collagen-rich ECM, which was positively stained blue by alkaline phosphatase (fig. 3C), indicating that the ADSCs were successfully induced to differentiate into osteocytes.

These data for adipogenic osteogenic induced differentiation described above demonstrate that the above procedure has been successful in extracting ADSCs from adipose tissue.

Inducing adipose-derived stem cells (ADSCs) to differentiate into testicular interstitial cells (ADSC-ALC) by micromolecules, and culturing the adipose-derived stem cells at a ratio of 1 × 10⁵The density of each hole is inoculated on a 12-hole culture plate, and the cells are overgrown after 5 days of culture. The culture medium adopts a differentiation culture medium ADSC-DIM: DMEM-F12, ITS, 10ng/mL LH, 0.2M SAG, 2M 22OHC and 5mM Li, this time point being defined as day 0 of differentiation. Then on days 0 to 7 of differentiation, 0.5M SAG, 2M 22OHC, 10mM Li was added to the differentiation medium every 2 days to promote differentiation. On days 7 to 14 of differentiation, the proliferation-promoting factors PDGF-AA at 10ng/mL and FGF2 at 10ng/mL, and the differentiation-promoting factor 20M android were added to the differentiation medium every 2 days. On days 14 to 18 of differentiation, 50ng/mL LH and 0.5M SAG of pro-maturation factor were added to the differentiation medium every 2 days. The ADSCs are induced in differentiation culture medium ADSC-DIM for 18 days, and the differentiation culture medium is changed 1 time every 2 days. After induced differentiation for 18 days, self-made glass cells are scraped under a microscope to manually remove non-ALC-like cells, the rest adherent cells are digested by EDTA with the mass-volume ratio of 0.25%, centrifuged at 1000 rpm for 5 minutes for Enrichment, and an Enrichment Medium (Enrichment Medium) is adopted: DMEM-F12, FBS (1% by mass/volume), Sodiumrugate and Glutamax were resuspended and transferred to 6-well plates previously treated with 1% by volume of Matrigel Coating (incubated at 37 ℃ for 1 hour or more) for enrichment culture for 7 days, i.e., day 25. The target cells obtained by differentiation are then subjected to subsequent identification analysis.

The above-mentioned method adopts the specific differentiation culture medium ADSC-DIM: DMEM-F12, ITS, 10ng/mL LH, 0.2. mu.M SAG, 2. mu.M 22OHC and 5mM Li, induced differentiation of ADSCs into ALCs. Simultaneously, adding a certain amount of small molecules into a differentiation culture medium at different time points comprises the following steps: SAG,22OHC, Li, PDGF-AA, FGF2, Androgen and LH promote cell proliferation and differentiation, and finally, manually eliminate non-ALCs-like cells to enrich differentiated target cells (ADSC-ALCs), wherein the specific differentiation process is shown in figure 4A. When the ADSC Medium is replaced by the differentiation Medium ADSC-DIM, the differentiation day 0 is defined, and the cells are in compact fusiform structure and have good growth state. On the 7 th day of induced differentiation, the cell morphology is significantly changed, and the cell is follicular and has strong refractivity. On the 14 th day of induced differentiation, the cell morphology was in a mixed state of circular and elliptical shapes, and the refractivity was decreased. At day 18 of induced differentiation, the cell morphology was in a mixed state of multiple morphologies (fig. 4B). After induced differentiation, the ADSC-ALCs are manually enriched, 100ng/ml LH (maximum stimulation concentration) is added into the culture medium for culturing for 3 hours, the culture medium is collected, and testosterone is measured in the supernatant of the culture medium, and the result shows that the ADSC-ALCs can secrete testosterone and is higher than that of the negative control ADSCs but lower than that of the positive control ALCs (figure 4C).

Sixthly, performing immunofluorescence identification on differential target cells (ADSC-ALCs): after the adipose-derived stem cells are well treated, the supernatant is aspirated and discarded, PBS is washed for 1 time, paraformaldehyde with the volume percentage of 4% is added for incubation for 15 minutes at room temperature, then PBS is washed for 3 times, 5 minutes are added for each time, PBS containing Triton-X100 with the mass-volume ratio of 0.1% and Bovine Serum Albumin (BSA) with the mass-volume ratio of 3% is added, and membrane permeation treatment is carried out for 1 hour at room temperature. Then add primary antibody without washing: rabbit monoclonal CYP11A1 antibody (vol: 1:350), rabbit polyclonal CYP17A1 antibody (vol: 1:100), rabbit polyclonal HSD3B1 antibody (vol: 1:500), and mouse monoclonal CD29 antibody (vol: 1:500) were incubated overnight at 4 ℃. Then washed 3 times with PBS for 5 minutes each, followed by the addition of secondary antibodies: cy 3-labeled goat anti-rabbit IgG antibody (volume ratio 1:500), Cy 3-labeled goat anti-mouse IgG antibody (volume ratio 1:500) and FITC-labeled goat anti-rabbit IgG antibody (volume ratio 1:500) were incubated at room temperature for 2 hours. After that, the cells were washed 3 times with PBS for 5 minutes, and then incubated with DAPI staining solution at room temperature for 15 minutes in the dark. Finally, washing with PBS for 3 times, each time for 5 minutes, and directly inverting to take a picture under a fluorescence microscope.

Immunofluorescence identification is carried out on the differentiated target cells (ADSC-ALCs) to detect the expression conditions of testis interstitial cell related marker proteins CYP11A1, CYP17A1, HSD17B3 and adipose-derived stem cell surface specific marker protein CD 29. The result shows that the negative control group adipose-derived stem cells ADSCs can positively express CD29, but negatively express CYP11A1, CYP17A1 and HSD17B 3. The positive control group Leydig cell LCs can positively express CYP11A1, CYP17A1 and HSD17B3 and negatively express CD 29. The experimental group induces partial differentiation of target cells ADSC-ALCs to positively express leydig cell related marker proteins CYP11A1, CYP17A1 and HSD17B3 and negatively express adipose-derived stem cell related marker protein CD29 (figure 5).

Seventhly, reverse transcription PCR (RT-PCR) detection

Total RNA was extracted from each group of cells using Trizol (England Weiji, USA) and OD was determined to ensure that OD 260/OD280 of RNA extracted from each group was between 1.8 and 2.1 to ensure purity. The total RNA was then reverse transcribed into cDNA using a reverse transcription kit (Toyobo, Japan), and the reaction system and reaction procedure were as described in the product manual. The cDNA is used for RT-PCR, and the primer sequence adopts:

Cyp11a1-F:GCAGTGTCTCGGGACTTCG

Cyp11a1-R:GGCAAAGCGGAACAGGTCA

Hsd3b1-F:CACATGGCCCGCTCCATAC

Hsd3b1-R:GTGCCGCCGTTTTTCAGATTC

Cyp17a1-F:TATGGCCCCATCTATTCGGTT

Cyp17a1-R:GCGATACCCTTACGGTTGTTG

Hsd17b3-F:GTCAACAATGTCGGAATGCTTC

Hsd17b3-R:TGATGTTACAATGGATGAGGCTC

Sf-1-F:GGAGGCTTGCGAAGGAGAAG

Sf-1-R:AGCTTACCCAACGGCGTG

CD29-F:GGAGTCGCGGAACAGCA

CD29-R:AGCAAACACACAGCAAACTGAA

CD44-F:CTGCCGCTTTGCAGGTGTA

CD44-R:CATTGTGGGCAAGGTGCTATT

Gadph-F:ACAACTTTGGTATCGTGGAAGG

Gadph-R:GCCATCACGCCACAGTTTC

the reaction system was subjected to 35 cycles (95 ℃ C., 10 seconds; 60 ℃ C., 30 seconds) of pre-denaturation at 95 ℃ for 3 minutes, with reference to the SYBR kit (Baori, Japan) instructions, after immediate isolation. After the reaction, a standard curve is drawn according to the statistical analysis of Ct values, and quantitative analysis is performed by using a Ct (2-Ct) -based method.

Meanwhile, reverse transcription-polymerase chain reaction (RT-PCR) detection results show that the induced differentiation target cells ADSC-ALCs can positively express leydig cell related marker genes Cyp11a1, Hsd3b1, Cyp17a1, Hsd17b3 and Sf-1 and negatively express adipose stem cell related marker genes CD29 and CD 44.

Serum testosterone determination (radioimmunoassay)

Preparing TBS-G solution: 1g of gelatin, 4.4g of Trizma HCl, 2.65g of Trizma Base, 5.84NaCl and 1g of Na Azide were dissolved in 1L of double distilled water. Add 500. mu.L TBS-G to labeled TC tubes (intact radioactivity measured without charcoal adsorption). Add 500. mu.L TBS-G to the labeled NBS tube (no antibody added, for measurement of nonspecific binding values). Add 200. mu.L TBS-G and 100. mu.L sample to the labeled sample tube. Add 300. mu.L of standards of different concentrations (10-2000 pg/100. mu.L, 8 concentrations) to the tube labeled with the standard tube. 200. mu.L of testosterone antibody was added to each tube except for TC tube and NBS tube. Add 300. mu.L of Tracer (3H-testosterone-TBS-G solution) to each tube, shake, and keep at 4 ℃ overnight. With the exception of TC tubes, 200. mu.L of activated carbon/dextran (for adsorption of testosterone bound to the antibody) was added to each tube and left for 20 minutes, shaken, and centrifuged at 1800g for 10 minutes. The supernatant was carefully added to a flask containing 5. mu.L of scintillation vial, taking care not to let the activated carbon enter the flask, and then mixed by inverting the flask upside down. And (5) liquid flash measurement. The difference between the internal and external effects detected was 15%.

In conclusion, the experimental results suggest that the addition of SAG,22OHC, Li, PDGF-AA, FGF2, Androgen and LH small molecules based on the differentiation medium ADSC-DIM can successfully induce the differentiation of adipose-derived stem cells (ADSCs) into mesenchymal cells of testis (ALCs).

Claims

1. A method for inducing human adipose-derived stem cells to differentiate into testicular interstitial cells by small molecules is characterized by comprising the following steps: separating adipose-derived stem cells from the obtained human adipose tissues by type I collagenase, adding the type I collagenase into a DMEM low-sugar (DMEM-LG) culture medium according to the mass-volume ratio of 0.1%, and digesting by pancreatin containing EDTA (ethylene diamine tetraacetic acid) with the mass-volume ratio of 0.25% to obtain subcultured adipose-derived stem cells; analyzing and identifying the obtained subcultured adipose-derived stem cells by flow cytometry; inducing the adipose-derived stem cells by using an adipogenic induction culture medium to complete adipogenic differentiation identification; fourthly, inducing the adipose-derived stem cells by adopting an osteogenic induction culture medium to complete osteogenic differentiation identification; fifthly, after the fat stem cells are identified and processed in the steps II to IV, performing immunofluorescence processing on the fat stem cells: performing membrane permeation treatment at room temperature, directly adding primary antibody for overnight incubation at 4 ℃, then adding secondary antibody for incubation at room temperature, and then performing staining for incubation at room temperature; sixthly, inoculating and culturing the adipose-derived stem cells for 5 days, performing differentiation culture, adding small molecules to promote the adipose-derived stem cells to be differentiated into testicular interstitial cells in the differentiation culture process, wherein the small molecules comprise SAG,22OHC, Li, PDGF-AA, FGF2, android and LH, manually removing non-testicular interstitial cell (ALCs) like cells, enriching differentiated target cells (ADSC-LCs), and completing immunofluorescence identification and reverse transcription PCR detection identification analysis of the target cells;

in the differentiation culture process of the adipose-derived stem cells in the step (c), when the inoculation culture medium is changed into a differentiation culture medium, the time point is defined as the day 0 of differentiation, then 0.5 mu M SAG,2 mu M22 OHC and 10mM Li are added into the differentiation culture medium every 2 days to promote differentiation in the day 0 to 7 of differentiation, in the day 7 to 14 of differentiation, proliferation promoting factors of 10ng/mL PDGF-AA and 10ng/mL FGF2 and differentiation promoting factors of 20 mu M android are added into the differentiation culture medium every 2 days, in the day 14 to 18 of differentiation, 50ng/mL LH and 0.5 mu M SAG are added into the differentiation culture medium every 2 days; inducing the adipose-derived stem cells in a differentiation medium ADSC-DIM for 18 days, and changing the differentiation medium for 1 time every 2 days;

the differentiation medium adopted in the differentiation culture in the step sixthly comprises DMEM-F12, ITS, LH of 10ng/mL, SAG of 0.2 mu M, OHC of 2 mu M22 and Li of 5 mM.

2. The method for inducing human adipose-derived stem cells to differentiate into leydig cells according to claim 1, wherein the small molecule comprises: after 18 days of induced differentiation, non-testicular mesenchyma-like cells were manually removed by scraping with home-made glass cells under a microscope, the remaining adherent cells were digested with EDTA at a mass-to-volume ratio of 0.25% and then centrifuged at 1000 rpm for 5 minutes for Enrichment, and resuspended in an Enrichment Medium (Enrichment Medium) comprising DMEM-F12, Fetal Bovine Serum (FBS) at a volume percentage of 1%, sodumpyvate, Glutamax, and transferred to a 6-well plate previously treated with 1% Matrigel Coating by volume, i.e., incubated at 37 ℃ for 1 hour or more for Enrichment culture for 7 days, i.e., day 25.

3. The method for inducing human adipose-derived stem cells to differentiate into leydig cells according to claim 1, wherein the small molecule comprises: the adipogenic induction culture medium in the step (c) comprises DMEM/LG containing 100U/mL P/S double antibody and 10% FBS by volume, 10 mu M of insulin, 0.5mM of isobutyl methylxanthine, 1 mu M of dexamethasone and 200 mu M of indomethacin.

4. The method for inducing human adipose-derived stem cells to differentiate into leydig cells according to any one of claims 1-2, wherein: the adipogenic induction medium in the step (c) comprises DMEM/LG containing 100U/mL P/S and 10% FBS by volume, 10 mu M of insulin, 0.5mM of isobutyl methylxanthine, 1 mu M of dexamethasone and 200 mu M of indomethacin.

5. The method for inducing human adipose-derived stem cells to differentiate into leydig cells according to claim 3, wherein: the osteogenic induction culture medium in the step (IV) comprises DMEM/LG containing 100U/mLP/S double antibody and 10% Fetal Bovine Serum (FBS) by volume percentage, 50 mu M ascorbyl phosphate, 1 mu M dexamethasone and 100 mu M glycerophosphate.

6. The method for inducing human adipose-derived stem cells to differentiate into leydig cells according to any one of claims 1-2, wherein: the osteogenic induction culture medium in the step (IV) comprises DMEM/LG containing 100U/mLP/S double antibody and 10% Fetal Bovine Serum (FBS) by volume percentage, 50 mu M ascorbyl phosphate, 1 mu M dexamethasone and 100 mu M glycerophosphate.

7. The method for inducing human adipose-derived stem cells to differentiate into leydig cells according to claim 5, wherein: the primary antibody in the fifth step comprises a rabbit monoclonal CYP11A1 antibody, a rabbit polyclonal CYP17A1 antibody, a rabbit polyclonal HSD3B1 antibody and a mouse monoclonal CD29 antibody, wherein the rabbit monoclonal CYP11A1 antibody is diluted with a diluent according to the volume ratio of 1:350, the rabbit polyclonal CYP17A1 antibody is diluted with the diluent according to the volume ratio of 1:100, the rabbit polyclonal HSD3B1 antibody is diluted with the diluent according to the volume ratio of 1:500, and the mouse monoclonal CD29 antibody is diluted with the diluent according to the volume ratio of 1: 500; the secondary antibody comprises a Cy 3-labeled goat anti-rabbit IgG antibody, a Cy 3-labeled goat anti-mouse IgG antibody and a FITC-labeled goat anti-rabbit IgG antibody, the Cy 3-labeled goat anti-rabbit IgG antibody is diluted with a diluent according to the volume ratio of 1:500, the Cy 3-labeled goat anti-mouse IgG antibody is diluted with the diluent according to the volume ratio of 1:500, and the FITC-labeled goat anti-rabbit IgG antibody is diluted with the diluent according to the volume ratio of 1: 500.

8. The method for inducing human adipose-derived stem cells to differentiate into leydig cells according to any one of claims 1-2, wherein: the primary antibody in the fifth step comprises a rabbit monoclonal CYP11A1 antibody, a rabbit polyclonal CYP17A1 antibody, a rabbit polyclonal HSD3B1 antibody and a mouse monoclonal CD29 antibody, wherein the rabbit monoclonal CYP11A1 antibody is diluted with a diluent according to the volume ratio of 1:350, the rabbit polyclonal CYP17A1 antibody is diluted with the diluent according to the volume ratio of 1:100, the rabbit polyclonal HSD3B1 antibody is diluted with the diluent according to the volume ratio of 1:500, and the mouse monoclonal CD29 antibody is diluted with the diluent according to the volume ratio of 1: 500; the secondary antibody comprises a Cy 3-labeled goat anti-rabbit IgG antibody, a Cy 3-labeled goat anti-mouse IgG antibody and a FITC-labeled goat anti-rabbit IgG antibody, the Cy 3-labeled goat anti-rabbit IgG antibody is diluted with a diluent according to the volume ratio of 1:500, the Cy 3-labeled goat anti-mouse IgG antibody is diluted with the diluent according to the volume ratio of 1:500, and the FITC-labeled goat anti-rabbit IgG antibody is diluted with the diluent according to the volume ratio of 1: 500.