CN108456683B - Function and application of gene SID1 for regulating heading stage of rice - Google Patents

Abstract

The present invention belongs to the field of plant gene engineering technology. In particular to a function and application of a gene SID1 for regulating and controlling the heading stage of rice. The invention comprises the cloning, the functional verification and the application of a rice heading stage gene SID 1. The gene SID1 or DNA fragment is transformed into rice plants, and the flowering transformation process of rice can be regulated, so that the heading time of rice is regulated, and the yield formation and the regional distribution of varieties are improved.

Description

Function and application of gene SID1 for regulating heading stage of rice

Technical Field

The present invention belongs to the field of plant gene engineering technology. In particular to clone, functional verification and application of a gene SID1 for regulating and controlling heading stage of plants (rice). The gene or the DNA fragment is transformed into a rice plant, and the flowering transformation process of rice can be regulated, so that the heading time of the rice is regulated, and the contribution to the yield formation and the variety regional distribution of the rice is made.

Background

Flowering (manifested as heading on rice) is an important growth and development process for the transformation of flowering plants from vegetative to reproductive growth. Because of the different requirements of people for the use of different plant organs, plants are required to bloom at the right time. The rice is harvested, and blooms at a proper time, so that reproductive development can be successfully completed, and the influence of adverse factors such as frost, bird insect damage and the like is avoided. The time for flowering, fruiting and high yield of woody fruit trees is an important factor influencing the economic applicability of perennial fruit trees, and the discovery and utilization of genes promoting flowering of fruit trees can lead the fruit trees to bloom and see fruits in advance, which means that farmers can gain benefits in advance, take effect early and increase the planting enthusiasm of the farmers. Spinach, water spinach, yam and other vegetable crops mainly harvest the vegetative organs, and delaying or avoiding flowering of these plants can increase the yield of useful vegetative organs. Therefore, the method has important application significance for guiding the improvement of crop varieties and breeding practice by regulating and controlling the flowering time of the plants. In the early days, the research team cloned the molecular switch gene RID1(Rice indicator 1) (the cloning of RID 1gene is disclosed in published papers and patent applications, Wu et al, RID1, encoding a Cys2/His2-type zinc finger transcription factor, acts as a master switch from genetic transformation to floralevovere in Rice, Proc.Natl.Acad.Sci.USA (2008): 15-12920; patent application No.: 200810046989; publication No.: CN 101235378B). The transformation of rice into flowers can be regulated by a method of genetically transforming RID 1.

The flowering time of plants is influenced by many factors, including external factors such as photoperiod and temperature, and internal factors such as physiological conditions (age and leaf number) of plants (Baule et al, The timing of evolution transformations in plants, Cell (2006): 655-664). Among them, the photoperiod is one of the most important environmental regulatory factors affecting plant flowering. Arabidopsis thaliana is a long-day plant because long-day conditions promote flowering of arabidopsis thaliana, while short-day conditions delay flowering of arabidopsis thaliana. A large number of molecular genetics experiments have identified a series of arabidopsis flowering control mutants and cloned related mutant genes, and the genes controlling flowering in arabidopsis are classified into 6 types of control pathways according to the biological functions of the related mutant genes: the circadian rhythm and photoperiod pathway, vernalization pathway, autonomous Flowering pathway, age pathway, gibberellin pathway and trehalose-6-phosphate (T6P) pathway (Fornara et al, Snap shot: Control of Flowering in Arabidopsis, Cell (2010): 550,550e 551-552; Wahl et al, Regulation of Flowering bytylase-6-phosphate signalling in Arabidopsis thaliana, Science (2013): 704 707). The biological clock rhythm and photoperiod pathways, vernalization pathways are mainly influenced by environmental factors, while the autonomous flowering pathway, age pathway, gibberellin and T6P pathways are mainly dependent on plant development age and endogenous hormone, metabolite levels (Mouradvo et al, Control of flowering time: interacting diseases as a basis for differentiation, plant cell (2002): S111-S130).

In contrast to Arabidopsis, rice is a typical short-day model Plant, and therefore, the study of the molecular genetic mechanism of rice flowering will help one to understand the similarities and differences at the flowering regulatory molecular level between long-day and short-day plants (Izawa et al, comprehensive biological society in bloom: genetic and genetic compatibility of flowering pathways in rice and Arabidopsis, Curr Opin Plant Biol, (2003): 113-120). Previous studies found that photoperiod-regulatory genes of rice and Arabidopsis have been conserved, for example, genes such as OsGI, Hd1 and Hd3a of rice and Arabidopsis homologous genes GI, CO and FT thereof play an important role in flowering regulation (Hayama et al, Adaptation of photoperiod control products short-day flowering facility, Nature (2003): 719-722; Yano et al, Hd1, a major photoperiod sensitive quantitative trait loci in facility, is closed related to the Arabidopsis flowing power CONNS, Plant Cell (2000): 2473 2483; Kojima et al, Hd3a, a restriction of genetic engineering flow, FT 1-Cell, 2002-1. Cell 1096. the Plant Cell can be used as a flowering regulator for flowering. However, rice and arabidopsis thaliana have some differences in the molecular mechanism of flowering regulation, for example, under the condition of inducible photoperiod, the Hd 1gene of rice and the arabidopsis thaliana homologous gene CO both promote flowering; however, under non-induced photoperiod conditions, the Hd 1gene in rice delays flowering, while the CO gene does not function in flowering control in Arabidopsis (IZawa et al, Phytochrome media, external light signal to press FT orthogonal flowering in Genes Dev (2002): 2006) -2020; Hayama et al, adaptive photoperiodic control Genes production short-day flowering entity, Nature (2003): 719-722). In addition, there are some flowering-regulating genes present only in rice or Arabidopsis thaliana. For example, Ehd1 and Ehd4 in rice act to promote heading under long and short day conditions, but their homologous genes do not exist in Arabidopsis; no homologous gene was found in rice, but the key regulatory gene FLC in the Arabidopsis autonomous FLOWERING pathway (Doi et al, Ehd1, a Btpype response regulator in rice, controls short-day movement of FLOWERING and control FT-like gene expression of Hd1, Genes Dev (2004): 926. sup. 936; Gao et al, Ehd4encodes a novel and Oryza-Genus-specificity regulator of photosynthetic FLOWERING in rice, Plos Gent (2013): 1003281; Michaels et al, FLOWERRIRIUS C LOCencodes a novel DS MADoMAdoman protein expression of rice expression of flow 949-56).

C2H 2-type zinc finger proteins are a large family of transcription factors widely existing in eukaryotes, and the most important characteristic of the proteins is that the N terminal contains a conserved INDETERMINATE domain, namely IDD. Studies have shown that many C2H 2-type zinc finger proteins in plants play an important regulatory role in Plant growth and development (Agarwal et al, Genome-side identification of C2H2zinc-finger gene family in rice and the same genetic and expression analysis, Plant mol. biol (2007): 467-485). For example, the cloned ID 1gene in maize belongs to a new class of plant-specific IDD proteins, which contain a putative nuclear localization signal and four different zinc finger motifs. It was found that The loss-of-function mutant of The ID 1gene appeared to delay flowering and to mutate inflorescences into seedling-like vegetative organs (Colasanti et al, The mail indermate 1flowering time regulator defined aspects of high strain subsequent detailed gene family in high strain plants, BMC Genomics (2006): 158; Colasanti et al, The indexing gene codes a zinc probe protein and regulation a leaf-general signal required for The transformation of a vegetative tissue mail, Cell (1998): 593 + 603). The RID 1gene cloned in Rice is an orthologous gene of maize ID1, the mutant of which appears to be unable to complete transformation from vegetative to reproductive growth, a flowering switch identified in Rice (Wu et al, RID1, encoding a Cys2/His2-type zinc finger transport factor, acts as a master switch from genetic transformation to floral depth in Rice, Proc Natl Acad Sci U A (2008): 12915-12920; Park et al, Rice index 1(OsId1) is a process for the expression of the expressed 1(Early addition date 1) scalable expression of phosphor, 1018J (1029; Matbara et al, Ed 2, edition 2, Plant of molecular engineering, 2008-365). The invention utilizes the technology of an activation tag to separate and identify the mutant inhibiting gene SID1 of rid1 in rice, SID1 can reverse the non-heading phenotype of rid1 mutant, the gene encodes an indeterminateddomain zinc finger protein, and mutant phenotype analysis, gene expression analysis and gene function verification experiments show that SID1 is a new gene for regulating the heading stage of rice and can be used for regulating the heading time of rice by molecules.

Disclosure of Invention

The invention aims to separate and clone a new gene SID1 for regulating a plant, particularly a rice heading stage and a coding protein thereof, and the gene SID1 is transformed into a rice plant body by a genetic transformation method to regulate the flowering stage of the plant (rice), so that the heading time of the rice is regulated, and the invention contributes to the yield formation and the variety regional distribution of the rice.

The applicant named the supressor of rid 1gene (SID 1gene for short) for regulating and controlling the flowering transition and/or heading stage of the cloned new gene of the plant (rice), and the nucleotide sequence of the gene is shown as SEQ ID NO: 1, or the sequence of SEQ ID NO: 1, and of course, the nucleotide sequence shown in SEQ ID NO: 1 by insertion, substitution or deletion of one or more bases to produce an allele of a mutant. According to the above inventive concept, the present invention can also be the sequences of SEQ ID NOs: 3, and the amino acid sequence of the SID1 protein shown in SEQ ID NO: 2, and (2) an amino acid sequence having a homology of 50% or more among amino acid sequences corresponding to the genes shown in (2), including a protein or a protein analog having a modified function by insertion, substitution or deletion of one or more amino acids in the amino acid sequence.

The gene SID1 for regulating and controlling the heading stage of a plant (rice) cloned by the invention is a gene which is cloned by a label activating method and participates in the regulation and control of the heading stage of the rice. The invention has proved that the gene is mainly expressed in the leaf on the tissue organ; the cloned Crispr deletion mutant of the SID 1gene shows a late heading phenotype, and the rid1 can recover flowering heading after the rid1 mutant is transformed by the normal functional gene SID 1. The SID1 protein contains a conserved ID (indeterminatedomain) domain that is crucial for floral transformation in the rid1 background.

The invention provides a nucleotide sequence and a protein sequence for changing flowering time of plants by carrying out genetic transformation on the plants by using SID1 gene. Specifically, the invention provides a polypeptide comprising SEQ ID NO: 1 or a part of the gene resembles a functional fragment of a vector, such as vector pU2300-SID1 shown in panel a of figure 3.

The cloned rice heading stage gene SID1 can be used for fusing with other regulatory elements, such as a constitutive promoter (such as Ubiquitin promoter) to construct a gene expression vector, or being used together with a Cas9 site-directed mutagenesis system, regulating and controlling the flowering characteristics (namely the functions of early flowering, delayed flowering or suppression of flowering and the like) of plants by using a transgenic technology and a CRISPR/Cas9-Based gene editing technology, and the like, and is applied to changing the growth period of varieties, improving the regional adaptation range of the varieties, improving the biomass of vegetative organs of the plants and the like.

The technical scheme of the invention is as follows:

1. the molecular switch gene RID1(Rice indicator 1) (Wu et al, RID1, encoding a Cys2/His2-type zinc finger transcription factor, acts as a master switch from genetic to floral expression in Rice, Proc Natl Acad Sci U S A (2008):12915-12920) for controlling Rice flowering transition was cloned by the T-DNA tagging method in the earlier days by the applicant, and the phenotype of the RID1 mutant is never heading. An inhibitory mutant of rid1, Suppressor of rid1(sid1-D), was identified by genetic screening. The methods for generating, screening and identifying the SID1 mutant are described in detail in example 1;

2. the flanking sequence of the site of the si 1-D mutant T-DNA insertion was isolated using the Tail-PCR method (Liu et al, effective isolation and mapping of Arabidopsis thaliana T-DNA insertions junctions by thermal asymmetry intercalary PCR, Plant J (1995): 457. sup.,. sup.: Zhang et al, Non-random distribution of T-DNA insertions and their variations of the genome obtained by the reaction of the mutant by hybridization 13,804T-DNA annealing sequences from strain tissue, Plant J (2007): 947. sup. sup.959), and sequence analysis showed that the T-DNA insertion was in the region 4502A between LOC _ Os02g45054(SID1) and LOC _ 70);

3. the recovery of rid1 normal heading of SID 1gene obtained by the invention is proved by the cosegregation verification of T-DNA insertion and mutation traits (part 3 of example 1) and overexpression complementation experiment (part 4 of example 1);

4. bioinformatics analysis of SID 1gene structure and protein sequence, SID1 contains the zinc finger domain and IDD domain of typical C2H2, and is a novel member of the plant-specific IDD protein family (see fig. 4);

5. the site-directed mutation of conserved amino acids in the SID1 protein ID domain zinc finger motif cannot reverse the rid1 non-heading phenotype, demonstrating that the SID1 protein ID domain zinc finger motif is essential for initiating the flowering transformation process and regulating the heading stage of rice (see section 2 of example 2);

6. the result of the cell localization of the SID 1gene promoter fusion reporter gene GUS tissue shows that the expression abundance of the SID 1gene in the leaf which receives the optical signal is high, and is the same as the reported expression site of the flowering gene. SID1 is localized in the nucleus and has transcriptional activation activity (see example 3);

7. site-directed mutation of SID 1gene (see example 4) by using CRISPR-Cas gene editing technology (Feng et al, Efficient genome editing using a CRISPR/Cas system, Cell Res (2013): 1229) and 1232), and obtaining a plant with SID1 site mutation;

8. the expression of heading stage-associated genes in the sid1 mutant and wild type plants was analyzed by quantitative RT-PCR (see example 4);

more detailed technical solutions will be given by the following examples.

Drawings

The invention will be understood from the following detailed description, taken in conjunction with the accompanying drawings, without limiting the invention thereto.

Sequence listing SEQ ID NO: 1 is the nucleotide sequence (1-8648bp) of the SID 1gene cloned in the invention.

Sequence listing SEQ ID NO: 2 is the nucleotide sequence (1-1848bp) of the coding region of the SID 1gene cloned in the present invention, i.e., CDS.

Sequence listing SEQ ID NO: 3 is the nucleotide sequence (1-1848bp) and the corresponding amino acid sequence (1-615aa) of the coding region of the cloned SID 1gene of the present invention, which codes for 615 amino acids.

FIG. 1: screening of rid1 inhibition mutant sid 1-D. Description of reference numerals: panel A in FIG. 1: pUBQ: (lanes 1to 7) detection of expression level of RID1 of RID1 transgenic heading individual. line 4(sid1-D) detected no expression of RID 1. rid1 served as a negative control. GAPDH was used as an internal control. KAN amplifies Kanamycin sequences at the T-DNA vector borders. pUBQ, the maize Ubiquitin promoter; panel B in fig. 1: the phenotypes of rice "Zhonghua No. 11" (ZH11), rid1 and sid1-D at heading stage are sequentially shown, and the scale is 15 cm; panel C in fig. 1: ZH11, rid1, sid1-D heading date statistics under different sunlight conditions (n 10). NLD, natural long day; SD, short day; LD, long day.

FIG. 2: the results of the flanking sequence isolation and co-isolation assays for sid 1-D. Description of reference numerals: panel A in FIG. 2: schematic diagram of flanking genes and T-DNA insertion structural regions of the T-DNA insertion site in the sid1-D mutant. The partial T-DNA structural region of the transformation vector, including the left boundary LB of the T-DNA, the selection marker gene Kanamycin driven by CaMV35S promoter, and the partial RID 13' UTR region, is transferred into RID1 genome. P4, P5 and P6 are sid1-D coseparation detection primers; panel B in fig. 2: the phenotype and genotype of the sid1-D material are co-separated and detected. Wherein: p1, P2 and P3 are coseparation detection primers for identifying the insertion site of rid 1T-DNA; p4, P5, P6 are coseparation detection primers that identify the site of insertion of sid-D T-DNA in the rid1 background. Panel C in fig. 2: and detecting the expression level of genes flanking the T-DNA insertion site in the backgrounds of sid1-D and rid 1. SID1(LOC _ Os02g45054) expression increased significantly in SID1-D background. Ubiquitin (UBQ) is used as an internal reference.

FIG. 3: genetic complementation analysis of the SID1 gene. Description of reference numerals: panel A in FIG. 3: SID1 construction scheme, a region containing SID 1gene full length coding region and 805bp before start codon and 125bp after stop codon is connected to pU2301 vector; panel B in fig. 3: SID1 transgenic T0 generation, recovering heading single plant SID 1gene expression detection. Control, transgenic negative plants; panel C in fig. 3: ZH11, rid1, SID1-D, rid1pUBQ:: a picture of the phenotype of SID1 material at heading stage. The scale is 15 cm; graph D in fig. 3: the empty vector (negative control) plants used for transformation did not spike. The scale is 15 cm.

FIG. 4 Structure and evolutionary Tree analysis of SID1 gene. Description of reference numerals: panel A in FIG. 4: structural schematic diagram of SID1 gene; panel B in fig. 4: structural schematic diagram of SID1 protein; panel C in fig. 4: evolutionary tree analysis of IDD protein in rice. Phylogenetic analysis the evolutionary tree construction software MEGA5.1 was used. 15 IDD homologous gene sequences from rice were used for construction of the evolutionary tree. The specific parameters are N-J bootstrap N-J, 1000 replicates.

FIG. 5 SID1 ID domain 4 zinc finger motifs are required to reverse the rid1 non-heading phenotype. Panel A in FIG. 5: structural schematic diagram of SID1 site-directed mutant protein for transgenic research. The ID domain of the SID1 protein is schematically shown at the top position. C and H represent cysteine and histidine residues, respectively, which identify the zinc finger motif. The numbers indicate the positions of C and H in the SID1 protein. Zinc finger motifs (ZF1, ZF2, ZF3, ZF4) are indicated by colored boxes. "X" represents a mutated zinc finger motif. ZF1M, ZF2M, ZF3M, ZF4M represent mutated forms of zinc finger motifs ZF1, ZF2, ZF3, ZF4, respectively. Panel B in fig. 5: mutation of the zinc finger motif of SID1 protein failed to restore ear sprouting to rid 1. Positive controls overexpressing SID1CDs can restore heading to rid 1. Scale, 15 cm.

FIG. 6 analysis of expression site of SID1 gene. Description of reference numerals: panel A in FIG. 6: wild type plants for SID1 expression profiling were grown under natural long-day conditions. Wherein: ML is mature leaf; YL is young leaf; ASA is the apical meristem region of the stem. The scale is 15 cm; panel B in fig. 6: the expression level of SID1 in each tissue was measured. Panel C in fig. 6 to panel I in fig. 6: pSID1: GUS staining pattern of each tissue organ of GUS transgenic line. Marker 6C is root tip; 6D is mature leaf; 6E is young leaf; 6F is leaf sheath; 6G is a longitudinal section of the apical meristem of the stem; 6H is a stem; 6I is floret. Scale, 2 mm.

FIG. 7 subcellular localization and transcriptional activity assays of the SID1 gene. Description of reference numerals: panel A in FIG. 7: subcellular localization analysis of SID 1. The SID1 protein is fused to Green Fluorescent Protein (GFP), the nuclear localization protein Ghd7 is fused to Cyan Fluorescent Protein (CFP), and both are co-transformed into rice protoplasts. The scale is 10 μm; panel B in fig. 7: and detecting the transcriptional activity of the SID1 truncated proteins with different lengths in the protoplast No. 11 of the flower in the wild rice variety. The SID1 truncated protein sequence is shown schematically on the left. The gray striped bar at the end of SID1N represents 4 zinc fingers. All luciferase activities were referenced to GAL4BD empty vector activity.

FIG. 8 construction of SID1Crispr mutants and late heading phenotype study. Description of reference numerals: panel A in FIG. 8: the non-conserved region located in the first exon of SID1 serves as the target site for the CRISPR-Cas9 system. PAM sequences are indicated by green letters, sgRNA targets are indicated by cyan letters; b diagram in fig. 8: and detecting potential mutation sites of T0 generation transgenic plants generated by CRISPR (clustered regularly interspaced short palindromic repeats) by CELI enzyme digestion. The red arrow represents the band of interest generated by CELI cleavage. Panel C in fig. 8: sequencing analysis of the mutation site. D1, deletion of 1 bp; d5, deletion of 5 bp; d7, deletion of 7 bp; graph D in fig. 8: heading-stage phenotype of wild-type plants and sid1 mutants under field long-day conditions. Red arrows represent ears of rice that have been pulled out; e diagram in fig. 8: statistical analysis of heading period of wild plants and sid1 mutants under long-day conditions of a field; graph F in fig. 8: the expression of Hd3a, RFT1, Ehd1, Hd1 genes in wild type and sid1 mutant plants was analyzed by qRT-PCR method. UBQ is used as internal reference. The average was taken from three biological replicates and each biological replicate contained two technical replicates. The Student's t test was used to analyze significant differences (. P < 0.05).

Detailed Description

Example 1: the SID 1gene has the function of restoring rid1 normal heading

1. Identification of rid1 inhibitory mutant sid1-D

The mutant identified by the invention is from RID1 background, 1 strain negative single strain with positive vector sequence detection and appearance of heading phenotype is obtained by over-expressing RID1 full-length cDNA, but no expression is detected by RID 1gene, the applicant names the mutant as rice mutant sid1-D (cloning of RID 1gene is already disclosed in published paper)And in the patent application, see Wu et al, Development of enhanced trace lines for functional analysis of the ricigenome, Plant J (2003): 418-427; zhang et al, Non-random distribution of T-DNAidentities at variance levels of the genome hierarchy as modified by analysis 13,804T-DNA warping sequences from a random enhancer-trap library, Plant J (2007): 947-; wu et al, RID1, encoding a Cys2/His2-type zinc finger translation factor, acts as a master switch from mobile to flow resolution in rice, Proc. Natl. Acad. Sci. USA (2008): 12915-12920; the patent names are: the clone and application of a gene RID1 for controlling the flowering conversion and heading stage of rice, patent application No.: 200810046989, respectively; publication No.: CN 101235378B). Acquisition of sid1-D mutant: the molecular switch gene RID1(Rice indicator 1) for controlling Rice flowering transition is cloned by utilizing a T-DNA tag method in the earlier stage of the subject group of the applicant, the RID 1gene encodes a transcription factor of a C2H2zinc finger structure, the transcription factor regulates the transition from vegetative growth to reproductive growth of Rice, and the molecular switch may be a grass plant conserved flowering molecular switch (Wu et al, RID1, encoding a Cys2/His2-type zinc finger transcription factor, acts as amaster switch from productive genetic transformation to flower Rice flower Rice. It was reported by Wu et al that insertion of T-DNA into the first intron of RID1 resulted in loss of RID1 function, thereby resulting in a never-heading phenotype; the non-heading phenotype of RID1 could be complemented by transferring the 5.7KB genomic region including the gene coding region and promoter region into RID1 mutant calli, suggesting that the non-heading phenotype of the RID1 mutant is indeed due to the mutation in RID1 gene. To verify whether the intron region of RID1 had an effect on the floral transformation of rice, applicants transferred the full-length cDNA of RID1 into RID1 mutant calli and observed the heading stage phenotype. Over-expression of the full-length cDNA of RID 1to obtain 80 independent transformed seedlings, and detection of the occurrence of the heading phenotype and the increase of the expression level of RID1 of 6 positive seedlings by using a primer KAN-F/R (KAN-F: CGGCGATACCGTAAAGCAC; KAN-R: ACTGAAGCGGGAAGGGACT) shows that the full-length cDNA of RID1 can start the transformation from the nutritional growth to the reproductive growth of rice. In the plant of the complementary transgene, 1 carrier primer is obtained and detected as positive and has the appearance of headingPhenotype, but no expression was detected in RID 1gene (#4), and this material was named sid1-D (dominant susceptors of RID1) (see Panel A in FIG. 1). The method comprises the steps of planting the sid1-D material T0 generation transgenic rice seeds in a field through conventional seed soaking and germination accelerating procedures (conventional methods) to obtain 200 plants, planting the plants in a test field of agriculture university in Wuhan Huazhong according to the interval of 5 inches multiplied by 8 inches (long-day condition, day length of 12-14 hours), and performing field management according to the conventional rice planting method. In the 200 sid1-D T1 segregating population, the heading and non-heading individuals show 3:1(143:57, chi)²＝1.13<3.84) segregation ratio (see panel B in FIG. 1), indicating that the mutant may result from a single-site dominant mutation; and the heading phenotype was co-segregating with the vector selection marker Kanamycin gene, thus we believe that the dominant mutation controlled by this single gene might co-segregate with the T-DNA insertion event. For this reason, applicants have conducted a more detailed phenotypic study of sid1-D material, with the heading periods for sid1-D and ZH11 being 88 days and 78 days, respectively, under natural long-day conditions; under the condition of artificially controlled short sunlight, the heading periods of sid1-D and ZH11 are 72 days and 58 days respectively; heading date for sid1-D and ZH11 were 101 days and 83 days, respectively, under artificially controlled long day conditions (see panel C in FIG. 1). The sid1-D is shown to be the phenotype reversion caused by dominant mutation, and the sid1-D dominant mutation can complement the rid1 non-heading phenotype.

2. Flanking sequence isolation of the site of insertion of sid1-D mutant T-DNA

The 3:1 segregation ratio of the single plant without the heading and the heading phenotype of the sid1-D T1 segregating population are assumed, and the heading phenotype is cosegregated with the gene of the carrier screening marker Kanamycin, so that it is assumed that the sid1-D heading phenotype is caused by a dominant mutation controlled by a single gene and cosegregated with the insertion of T-DNA, and the flanking sequence of the sid1-D material is isolated. Since the sequence of the Kanamycin gene could be detected in the sid1-D material, the applicants have designed 3 flanking sequence isolation primers in sequence using the Kanamycin gene sequence as a template, and isolated a flanking sequence from a flanking sequence of DNA fragment-fragment. The flanking sequences were found by sequence analysis to be located in the intergenic regions of rice chromosome 2, LOC _ Os02g45054 and LOC _ Os02g45070 (see Panel A in FIG. 2).

The flanking sequences of the T-DNA insertion site of the sid1-D mutant isolated by Tail-PCR technique were as follows:

CTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGGATCGATCCTCTAGCTAGAGTCGATCGACAAGCTCGAGTTTCTCCATAATAATGTGTGAGTAGTTCCCAGATAAGGGAATTAGGGTTCCTATAGGGTTTCGCTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGTATTTGTAAAATACTTCTATCAATAAAATTTCTAATTCCTAAAACCAAAATCCAGTACTAAAATCCAGATCCCCCGAATTAATTCGGCGTTAATTCAGTACATTAAAAACGTCCGCAATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATGTTCTACTAGTTCGTACATGCATGAGCATAGTAAAAAATTTGTCTCTCTTGCCCTTCACCGAGGCCCATTCTTCAAGTGTTCTGCATTGCGTCGAAATCATCCTTTAAGTCATATAACTGCTTGTCTCTGTGCCTAGATTTCTCATCATCTCACAGTAATAAGCATTTCAACATGAATCACTACTACAAAACCAGTTTGTACATACGGCTAGAATAGATTTTTTTTTTCATATATACATGCTGTTGGAGGGTCCGCCTATAACTTAAAAACCTATAAAAATAGTTGATTTTCACATATGGCTCGATCCACCGCCGTCTACAAAAATTGATTTGGGCGCGCCACCCAGTGAAAAGGCCAAGGTGAATCAAATCTTATGGCTTTGAACTCCTTGTTAA

3. co-isolation assay for T-DNA insertion and phenotype

To preliminarily determine that the spilt phenotype of sid1-D is due to T-DNA insertion, applicants conducted co-segregation testing of the mutant phenotype and T-DNA. Total DNA from rice mutant sid1-D plants was extracted as a template for PCR reaction by the CTAB method (see Liu et al, A genome-wide analysis of wide compatibility in edge and the location of the S5locus in the molecular map, the door Appl Genet (1997): 809 814). Determining an insertion site according to the matching condition of the flanking sequence of the T-DNA insertion site of the sid1-D mutant and the rice genome, and designing a pair of primers on two sides of the insertion site: p4(GGTGGGCCACTTCTAGCCGC) and P5(GTCCCCAGCTAGCGGCATGC), and a primer P6(GCTGACCGCTTCCTCGTGCTTT) designed on the T-DNA (FIG. 2A). Primers P4, P5 and P6 were used for the PCR reaction. The PCR reaction conditions were: 5min at 94 ℃; 30sec at 94 ℃, 45sec at 58 ℃, 1min at 72 ℃ and 35 cycles; 7min at 72 ℃; at 25 ℃ for 1 min. In the T1 generation separation population, only P4 and P6 pairs can amplify the target product when the T-DNA insertion site is pure, because P4 and P5 are on both sides of the inserted T-DNA segment, so that the amplification product of P4 and P5 pairs is too large (larger than 10kb) to obtain an amplified fragment; the wild type plant without T-DNA insertion has no T-DNA insertion, so that the P4 and P6 paired amplification has no product, but the primer P4 and P5 can be paired to obtain a target product; and the hybrid plants with the T-DNA insertion sites can be amplified to obtain products when P4 is matched with P5 and P4 is matched with P6. Thus, in the rid1 background, individuals homozygous and heterozygous for the T-DNA insertion site all exhibited the heading phenotype, and the remaining plants exhibited the non-heading phenotype, indicating that the heading phenotype of sid1-D cosegregates with the genotype (see panel B in FIG. 2). Further sequencing analysis of the inserted sequence by the applicant shows that only the 162bp sequence of the RID 13' UTR region and the Kanamycin sequence driven by the CaMV35S promoter are detected (see a picture A in figure 2), which indicates that the T-DNA structural region of the transformation vector is not completely transferred into the rice genome, and the reversion of the RID1 non-heading phenotype is not caused by the increase of the expression level of the RID 1gene and probably caused by the over-expression of the flanking gene of the inserted site. Thus, the applicant further examined the expression of 6 genes flanking the T-DNA insertion site, and compared with the rid1 mutant, the expression level of LOC _ Os02g45054(OsIDD4) was significantly increased in the sid1-D material background, while the expression levels of other flanking genes were not significantly different (see the C diagram in FIG. 2). The gene with accession number LOC _ Os02g45054(OsIDD4) may be a candidate gene for rid 1to restore heading. The gene is named as Suppressor of rid1(SID 1gene for short). The nucleotide sequence of the gene is shown as SEQ ID NO: 1 is shown.

4. RID1 normal heading is restored by over-expression of SID 1gene

Designing a primer SID1(G) -OX-F (K)/R (K), amplifying a target fragment (shown as A picture in figure 3, wherein the target fragment comprises 805bp promoter sequence, SID 1gene full length 8648bp, nucleotide sequence table SEQ ID NO: 1 shows 1-8648bp, coding region of the gene is a sequence shown as SEQ ID NO: 2 (sequence length 1848bp), 125bp 3 ' non-coding region) by using DNA of wild type rice variety ' Zhonghua 11 ' (from institute of crop science and research of Chinese academy of agricultural sciences) as a template, digesting the foreign fragment by using enzyme cutting site KpnI (KpnI purchased from Bo bioengineering GmbH Co) on a primer joint, connecting to an overexpression vector pU2301(pU2301 modified by the Chamber tour military company by using T4DNA ligase (T4DNA ligase purchased from Fermentas a particular using method and amount referring to the specification of the product of the company), referring to the marchantia, utilization of a rice mutant library, OsIRL gene family analysis and research on rice flowering mechanism, Wuhan: china agricultural university library (2009) [ doctor academic thesis ], http:// kns.cnki.net/KCMS/detail/detail.aspx? dbcode & dbname CDFD0911& filename 2010271706 nh & uid WEEvREcWSLJHDRa 1 FhdXNXJVUwwwa 2JvRTBSbDFob21Rb05KaFBlST0 $9A4hF _ YAuvQ5obgVAq NKPCYcEjKensW4ggI8Fm4gTkoUKaID8j8 gFw! | A Mjc3 NTdXTTFGckNVUkwyZlZplZHVGeS 9rVWI3SVYx MjZIckcvSDliTFaRWJQSVI 4ZVgxTHV4WVM3RGgXVDNxVHI), introducing the ligation product into Escherichia coli DH5a (purchased from Promega) by an electrotransformation method (the electrotransformation machine is a product of eppendorf company, the voltage used in the present invention is 1800V, the operation is referred to the instruction manual of the machine), adding 800. mu.l of LB medium for resuscitation for 45 minutes, taking 200. mu.l out and spreading on LA medium plates containing 50mg/L kanamycin, and culturing in an incubator at 37 ℃ for 14-16 hours (LA and LB formula are referred to the molecular cloning experimental guidance). The single clone is picked up, amplified and extracted, and the plasmid after positive clone screening, enzyme digestion verification and sequencing verification through PCR is named as pU2301-SID1 (the structure is shown in A picture in figure 3). The primer sequences used for constructing the SID1 overexpression vector are as follows (underlined sequences are enzyme cutting sites):

SID1(G)-OX-F(K):GGGGTACCGTAGAGTGTGGAAAGAAGGAAGCAAAAGGGGGAGA

SID1(G)-OX-R(K):GGGGTACCGAGGGTTAACTGAATGACTGAAAGAGGACAAAAAATAGAAAA

the constructed vector was electroporated into Agrobacterium (Agrobacterium tumefaciens) EHA105 (available from CAMBIA, http:// www.cambia.org/day/CAMBIA/materials/overview. html) strain, Agrobacterium-mediated genetic transformation method (Hiei et al, effective transformation of rice L.) was used to select a callus with G418 (available from Beijing plain Biotechnology Limited) by introducing the Agrobacterium strain containing the pU2301-SID1 vector into the callus with PCR-based red 1 mutant genotype background, infecting, co-culturing, screening out a callus with G418 (available from Beijing plain Biotechnology Limited) by the steps of differentiation and rooting, and synthesizing a lignin-mediated transformation reagent (available from Beijing patent No. 1) by using the Agrobacterium-mediated genetic transformation method (Plant J (1994: 271-282), application No.: 200610018105.5, respectively; publication No.: CN1995346) and transplanting the obtained transgenic seedling into a field to obtain SID1 over-expression plants in rid1 background. The empty vector pU2301(pU2301 was transformed by the present Mega-warrior, referred to the Progyo, the utilization of the rice mutant pool, OsIRL gene family analysis and the study of rice flowering mechanism, Wuhan: library of Huazhong university of agriculture, (2009) [ doctor's thesis ], http:// kns.cnki.net/KCMS/detail. aspx?dbcode?cdfd & dbname ═ CDFD0911& filename &. 2010271706.nh & uid wereeventsldldldldldldldlra 1 FhdXJXJVJVbidfob 21Rb05 KaFvST 0 ═ YAVvZyVvZvZvZvVvZyVvZvZvW 19!8was introduced into the transgenic tissue VvZvZvZvZvZvZvVvZvZvZvZvZvW 19!8, VvZvZvZvZvZvVvZvZvZvVvZvVvZvW 3.

The transgenic results show that the pU2301-SID1 strain is introduced into callus with rid1 mutant genotype background to finally obtain 81 strains of T0 generation complementary transgenic plants. When the transgenic families over-expressing SID1 were planted under summer field cultivation conditions in Wuhan City, Hubei province in 2012, the fid 1 restored the heading phenotype (see B diagram in FIG. 3 and C diagram in FIG. 3), and the heading stages of the transgenic plants were not completely consistent, and detailed heading stage data are shown in Table 1. Furthermore, 80 control transgenic plants were obtained by introducing callus of rid1 mutant genotype background with pU2301 empty vector, and the 80 control materials still maintained the non-heading mutant phenotype (see panel D in FIG. 3). And (3) recovering the filial generation of the heading plant, wherein the heading phenotype is completely coseparated with the SID1 transgene, namely, the heading of a positive single plant is performed, and the heading of a negative single plant is not performed. Therefore, the transgenic result shows that the SID 1gene regulates the flowering conversion of rice, and the non-heading phenotypic character of the rid1 mutant can be reversed by over-expressing the SID1 gene; meanwhile, the SID 1gene has the function of regulating the heading stage of rice.

TABLE 1 statistics table for heading period of different genotype plants

Example 2: SID1 encodes IDD protein with function of regulating heading stage of rice

1. SID1 protein is a new member of rice specific IDD protein family

The SID 1gene encodes a typical Cys-2/His-2 zinc finger protein transcription factor, contains three exons and two introns, has a gene coding region of 1848bp in length, encodes 615 amino acids (see A diagram in figure 4 and B diagram in figure 4), SID1 is a rice specific ID domain family member, and the evolutionary tree analysis shows that 15 ID domain proteins coexist in rice, SID1 and RID1 protein belong to different clades (see C diagram in figure 4), which indicates that SID1 protein is a newly identified IDD protein in rice, and the function of the protein is not reported yet.

2. The ID domain mutation of SID1 protein cannot reverse the rid1 non-heading phenotype

To further investigate whether the SID1 protein ID domain 4 zinc finger motif is essential for reverting to the rid1 spilt phenotype, applicants mutated the SID1 protein ID domain zinc finger motif by means of amino acid substitutions, i.e. replacing the conserved amino acid cysteine (Cys) with glycine (Gly). ZF1M (C97A, C100A), ZF2M (C139A, C144A), ZF3M (C174A, C177A), ZF4M (C201A, C203A) represent the first zinc finger motif (ZF1), the second zinc finger motif (ZF2), the third zinc finger motif (ZF3), the fourth zinc finger motif (ZF4) mutations in the ID domain of SID1 protein, respectively. Site-directed mutagenesis was performed by three PCR steps. First and second PCR amplifications were performed using SID1CDs as a template. First round of PCR, using the forward primer SID1(CDs) -OX-F and the reverse primer with mutation site (end of primer name R); second round PCR, using a forward primer with a mutation site (complementary to the first round PCR amplification reverse primer sequence, primer name end F) and reverse primer SID1(CDs) -OX-R amplification. Recovering and purifying the PCR amplification products of the first round and the second round, and using the mixture of the PCR amplification products as a template for the third round of PCR amplification, wherein the primer uses SID1(CDs) -OX-F/SID1(CDs) -OX-R. The third PCR amplified product fragment was digested with cleavage site KpnI-BamHI on primer linker, ligated to overexpression vector pU2301 treated with the same enzyme (pU2301 was modified by the present Venezuelan warrior, reference Venezuel, utilization of rice mutant library, OsIRL gene family analysis and study of rice flowering mechanism, Wuhan university of China library, (2009) [ doctor's thesis ], http:// kns.cnki.net/KCMS/detail/detail.aspx?dbcode ═ CDFD & dbname:. CDFD & dbnanme:. CDFD0911& enfilename 2010271706.nh & wecew:. WEcWsldRa 1 FhdXNXJVAwwwa QS 2 JvBSbDFob 21Rb KavFBL56355:. VvZFvZFvZFvZFvZFvZFvZFvZfQ 3:. fw 5:. VvZFvZFvZFvZfQ 19:. fw 3, VvZFvZFvZFvZFvZFvZFvZFvZfQ 19:. fw 5:. fw 19:, VvZFvZFvZFvZFvZFvZFvZFvZFvZFvZFvZFvZfQ 19:, FvZfQ # 3, FvZfQ # 19:. fw 5:. No. 5, VvZfZfZfZFvZFvZfZfZfZFvZFvZFvZFvZFvZfQ 3, VvZfQ # 19, FvZfZfZfZfZfZfZfQ. A fragment containing SID1 full-length CDS is obtained by using a full-length cDNA of SID1 as a template and amplifying SID1(CDs) -OX-F (K)/R (B), and the fragment is digested with a cleavage site KpnI-BamHI on a primer adaptor and is connected to a overexpression vector pU2301 treated by the same enzyme, so that a constructed vector is named pUBQ:SID 1(CDs) as a positive transgenic control. The primer sequences used for constructing the site-directed mutagenesis vector for SID1 are as follows (underlined sequences are cleavage or mutation sites):

SID1(CDs)-OX-F(K):GGGGTACCCCATGGCATCCAACTCATCAGCG

SID1(CDs)-OX-R(B):CGGGATCCCGTCATTGCATCCTGCCTCCGT

SID1-SM-ZF1-F：CCGGTTCGTGGCCGAGGTGGCCAACAAGGG

SID1-SM-ZF1-R：CCCTTGTTGGCCACCTCGGCCACGAACCGG

SID1-SM-ZF2-F：TACCTGGCCCCGGAGCCGACGGCCGTCCAC

SID1-SM-ZF2-R：GTGGACGGCCGTCGGCTCCGGGGCCAGGTA

SID1-SM-ZF3-F：GAAGTGGAAGGCCGACAAGGCCTCCAAGCG

SID1-SM-ZF3-R：CGCTTGGAGGCCTTGTCGGCCTTCCACTTC

SID1-SM-ZF4-F：CGAGTACCGCGCCGACGCCGGCACCCTCTT

SID1-SM-ZF4-R：AAGAGGGTGCCGGCGTCGGCGCGGTACTCG

the constructed vector is transformed into rid1 mutant callus to obtain an overexpression single strain with SID1zinc finger motif mutation in rid1 background, and whether SID1 protein after ID domain zinc finger motif mutation can enable rid 1to recover heading is observed (see A picture in figure 5). Heading period examination of transgenic T0 generation plants shows that the SID1 protein transgenic line excessively expressing the site-directed mutant ID domain zinc finger motif can not heading rid1, while a positive control plant transferred into pUBQ (SID1) (CDs) can reproduce the heading phenotype of SID1-D (see B picture in figure 5), which indicates that the SID1 protein ID domain zinc finger motif is necessary for recognizing and binding with downstream target genes, starting a flower transformation process and regulating the heading period of rice.

Example 3: SID 1gene is expressed in leaf blade, localized in nucleus, and has transcription activation activity

The invention firstly utilizes quantitative RT-PCR to analyze the expression pattern of SID1 gene. Total RNA extraction, reverse transcription and qRT-PCR reaction conditions in Plant (preferably Rice) tissues are described in the literature (Huang et al, Down-Regulation of aS ILENT INFORMATION Regulator2-Related Histone deacylase Gene, OsSRT1, IndustDNA Fragmentation and Cell Death in Rice, Plant physiology (2007): 1508 1519). Total RNA from rice was obtained from the "Zhonghua 11" plant of the wild-type rice variety planted under natural long-day conditions (see Panel A in FIG. 6). The specific method comprises the following steps: taking the rice with one leaf, two leaves, three leaves, immature leaves, roots, shoot tip tissues and leaf sheaths 35 days after germination to extract total RNA. The expression profile data shows that the expression level of the SID 1gene is higher mainly in mature leaves of rice (see B picture in figure 6). To further analyze the spatio-temporal expression pattern of the SID 1gene, the present invention constructed pSID1:: GUS vector and introduced the promoter vector into the wild type rice variety "flower 11" by Agrobacterium-mediated genetic transformation method (Hiei et al, effective transformation of rice (Oryza sativa L.), mediated by Agrobacterium and sequence analysis of the bases of the T-DNA, Plant J (1994): 271-282). The vector (pSID1:: GUS) was constructed as follows: a3 kb promoter region was amplified using the primers SID1-GUS-F (5'-CCCAAGCTTAGAACTCCATCCGGTCTCCTGTT-3') and SID1-GUS-R (5 '-AACTGCAGAAATAGCGGCTTAATCTGGTCCTC') using the "Zhonghua 11" DNA of rice variety as a template. The objective fragment was digested with restriction sites HindIII and PstI (restriction enzymes HindIII and PstI are available from Takara), and T4DNA ligase (T4DNA ligase is available from Fermentas, the detailed usage and dosage refer to the instructions of the product of this company) was used to ligate the foreign fragment to the same enzyme-treated pC2300-EX-GUS vector (Zhao et al, Tribenuron-Methyl indeces male sterility through genetic engineering of acetic acid synthesis to autophagell 1724), i.e., construction of the pSID1:: GUS promoter vector was completed. The constructed vector is used for transforming callus of 'Zhonghua No. 11' of a wild rice variety, a plurality of transgenic positive plants are randomly selected for GUS staining pattern analysis, GUS signals of the transgenic plants are specifically appeared in nutritive organs such as mature leaves, young leaves, leaf sheaths, root tips and the like, and the plurality of transgenic positive plants have the same expression pattern (see a C picture in figure 6 to a I picture in figure 6). The results show that the SID 1gene is mainly expressed in high abundance in leaves which receive optical signals, and indicate that the SID 1gene is involved in the regulation and control of rice heading stage.

In order to analyze the subcellular localization of the SID1 protein, the invention constructs a subcellular localization vector which is named as pM999-SID 1-GFP. The specific construction method of the subcellular localization vector comprises the following steps: a full-length CDs fragment of SID1 was PCR-amplified using DNA of rice variety "Zhonghua No. 11" as a template and primers SID1-pM999-F (5 'CGGAATTCATGGCATCCAACTCATCAGCGGCA') and SID1-pM999-R (5 'GGGGTACCTTGCATCCTGCCTCCGTTGAAGGAC'), and this target fragment was ligated to pM999-GFP (Xu et al, Differential expression of GS5 regulated grains in rice plant J Exp Bot (2015):2611-2623) vector after digestion with EcoRI and XbaI, and SID1 protein was fused with GFP reporter gene. The GFP-fused SID1 protein shares the same subcellular localization pattern as the CFP-fused nuclear protein Ghd7 (see Panel A in FIG. 7), indicating that the SID1 protein is a nuclear localization protein. SID1 transcriptional activity assays were performed in rice protoplasts using the DualLuciferase Reporter (DLR) assay system (Bart et al, A novel system for gene cloning using siRNAs in rice plants and step-derived dprotoplasts, Plant Methods (2006): 1-9). 3 pairs of primers SID1-LUC-F (B)/SID1-LUC-R (E), SID1-LUC-F (B)/SID1-LUC-N-R (E), SID1-LUC-F (B)/SID1-LUC-R (E) are designed to respectively amplify a full-length SID1 sequence, a C-terminal truncated SID1 sequence and an N-terminal truncated SID1 sequence, and are connected to a GAL4DB vector to be used as Effector proteins (Effector). The 5 tandem repeats of the GAL4 binding element precede the minor TATA box element of the LUC gene (35S-GAL4-LUC), and function as cis-activators (Reporter). The Ubi-Rennila LUC vector serves as an internal reference (GAL4DB, 35S-GAL4-LUC, Ubi-Rennila LUC vectors are provided by professor Chen' S institute of genetics and developmental biology, national academy of sciences of China) (Hao et al, Planta NAC-type transcription factor protein a NARD domain for expression of transcription activity, Planta (2010): 1033-1043). The vector combinations GAL4DB-SID1/35S-GAL4-LUC, GAL4DB-SID1-N/35S-GAL4-LUC, GAL4DB-SID1-C/35S-GAL4-LUC were transformed into rice variety "middle flower 11" protoplasts (see Zhang et al, A high yield rice green tissue promoter system for transformed gene expression and studled light/chloroplast-related processes, Plant Methods (2011): 1-14), respectively, and the protoplasts were collected by culturing at room temperature for 12-16 h. Relative Luciferase activity Assay fluorescence values were collected using the Dual-Luciferase Reporter Assay System kit (Promega), TECAN Infinite M200 multifunctional microplate reader. The results showed that the SID1 full-length protein had transcriptional activation activity and that the N-terminal transcriptional activation activity was the strongest relative to the empty vector control (see panel B in fig. 7). These results show that the SID 1gene has transcriptional activation activity, can activate the expression of downstream genes, and can effectively regulate the activation effect of SID1 on target genes by artificially changing the transcriptional activity, thereby influencing the heading stage of rice. The primers and sequences used for vector construction were as follows (underlined sequences are restriction sites):

SID1-LUC-F(B):CGGGATCCATGGCATCCAACTCATCAGCG

SID1-LUC-R(E):CGGAATTCTTGCATCCTGCCTCCGTTGA

SID1-LUC-N-R(E):CGGAATTCGAGGCTGAGCGCCATGTTG

SID1-LUC-C-F(B):CGGGATCCATGGCGCTCAGCCTCTCCC

example 4: site-directed mutation SID 1gene by using CRISPR-Cas system to regulate rice heading stage

In order to research the function of the SID 1gene, the present invention adopts CRISPR-Cas system (Feng et al, effective genome editing in plants using a CRISPR/Cas system, Cell Res (2013): 1229-1232) to perform site-directed mutation on SID1 gene. Applicants designed a gRNA site in the first exon near the ATG (34-43bp) non-conserved region (the standard target site recognition format is GN19NGG, where NGG is the PAM sequence required for protein binding to the genome and the first G of GN19 is the initiation signal required for transcription of small RNAs), circumventing off-target effects by online BLAST. Primers were synthesized by adding linker sequences (OsU6 promoter for the present system, where 5 '-GTGT-3' linker was added to the 5 'end of the upstream primer and 5' -AAAC-3 'linker was added to the 5' end of the downstream primer) for cloning to both ends of the sgRNA recognition sequence (not containing PAM sequence). The synthesized forward and reverse primers were annealed to form double-stranded nucleotides containing sticky end linkers, ligated into OsU6-SK intermediate vector. OsU6-SK (cloning target site exogenous fragment), 35S-Cas9-SK fragment was subcloned into pCAMBIA1300 vector (OsU6-SK, 35S-Cas9-SK, pCAMBIA1300 vector provided by the Proc. Zhu health professor of the research center for stress biology in Shanghai of Chinese academy of sciences) (Feng et al, effective genetic testing in plants using a CRISPR/Cas system, CellRes (2013): 1229-1232), correct recombinant storage strain was picked up for genetic transformation, transformation recipient was rice variety middle flower 11 (ZH11), transformation procedure was as described in example 1 section 4. Selecting a non-conserved region of the first exon of the SID 1gene as a target site of a CRISPR-Cas9 system to obtain 97 independent transgenic plants (see A picture in figure 8). PCR primers were designed to amplify the target region containing the target sequence, and CELI (Till et al, A protocol for TILLING and ecotelling in plants and animals, Nat protocol (2006): 2465 and 2477) was used to enzymatically detect T0 individuals with potential mutation sites (see FIG. 8, panel B). And further carrying out sequencing verification on the target site by using the single plant of the target band obtained by CELI enzyme digestion detection to obtain a mutant plant SID1 at the SID1 site. Sequencing results show that the target site region contains base deletion (1-7bp) of a small fragment, and mutants with deletion of 1bp (D1), 5bp (D5) and 7bp (D7) are selected for subsequent research (see a figure C in figure 8). The sid1 homozygous mutant plants were planted in the field under natural long-day conditions, with a heading date delayed from that of wild type (D1: 82.1. + -. 1.4 days; D5: 81.6. + -. 1.4 days; D7: 81.5. + -. 1.2 days; wild type: 79.2. + -. 1.3 days) (see FIG. 8, D, E in FIG. 8). These results indicate that SID1 is a flowering promoting factor under long day conditions. To further analyze the molecular mechanism of SID 1gene in regulating rice flowering, expression of flowering-related genes Hd3a, RFT1, Ehd1 and Hd1 was analyzed in SID1 mutant and wild-type plants. The expression analysis of heading stage-associated genes was as described in example 2. QRT-PCR results show that compared with the expression level of ZH11 of a wild plant, the expression levels of Hd3a and RFT1 in sid1 background are obviously inhibited under the conditions of long and short sunshine; the expression level of Ehd1 is partially suppressed under long-day conditions; the differences in the expression of the Hd 1gene were not significant (see FIG. 8, Panel F). Therefore, the applicant believes that the SID 1gene mainly influences the heading date of rice by regulating the expression of florigen genes Hd3a and RFT 1. The SID1gRNA vector sequence and detection primer sequence are as follows:

SID1-Cas-F：GTGTGCGTTGTTTGGAATTAGGGA

SID1-Cas-R：AAACTCCCTAATTCCAAACAACGC

SID1-CE-F TTCTTGCTTGAGTTTGTTATCG

SID1-CE-R TGAAACTCGCTCCAACCG

because rid1 mutant plants show a non-heading phenotype, rice plants overexpressing SID 1gene restore the flowering characteristics of rid1 mutant plants, which indicates that SID 1gene plays a role of molecular switch for flowering. In rid1 background, the heading date of transgenic plants over-expressing SID 1gene is not completely consistent; and the SID1 mutant material presents a late heading phenotype, which indicates that the SID 1gene has the function of regulating the heading stage of rice. Therefore, the SID 1gene can be ectopically expressed in a specific tissue part or a specific period in the rice by a plant genetic engineering technology, so that the purpose of regulating the heading stage of the rice and further improving the regional and seasonal adaptability of rice varieties can be achieved by regulating the space-time expression mode and the expression quantity of the SID1 gene.

SEQUENCE LISTING

<110> university of agriculture in Huazhong

<120> function and application of gene SID1 for regulating and controlling heading stage of rice

<130>

<141>2017-02-10

<160>3

<170>PatentIn version 3.1

<210>1

<211>8648

<212>DNA

<213> Rice (Oryza sativa)

<220>

<221>gene

<222>(1)..(8648)

<223>

<400>1

atggcatcca actcatcagc ggcagctgtg gcggcgttgt ttggaattag ggatggcgac 60

catgaggacc agattaagcc gctatttgcc cagcagcagc aacaccacca ccaccagcca 120

cctatggcgc catccaacgc cgcggcggcg gcttctgcgg cagggtcggc ggccggtcaa 180

gcggccgtgg cggcgccacc agcgaagaag aagagaacct taccaggtaa tccatgcaaa 240

gtttatccct ttttttttgt tcagtttcag actttcagtc atgcatgcat ggatgccagc 300

atagcattct tctatctcct tgctgatctt gtctcgattt atcggttgga gcgagtttca 360

attcctttgt tttagcatgc acaagaagac agctagctac tgctagcttg tccaagattc 420

acatggtttt tgtatcgatt ttaccgtgtt tgtctagtga ttttttttct tggttttgaa 480

atttttgatt cacatgcata atgtcttttt tggaagggat ttgtacgcta gcatagagtc 540

caagatttgg ttcccttgga tttaaattac atgaaatggt cctatatctt cttcggtttc 600

taatttctct ctcttctcta gcttggtcca atgaatttct tacgcacctg gattgtagtc 660

acccagcact acttcattta aagcttgtag tctcacctgg atgaatagta tagtcctcag 720

ttcaggtgaa ggtacaaagc acaaaatgat ttcttgtttt ttttttgttt ttttttctca 780

tatgtcatta taaatcagac ttatttttca gtagatagat tggttcccct aattatttct 840

ttaccgcagt aaagttcctt aattcaaata gacaatcacc atcatttaat catcaattaa 900

tcttagagat tttttgggca agattccatg tacgtgagct gttctcctct tcacccttgc 960

tggcctcttc ctttctctta ccaatcatga gagatgcaga tacgggccat gacatatgca 1020

cgagcaatgt caattcattt gttccctaca tgcctcttgc tgcaaaatta attctctttt 1080

gccccccccc cctccttcat aatctcgtgc aaatattctc tttttgcctt aatttgtccc 1140

tggctactaa aatcaaaagg aaaaaaaatc actactcccc attacaaatc atccttgcat 1200

gcctaaccga tcttcatcac cataaatcta ctccgattgg gaaattcttt cgtgttaaga 1260

aacatgcatg cgtttgtcat catcagccac actgcaattt ggttttgtca tcagtagtgc 1320

ggcaagctgt actccttatt tctctctctt ctaatcccca cataatgtta aaaccaccgt 1380

gcatctatat ctatatatcg atctaaatta accattcaca tatatgcatc taatatttat 1440

gttgaactaa cattttgatc aggtagtgca gcgcatgcat atgtatatac tcctatcttc 1500

taattaatac tactttgcac tagtactaat aagctgtact tgcatgcatt gcatgcgcag 1560

acccggacgc ggaggtgata gcgctgtcgc cgaagacgct gctggcgacg aaccggttcg 1620

tgtgcgaggt gtgcaacaag gggttccagc gggagcagaa cctgcagctg caccggcgcg 1680

ggcacaacct gccgtggaag ctgaagcaga agaacccgct gcaggcgcag cgccgccggg 1740

tgtacctgtg cccggagccg acgtgcgtcc accacgaccc ctcccgcgcc ctcggcgacc 1800

tcaccggcat caagaagcac ttctgccgca agcacggcga gaagaagtgg aagtgcgaca 1860

agtgctccaa gcgctacgcc gtccagtccg actggaaggc ccactccaag atctgcggca 1920

cccgcgagta ccgctgcgac tgcggcaccc tcttctcccg gtaagcccac actctaccca 1980

tctctctact acgtatatat gtatggtgtt tttcgcagct tgatttctcc atctgcatga 2040

gacgttgcat gtgtgtgcgt gctagctagc gaagaatgtt tagtagtgtg cgcacaaaaa 2100

tggcagcatg cacgttcggc cggggttagg gttttgtctg ggtggtatag tgtagtactt 2160

taactaatct gttcacgagg gttaatggct agtgggagga gaagaattat cgatgtcgta 2220

cacacgtgta cgtaccgcgt ggtctgcagg atgcatatgc atatgtatgg gcgaagagca 2280

ttagggctac tgctcgcacg tgatcttgcc attgtcttgc tgatgcaaat gtttccaagc 2340

gttcttgtgc tggcatgcat cgtcgtcaag cctggctgaa aaggcctccc gtctcttcct 2400

catgctatat atattacaag tcacacaaat aaacgcgata tgtttatata tgtgtgcgcg 2460

tgtgttatac tgattcatgg ccccaattcg ggatcgatat gcccggaacg tcgacagcta 2520

gctagcacat tcttaattcg ttgggctgtc tgtctattca tcagacaact gaattttgaa 2580

atatctaagc ggtcagaatt attccaagat ccgtgcaata actatatata tatatatata 2640

tacatatgta agagcatgac caacagttct ctaaatgtta ataattaaat atacactgta 2700

agacactctc ctacagtttt ttccttaaaa aaagacaatg ctcctaaata aaatccaacc 2760

ataaaaagat gggtttttct atgaaaatta ggatccaaca attcccatgt agagatgata 2820

aaaaaaattt agcatcccca actccgtttt tatcgttctc cacatctagg gaatggcaca 2880

cccaaaaaac tgatcatgcg tgggatgaga gctatcgaga tagcggcatg gaaggtgggc 2940

gagggagatc gcccatgagg agagaagggc ccctttttat tttaggaaat taagtttaga 3000

ctatctgtta tagagatcaa ggtatatttt atatccttaa attcttatta gagatttcaa 3060

ataagatatt tattagagga gaatattgga catttgttgg ggatgcaata aaccacttcg 3120

atgcccggaa tcctgatcca tctctcgcct ccgctagctc ttcgatcgat ctccacctta 3180

ttggaaggcg ccagaaattc cagctagttg tcctctccat atcaaatcct ccatccacac 3240

catagcgtta ttattggggt atatatagct tcatctatga tatacagctc atgcagctga 3300

agttcggatg tcgctggtgc caagagggct taccaatgaa gtcactagtg atgttcttag 3360

tgagtcatcc tgttgcctcc ctctcttcct cgcacctctc tcggtcggct agaggtagaa 3420

gatgcttgcc acttgtcgaa tcgtcggatc aagatcttca tagatcaatt ggccaagatt 3480

taagaaacaa aatcccagtg gactagtaaa tagaaaaatt gtcgtccata tatataaaaa 3540

tataattaaa caagcttata tgtgtggcac tacacgtctg cactatattt ttattttaat 3600

gaatcagcga gccgtcaatt ttattgaata tagaaggagt aaattgtaca aaagaaatga3660

gctgtacacg tctgcattat acacccccat atgatcgtaa ttggctaatc tgttttgagc 3720

tgccatatag aagagtatgg atatatatag tctttcgctg tgtatatcca cccgtggatt 3780

gagccgactt tctatttata tctaaaaata atataatgca aactataact tatatcatgc 3840

agaatatgat atgtgaatgt gtgtgagctg gccggctaga tagatgtgcg gtgcagggcc 3900

tttcgttggc cttacgtgtc agaagagcct gtggttcacg cttcacacgg cttagatttc 3960

cctcggatac atgcatactc cgatccaggc ccttacatct gatctcacga gtcacatggg 4020

tgcaacttcg cttgctagca gcagtgtcac gcatactgca gactctctct ctctctctct 4080

ctctctctct ctctctctct ctctctctct ctctctctcc agaatagcag caagtgttca 4140

cccctatctt tcacaactcg agcattttcc tctctggctt catggcatga cctctgcatg 4200

cagagttctt agcatcaata attttgatgc aatgggggcc tagccctata tatatgtgta 4260

ggcttttgta gttttgcatg tgttttttca tccatatata ttcttgttgg atcacccttt 4320

ggttccttgg aaaatgagct ttttacaaag tcttctcatg tctccgggcg agttggcgtg 4380

tgcgtgtgct actgctctct accatggcga tgtccaatat gtctactact agtactagct 4440

agtagtagaa tttcttttcc cagccctttc tccttggaag cttcttgcac catatatatt 4500

aattaagaac ctatatatat cggtgacgcc atgctatatc aatctgccta ctcttttcct 4560

cgttttcatc cctgattgac atgagtttct gggatctcga gcttcaattg agtgtgatag 4620

aagtcaagtg atgaaacgaa caggttttag tcaaccccac acttgaaaac atgtagaatc 4680

actggtagat ttagattttt tttctaaaaa aaagatttat aattttttaa agtacatgca 4740

aacacaagta cgaacaatta tatatcaatg ttattgaaca cttcaaatac aagacattat 4800

aaaaatgtga ttcattgaca accctgggtg gcctaggagc tacccggggt cgctaggcat 4860

ttatctgcac cttggtagaa gttgtacata ttttgagcct ttaaaggtca ttctaaaata 4920

agaaggtcat tgccctcctt ttgcgtgtcg cttacataat caataaaaca ttaataacgt 4980

atattgggtt gtcatatagt taccctacaa atatgtatgt tcaaacttaa tttgaacaag 5040

tgggaaaaaa tataactgcg ggaaatacac acacacacta ctttaatttc atagttaatt 5100

aggtttgttt tttctttgat gtaaatgaat ttggtcgtgg atgtctgtac agtaatacat 5160

gcatgtgacg gcataatcta tatggccaaa tcttgttagc ttataactat ttagatttca 5220

tacatgaaac gagggcgcgc acgacacaca ttcttgattt aatatagctt aaaatacttc 5280

tcccaagatt ttttttttcg gaatactaac agtaggagtt gttacacgca atagataaaa 5340

ttcacttact tgtagaagaa agaattaaag atatttcaac gatagtatat cacacagttc 5400

tactgtttag acgaccatta tttctcgtac ccacctcaag tcatacgcac agtgtacaca 5460

cattcatgca tccttgccaa ttactgtact agctagtact ccagcttgta actttttccg 5520

tacaaatata tggtcgtcct gtgtatggaa cttggaatct tatcggttca aggcaagaat 5580

ggaacgtacg tactacgtct cctaaaagat gcaaatatat aattcttgaa tacacattgc 5640

atctaattat tatagtgctt ttttgcatgg atttctgtac tgttgtgctt aacatgcaat 5700

tgattagaga aaaataatca ttttctcggg agtggatttt aaactctcga gaggatatcc 5760

cctcgttatt tgcatgcaat tcaaatagtt acgaaaaaaa tctaaataaa atatgagaag 5820

atgtattaat atgtgatata tcgctccaca aacatgcaag ttaaaattca acttttacat 5880

gtcgtaacga aaaaaaataa atttaaccat gaatatgcat taactagcta taatttaatt 5940

ttttttcgtt gtgagatata gaagtcgaat ttgagcttca tgtttgtgga gtgatatatc 6000

ccatattaat atatcttttc atttttttaa aaaaaacaac tagactattt gagtgacatg 6060

caaacaatta tgggacatcc ttctaagagt ttagaataaa aatactattt tctcaactct 6120

ctttgagagt ttgaggagag ggggattgag aagattggga agatacacaa aacgaggtga 6180

gctattagcg catgattaat tgagtattaa ctattttaaa ttttaaaaat ggattaatat 6240

gattttttaa agcaactttc ctataaaaaa tttttacaaa aaatacaccg tctagtagtt 6300

tgggaagcgt gcacgcggaa tacgatgtcc ttttctcacc caatccccca gaactcatca 6360

caaagaacgc agccttagtt gttagtatcg atatgatcaa tgccttcttt ccaatatata 6420

gtaaactagt cgatacaccg ctttttgctg cggaatatgt cgatgaatgc atgttatata 6480

tcatagaaat ggtaatgtat atgtttaaat aatgtaaaaa taatgtggag atattgattt 6540

gacattgttt gcatattgag ttctaaaaat acaacaaaat tgtataagtc ttttgttttt 6600

ttctagtcaa cttatttaat tttgaccaag tttatagaaa aatataatag tatttaaaaa 6660

ataaacatat tattagaata tatcaaatgt tagatttaat aaaattaatt tgatatttta 6720

gatgtcgcta aatttttcta tacatttaaa agaaattgac gagggaaaaa aaatcaaata 6780

acttaccgta taaaatagag agagtactac tacatttgca cggatgacac agcaaaaatt 6840

ttgcatctag ctgtctagct gatgagcacc acttcacgtg atttctgtat cagtacccga 6900

tactgtagtg acatgcactg tccttcgagt tatcttcact tttgcgtcgt acaatttcac 6960

gtgcaaactt gtgccgcacg gacagtgatc agtttgatgg tacatcgcat gtgtccgtcg 7020

tcgtccatgc aaatgcagga gggacagctt catcacccac cgcgccttct gcgacgccct 7080

cgcccaggag agcgcgcggc tgccacccgc cgccgccggc cacctctacg gctccgccgg 7140

cgccgccaac atggcgctca gcctctccca ggtcggctcc cacctcgcct ccaccctcca 7200

ggaccacggc caccaccacc accatcacgg cgcctccccg gacctcctcc gcttcggcgg 7260

cagcggcggt ggcgccatgg ctgcacgcct cgagcacctc ctgtcgtcgt ccagcgcctc 7320

cgcgttccgg cccctgccgc cgccgcagca gcagcctccg gcgccgttcc tcctcggcgc 7380

ggcgccgcag gggttcggcg acggcggcga cggcagtggt ccgcacggat tcttgcaggg 7440

taagccgttc catggcctca tgcagctccc tgacctccaa gggaatggca ccggcgggcc 7500

gtcgccgtcg ggtccgggtc tctacaacct cggctacatc gccaacagcg cgaacagctc 7560

gggtacttcc agccatggcc acgcgagcca gggacagatg acgaacaccg accagttcag 7620

cgaaggaggg ggtggtggcg gcggcggcgg cggttcagag acatcggcgg cggcgctgtt 7680

cggcgccggt gggaacttct ccggcggcga ccaccaccag gtttctcctg ccgggatgta 7740

cgcgaatgat caggccatga tgctgccgca gatgtcggcg accgcgctgc tccagaaggc 7800

ggcgcagatg ggctcgagca cgtcgagcgc gaacggcgcc ggcgcgtccg tgttcggcgg 7860

cggcttcgcc ggctcgtcgg cgccgtcgtc catcccgcac ggccgcggga cgaccatggt 7920

cgaccagggg cagatgcacc tccagagcct gatgaactcg ctcgccggcg gtggcaacgc 7980

cgaccaccag ggcatgtttg ggagtggcag catgattgac ccgaggctgt acgacatgga 8040

ccagcacgag gtgaagttca gcctgcagcg cggcggcggc ggcggcggcg acggcgacgt 8100

gacgcgtgac ttcctcggcg tcggcggcgg cggtttcatg agggggatgt cgatggcgag 8160

aggggagcac catggcggtg gcggcagcga catgcatggc accttggagg ccgagatgaa 8220

gtcggcgtcg tcgtccttca acggaggcag gatgcaatga tctcttaagc atatatacgt 8280

ggcacgttgg catcaacatg catggcagga ataagttgtt gatttgcagg ttgcaataca 8340

atgctgtgac ttgtgacaca tgtgatagat gtttttgcat gcatccatgc aaaaggataa 8400

agccagcttt gatgatgata caatcttagc gagagacatg gtgagcagaa gagcttctcc 8460

tagactccta ctaatgcatg atgaagctag atcaacagga atcatgagac ttgagctgaa 8520

gttaggcgtt attactgcaa tatactattc tgttcctgat agatcttatt gctaaatttc 8580

atttgaaaga ataggtcttg ctaaatgtaa ttgggttaat tgtactggat cagggataac 8640

tgcaatga 8648

<210>2

<211>1848

<212>DNA

<213> Rice (Oryza sativa)

<220>

<221>CDS

<222>(1)..(1848)

<223>

<220>

<221>gene

<222>(1)..(1848)

<223>

<400>2

atg gca tcc aac tca tca gcg gca gct gtg gcg gcg ttg ttt gga att 48

Met Ala Ser Asn Ser Ser Ala Ala Ala Val Ala Ala Leu Phe Gly Ile

1 5 10 15

agg gat ggc gac cat gag gac cag att aag ccg cta ttt gcc cag cag 96

Arg Asp Gly Asp His Glu Asp Gln Ile Lys Pro Leu Phe Ala Gln Gln

20 25 30

cag caa cac cac cac cac cag cca cct atg gcg cca tcc aac gcc gcg 144

Gln Gln His His His His Gln Pro Pro Met Ala Pro Ser Asn Ala Ala

35 40 45

gcg gcg gct tct gcg gca ggg tcg gcg gcc ggt caa gcg gcc gtg gcg 192

Ala Ala Ala Ser Ala Ala Gly Ser Ala Ala Gly Gln Ala Ala Val Ala

50 55 60

gcg cca cca gcg aag aag aag aga acc tta cca gac ccg gac gcg gag 240

Ala Pro Pro Ala Lys Lys Lys Arg Thr Leu Pro Asp Pro Asp Ala Glu

65 70 75 80

gtg ata gcg ctg tcg ccg aag acg ctg ctg gcg acg aac cgg ttc gtg 288

Val Ile Ala Leu Ser Pro Lys Thr Leu Leu Ala Thr Asn Arg Phe Val

85 90 95

tgc gag gtg tgc aac aag ggg ttc cag cgg gag cag aac ctg cag ctg 336

Cys Glu Val Cys Asn Lys Gly Phe GlnArg Glu Gln Asn Leu Gln Leu

100 105 110

cac cgg cgc ggg cac aac ctg ccg tgg aag ctg aag cag aag aac ccg 384

His Arg Arg Gly His Asn Leu Pro Trp Lys Leu Lys Gln Lys Asn Pro

115 120 125

ctg cag gcg cag cgc cgc cgg gtg tac ctg tgc ccg gag ccg acg tgc 432

Leu Gln Ala Gln Arg Arg Arg Val Tyr Leu Cys Pro Glu Pro Thr Cys

130 135 140

gtc cac cac gac ccc tcc cgc gcc ctc ggc gac ctc acc ggc atc aag 480

Val His His Asp Pro Ser Arg Ala Leu Gly Asp Leu Thr Gly Ile Lys

145 150 155 160

aag cac ttc tgc cgc aag cac ggc gag aag aag tgg aag tgc gac aag 528

Lys His Phe Cys Arg Lys His Gly Glu Lys Lys Trp Lys Cys Asp Lys

165 170 175

tgc tcc aag cgc tac gcc gtc cag tcc gac tgg aag gcc cac tcc aag 576

Cys Ser Lys Arg Tyr Ala Val Gln Ser Asp Trp Lys Ala His Ser Lys

180 185 190

atc tgc ggc acc cgc gag tac cgc tgc gac tgc ggc acc ctc ttc tcc 624

Ile Cys Gly Thr Arg Glu Tyr Arg Cys Asp Cys Gly Thr Leu Phe Ser

195 200 205

cgg agg gac agc ttc atc acc cac cgc gcc ttc tgc gac gcc ctc gcc 672

Arg Arg Asp Ser Phe Ile Thr His Arg Ala Phe Cys Asp Ala Leu Ala

210 215 220

cag gag agc gcg cgg ctg cca ccc gcc gcc gcc ggc cac ctc tac ggc 720

Gln Glu Ser Ala Arg Leu Pro Pro Ala Ala Ala Gly His Leu Tyr Gly

225 230 235 240

tcc gcc ggc gcc gcc aac atg gcg ctc agc ctc tcc cag gtc ggc tcc 768

Ser Ala Gly Ala Ala Asn Met Ala Leu Ser Leu Ser Gln Val Gly Ser

245 250 255

cac ctc gcc tcc acc ctc cag gac cac ggc cac cac cac cac cat cac 816

His Leu Ala Ser Thr Leu Gln Asp His Gly His His His His His His

260 265 270

ggc gcc tcc ccg gac ctc ctc cgc ttc ggc ggc agc ggc ggt ggc gcc 864

Gly Ala Ser Pro Asp Leu Leu Arg Phe Gly Gly Ser Gly Gly Gly Ala

275 280 285

atg gct gca cgc ctc gag cac ctc ctg tcg tcg tcc agc gcc tcc gcg 912

Met Ala Ala Arg Leu Glu His Leu Leu Ser Ser Ser Ser Ala Ser Ala

290 295 300

ttc cgg ccc ctg ccg ccg ccg cag cag cag cct ccg gcg ccg ttc ctc 960

Phe Arg Pro Leu Pro Pro Pro Gln Gln Gln Pro Pro Ala Pro Phe Leu

305 310 315 320

ctc ggc gcg gcg ccg cag ggg ttc ggc gac ggc ggc gac ggc agt ggt 1008

Leu Gly Ala Ala Pro Gln Gly Phe Gly Asp Gly Gly Asp Gly Ser Gly

325 330 335

ccg cac gga ttc ttg cag ggt aag ccg ttc cat ggc ctc atg cag ctc 1056

Pro His Gly Phe Leu Gln Gly Lys Pro Phe His Gly Leu Met Gln Leu

340 345 350

cct gac ctc caa ggg aat ggc acc ggc ggg ccg tcg ccg tcg ggt ccg 1104

Pro Asp Leu Gln Gly Asn Gly Thr Gly Gly Pro Ser Pro Ser Gly Pro

355 360 365

ggt ctc tac aac ctc ggc tac atc gcc aac agc gcg aac agc tcg ggt 1152

Gly Leu Tyr Asn Leu Gly Tyr Ile Ala Asn Ser Ala Asn Ser Ser Gly

370 375 380

act tcc agc cat ggc cac gcg agc cag gga cag atg acg aac acc gac 1200

Thr Ser Ser His Gly His Ala Ser Gln Gly Gln Met Thr Asn Thr Asp

385 390 395 400

cag ttc agc gaa gga ggg ggt ggt ggc ggc ggc ggc ggc ggt tca gag 1248

Gln Phe Ser Glu Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Ser Glu

405 410 415

acatcg gcg gcg gcg ctg ttc ggc gcc ggt ggg aac ttc tcc ggc ggc 1296

Thr Ser Ala Ala Ala Leu Phe Gly Ala Gly Gly Asn Phe Ser Gly Gly

420 425 430

gac cac cac cag gtt tct cct gcc ggg atg tac gcg aat gat cag gcc 1344

Asp His His Gln Val Ser Pro Ala Gly Met Tyr Ala Asn Asp Gln Ala

435 440 445

atg atg ctg ccg cag atg tcg gcg acc gcg ctg ctc cag aag gcg gcg 1392

Met Met Leu Pro Gln Met Ser Ala Thr Ala Leu Leu Gln Lys Ala Ala

450 455 460

cag atg ggc tcg agc acg tcg agc gcg aac ggc gcc ggc gcg tcc gtg 1440

Gln Met Gly Ser Ser Thr Ser Ser Ala Asn Gly Ala Gly Ala Ser Val

465 470 475 480

ttc ggc ggc ggc ttc gcc ggc tcg tcg gcg ccg tcg tcc atc ccg cac 1488

Phe Gly Gly Gly Phe Ala Gly Ser Ser Ala Pro Ser Ser Ile Pro His

485 490 495

ggc cgc ggg acg acc atg gtc gac cag ggg cag atg cac ctc cag agc 1536

Gly Arg Gly Thr Thr Met Val Asp Gln Gly Gln Met His Leu Gln Ser

500 505 510

ctg atg aac tcg ctc gcc ggc ggt ggc aac gcc gac cac cag ggc atg 1584

Leu Met Asn Ser Leu Ala Gly Gly Gly Asn Ala Asp HisGln Gly Met

515 520 525

ttt ggg agt ggc agc atg att gac ccg agg ctg tac gac atg gac cag 1632

Phe Gly Ser Gly Ser Met Ile Asp Pro Arg Leu Tyr Asp Met Asp Gln

530 535 540

cac gag gtg aag ttc agc ctg cag cgc ggc ggc ggc ggc ggc ggc gac 1680

His Glu Val Lys Phe Ser Leu Gln Arg Gly Gly Gly Gly Gly Gly Asp

545 550 555 560

ggc gac gtg acg cgt gac ttc ctc ggc gtc ggc ggc ggc ggt ttc atg 1728

Gly Asp Val Thr Arg Asp Phe Leu Gly Val Gly Gly Gly Gly Phe Met

565 570 575

agg ggg atg tcg atg gcg aga ggg gag cac cat ggc ggt ggc ggc agc 1776

Arg Gly Met Ser Met Ala Arg Gly Glu His His Gly Gly Gly Gly Ser

580 585 590

gac atg cat ggc acc ttg gag gcc gag atg aag tcg gcg tcg tcg tcc 1824

Asp Met His Gly Thr Leu Glu Ala Glu Met Lys Ser Ala Ser Ser Ser

595 600 605

ttc aac gga ggc agg atg caa tga 1848

Phe Asn Gly Gly Arg Met Gln

610 615

<210>3

<211>615

<212>PRT

<213> Rice (Oryza sativa)

<400>3

Met Ala Ser Asn Ser Ser Ala Ala Ala Val Ala Ala Leu Phe Gly Ile

1 5 10 15

Arg Asp Gly Asp His Glu Asp Gln Ile Lys Pro Leu Phe Ala Gln Gln

20 25 30

Gln Gln His His His His Gln Pro Pro Met Ala Pro Ser Asn Ala Ala

35 40 45

Ala Ala Ala Ser Ala Ala Gly Ser Ala Ala Gly Gln Ala Ala Val Ala

50 55 60

Ala Pro Pro Ala Lys Lys Lys Arg Thr Leu Pro Asp Pro Asp Ala Glu

65 70 75 80

Val Ile Ala Leu Ser Pro Lys Thr Leu Leu Ala Thr Asn Arg Phe Val

85 90 95

Cys Glu Val Cys Asn Lys Gly Phe Gln Arg Glu Gln Asn Leu Gln Leu

100 105 110

His Arg Arg Gly His Asn Leu Pro Trp Lys Leu Lys Gln Lys Asn Pro

115 120 125

Leu Gln Ala Gln Arg Arg Arg Val Tyr Leu Cys Pro Glu Pro Thr Cys

130 135 140

Val His His Asp Pro Ser Arg Ala Leu Gly Asp Leu Thr Gly Ile Lys

145 150 155 160

Lys His Phe Cys Arg Lys His Gly Glu Lys Lys Trp Lys Cys Asp Lys

165 170 175

Cys Ser Lys Arg Tyr Ala Val Gln Ser Asp Trp Lys Ala His Ser Lys

180 185 190

Ile Cys Gly Thr Arg Glu Tyr Arg Cys Asp Cys Gly Thr Leu Phe Ser

195 200 205

Arg Arg Asp Ser Phe Ile Thr His Arg Ala Phe Cys Asp Ala Leu Ala

210 215 220

Gln Glu Ser Ala Arg Leu Pro Pro Ala Ala Ala Gly His Leu Tyr Gly

225 230 235 240

Ser Ala Gly Ala Ala Asn Met Ala Leu Ser Leu Ser Gln Val Gly Ser

245 250 255

His Leu Ala Ser Thr Leu Gln Asp His Gly His His His His His His

260 265 270

Gly Ala Ser Pro Asp Leu Leu Arg Phe Gly Gly Ser Gly Gly Gly Ala

275 280 285

Met Ala Ala Arg Leu Glu His Leu Leu Ser Ser Ser Ser Ala Ser Ala

290 295 300

Phe Arg Pro Leu Pro Pro Pro Gln Gln Gln Pro Pro Ala Pro Phe Leu

305 310 315 320

Leu Gly Ala Ala Pro Gln Gly Phe Gly Asp Gly Gly Asp Gly Ser Gly

325 330 335

Pro His Gly Phe Leu Gln Gly Lys Pro Phe His Gly Leu Met Gln Leu

340 345 350

Pro Asp Leu Gln Gly Asn Gly Thr Gly Gly Pro Ser Pro Ser Gly Pro

355 360 365

Gly Leu Tyr Asn Leu Gly Tyr Ile Ala Asn Ser Ala Asn Ser Ser Gly

370 375 380

Thr Ser Ser His Gly His Ala Ser Gln Gly Gln Met Thr Asn Thr Asp

385 390 395 400

Gln Phe Ser Glu Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Ser Glu

405 410 415

Thr Ser Ala Ala Ala Leu Phe Gly Ala Gly Gly Asn Phe Ser Gly Gly

420 425 430

Asp His His Gln Val Ser Pro Ala Gly Met Tyr Ala Asn Asp Gln Ala

435 440 445

Met Met Leu Pro Gln Met Ser Ala Thr Ala Leu Leu Gln Lys Ala Ala

450 455 460

Gln Met Gly Ser Ser Thr Ser Ser Ala Asn Gly Ala Gly Ala Ser Val

465 470 475 480

Phe Gly Gly Gly Phe Ala Gly Ser Ser Ala Pro Ser Ser Ile Pro His

485 490 495

Gly Arg Gly Thr Thr Met Val Asp Gln Gly Gln Met His Leu Gln Ser

500 505 510

Leu Met Asn Ser Leu Ala Gly Gly Gly Asn Ala Asp His Gln Gly Met

515 520 525

Phe Gly Ser Gly Ser Met Ile Asp Pro Arg Leu Tyr Asp Met Asp Gln

530 535 540

His Glu Val Lys Phe Ser Leu Gln Arg Gly Gly Gly Gly Gly Gly Asp

545 550 555 560

Gly Asp Val Thr Arg Asp Phe Leu Gly Val Gly Gly Gly Gly Phe Met

565 570 575

Arg Gly Met Ser Met Ala Arg Gly Glu His His Gly Gly Gly Gly Ser

580 585 590

Asp Met His Gly Thr Leu Glu Ala Glu Met Lys Ser Ala Ser Ser Ser

595 600 605

Phe Asn Gly Gly Arg Met Gln

610 615

Claims (1)

1. The application of the rice gene SID1 in regulation and control of the heading stage of rice is characterized in that the nucleotide sequence of the gene is shown in a sequence table SEQ ID NO: 1 is shown.

Images