CN108424963A

CN108424963A - Circ_0079591 is diagnosed as URSA in serum and pregnancy outcome assesses the application of marker

Info

Publication number: CN108424963A
Application number: CN201810602718.6A
Authority: CN
Inventors: 李霞; 王彬; 赵霖; 张华�; 张云虹; 尹训强; 魏然; 张振; 朱肖肖; 郭强
Original assignee: INSTITUTE OF BASIC MEDICINE SAMS
Current assignee: INSTITUTE OF BASIC MEDICINE, SAMS; Shandong University of Traditional Chinese Medicine
Priority date: 2018-06-12
Filing date: 2018-06-12
Publication date: 2018-08-21
Anticipated expiration: 2038-06-12
Also published as: CN108424963B

Abstract

The invention discloses circ_0079591 in serum as URSA diagnosis and the application of pregnancy outcome's assessment marker, and diagnosis and pregnancy outcome assess marker using circ_0079591 as URSA, develop corresponding detection kit, the kit detection sensitivity is high, specificity is high, easy to detect, meet the detection demand of diagnosis patient URSA, accuracy rate of diagnosis is high according to clinical verification.

Description

Circ_0079591 is diagnosed as URSA in serum and pregnancy outcome assesses marker Using

Technical field

The invention belongs to biomedical sectors, and in particular to circ_0079591 is as unexplained recurrent in serum Spontaneous abortion (URSA) diagnoses and the application of pregnancy outcome's assessment marker.

Background technology

Spontaneous abortion recurs 2 times or 2 times referred above to recurrent miscarriage (recurrent spontaneous Abortion, RSA), incidence is about the 1%~5% of the women of child-bearing age, and the cause of disease is complicated, except a small number of chromosomes, endocrine, solution It cuts open, infect etc. outside factors, about 80% etiology unknown, referred to as unexplained recurrent spontaneous abortion (unexplained recurrent Spontaneous abortion, URSA).URSA serious harm women of child-bearing age's healthy reproductions, but current still shortage high specificity, The good biological indicator of high sensitivity, stability, clinical intervention treatment there is no clearly unified standard, gestation can not be effectively predicted Final result.Therefore, at present it is necessary to seek the marker of new effective URSA clinical diagnosises, treatment and prognosis detection, to diagnose, It treats URSA and research and development related drugs provides foundation.

Circular rna (circular RNA, circRNA) is in closed hoop, is a kind of last without the ends 5' cap and 3' The special endogenous non-coding RNA for holding tail, is mainly made of exon transcription product, and minority derives from introne or introne Segment is the new hot spot of current RNA research fields.CircRNA is present in a variety of eucaryotes, at different groups of same organism It is also widely present in knitting；Most circRNA have highly conserved sequence, only a small number of not guarded in evolution；Most of positioning In cytoplasm, minority is positioned in nucleus.Moreover, part circRNA has the function of miRNA molecule sponge, with miRNA Interaction, regulates and controls the expression of target gene；Most of circRNA can play regulating and controlling effect in transcription or post-transcriptional level, a small number of It can play a role in transcriptional level.Some previous are the study found that circRNA is sick in the hardening of artery congee, nerve problems, Ruan It plays an important role in the diseases generating process such as malicious disease, diabetes, tumour and cancer, becomes current medical domain research New hot spot.CircRNA molecules are in closed circular structure, are not influenced compared with traditional linear rna by RNA excision enzymes, CircRNA expression is more stable, and not degradable, the tissue specificity and stability of circRNA make it be expected to examine as URSA clinics The excellent marker object of disconnected, treatment and prognosis detection.

Invention content

For the above prior art, inventor passes through a large amount of technical research and long-term clinical practice, provides one kind It diagnoses URSA and/or assesses the Related product of URSA Pregnancies, and circ_0079591 is provided and is diagnosed as URSA And the application of pregnancy outcome's assessment marker.

In the first aspect of the invention, circ_0079591 is provided as URSA diagnosis and/or URSA patient's gestation Final result is assessed marker and is being prepared for diagnosing URSA and/or for assessing the application in URSA Pregnancies product.

Wherein, the nucleic acid sequence of the circ_0079591 is as follows：

AGCACTAGACAAACTGAATGGATTTCAGTTAGAGAATTTCACCTTGAAAGTAGCCTATATCCCTGATGA AATGGCCGCCCAGCAAAACCCCTTGCAGCAGCCCCGAGGTCGCCGGGGGCTTGGGCAGAGGGGCTCCTCAAGGCAGG GGTCTCCAGGATCCGTATCCAAGCAGAAACCATGTGATTTGCCTCTGCGCCTGCTGGTTCCCACCCAATTTGTTGGA GCCATCATAGGAAAAGAAGGTGCCACCATTCGGAACATCACCAAACAGACCCAGTCTAAAATCGATGTCCACCGTAA AGAAAATGCGGGGGCTGCTGAGAAGTCGATTACTATCCTCTCTACTCCTGAAGGCACCTCTGCGGCTTGTAAGTCTA TTCTGGAGATTATGCATAAGGAAGCTCAAGATATAAAATTCACAGAAGAGATCCCCTTGAAGATTTTAGCTCATAAT AACTTTGTTGGACGTCTTATTGGTAAAGAAGGAAGAAATCTTAAAAAAATTGAGCAAGACACAGACACTAAAATCAC GATATCTCCATTGCAGGAATTGACGCTGTATAATCCAGAACGCACTATTACAGTTAAAGGCAATGTTGAGACATGTG CCAAAGCTGAGGAGGAGATCATGAAGAAAATCAGGGAGTCTTATGAAAATGATATTGCTTCTATGAATCTTCAAGCA CATTTAATTCCTGGATTAAATCTGAACGCCTTGGGTCTGTTCCCACCCACTTCAGGGATGCCACCTCCCACCTCAGG GCCCCCTTCAGCCATGACTCCTCCCTACCCGCAGTTTGAGCAATCAGAAACGGAGACTGTTCATCTGTTTATCCCAG CTCTATCAGTCGGTGCCATCATCGGCAAGCAGGGCCAGCACATCAAGCAGCTTTCTCGCTTTGCTGGAGCTTCAATT AAG

Further, the circ_0079591 is the circ_0079591 in serum sample.

The second aspect of the invention, the kit or genetic chip for providing detection circ_0079591 are used in preparation Diagnose URSA and/or for assessing the application in URSA Pregnancies product.

Further, the kit includes at least the forward primer 5'- for circ_0079591 ATCAGTCGGTGCCATCATCG-3' and reverse primer 5'-GCGGCCATTTCATCAGGGATA-3'.

Further, the genetic chip includes at least the probe with the nucleic acid array hybridizing of circ_0079591.

Further, whether the product can diagnose patient by circ_0079591 expressions in detection serum With URSA, the low expression of circ_0079591 is related to the occurrence and development of URSA and pregnancy outcome.

Further, the product of the expression of the detection circ_0079591 includes：By RT-PCR, fixed in real time The expression of PCR, in situ hybridization, genetic chip or gene sequencing detection circ_0079591 are measured to diagnose URSA and/or comment Estimate the product of URSA Pregnancies.

The third aspect of the invention provides a kind of for diagnosing URSA and/or assessing URSA Pregnancies The characteristics of product, the product is：The product can be diagnosed by detecting the circ_0079591 expressions in serum URSA and/or assessment URSA Pregnancies, high-throughput testing result show that circ_0079591 expresses calibration in URSA groups Normal gravid woman significantly reduces.

Further, the product is chip or detection kit；Its chips is included at least with circ_0079591's The probe of nucleic acid array hybridizing.

Further, the detection kit includes reagent for preparing reverse transcription reaction system and for preparing qPCR The reagent of reaction system.

The fourth aspect of the invention provides applications of the circ_0079591 in the drug for preparing treatment URSA.

Further, the drug is the agonist of circ_0079591.

Compared with prior art, the advantageous effect of technical scheme of the present invention is：

(1) for the present invention by high-throughput chip and Big Clinical Samples expression verification, screening obtains circ_0079591 can As the marker of diagnosis URSA, diagnosis efficiency is up to 91.70%.

(2) for the present invention by high-throughput chip, screening, which obtains circ_0079591, can be used as URSA Pregnancies The marker of assessment, diagnosis efficiency are up to 88.70%.

(3) present invention provides foundation to develop the drug of raising circ_0079591 expressions future.

(4) present invention develops corresponding using circ_0079591 as diagnosis URSA and the marker of pregnancy outcome's assessment Detection kit, kit detection sensitivity is high, specificity is high, easy to detect, meets the detection need of diagnosis patient URSA It asks, accuracy rate of diagnosis is high according to clinical verification.

Description of the drawings

The Figure of description for constituting the part of the present invention is used to provide further understanding of the present invention, and of the invention shows Meaning property embodiment and its explanation are not constituted improper limitations of the present invention for explaining the present invention.

Fig. 1：URSA patient screens with normal pregnant women peripheral blood difference circRNA.

Fig. 2：URSA patient verifies with the circ_0079591 expression of normal pregnant women peripheral blood.

Fig. 3：Pregnancy failure group is verified with the circ_0079591 expression of Pregnancy Success group peripheral blood in URSA patient.

Fig. 4：URSA patient schemes with normal pregnant women ROC Curve, and A is circ_0079591ROC curve graphs, and B is pregnant Hormone ROC curve figure.

Fig. 5：Pregnancy failure group is schemed with Pregnancy Success group ROC Curve in URSA patient, and A is circ_0079591ROC bent Line chart, B are progestational hormone ROC curve figure.

Specific implementation mode

It is noted that described further below be all exemplary, it is intended to provide further instruction to the present invention.Unless another It indicates, all technical and scientific terms used herein has usual with general technical staff of the technical field of the invention The identical meanings of understanding.

It should be noted that term used herein above is merely to describe specific implementation mode, and be not intended to restricted root According to exemplary embodiments of the present invention.As used herein, unless the context clearly indicates otherwise, otherwise singulative It is also intended to include plural form, additionally, it should be understood that, when in the present specification using term "comprising" and/or " packet Include " when, indicate existing characteristics, step, operation and/or combination thereof.

Term is explained：

circ_0079591：Circular rna 0079591, nucleic acid sequence such as SEQ ID NO:Shown in 1.

As background technology is introduced, use progestational hormone etc. as diagnosis URSA and pregnancy outcome's assessment in the prior art There are certain deficiencies, and in order to solve technical problem as above, the present invention obtains circ_0079591 by high-throughput chip, screening URSA diagnosis and pregnancy outcome can be used as to assess marker.

In the another embodiment of the present invention, the circ_0079591 is the circ_ in serum sample 0079591。

In one particular embodiment of the present invention, the specific technical solution being related to includes：

(1) URSA patient and normal pregnant women venous blood (every group each 6) are collected, mononuclearcell is detached, using height Flux cDNA microarray difference circular rna.

(2) enlarged sample amount (every group each 60), fluorescence real-time quantitative PCR (qPCR) verification screening difference circular rna table It reaches.

(3) clinical data (age, gender) is analyzed.

(4) Logistic analysis of regression model.

(5) ROC curve analytical control efficiency and best cutoff values.

In the exemplary embodiment of the present invention, the kit or genetic chip of detection circ_0079591 are provided It is preparing for the application in diagnosing URSA and/or assessing URSA Pregnancies product.

In the specific embodiment of the present invention, the kit includes at least the forward direction for circ_0079591 Primer 5'-ATCAGTCGGTGCCATCATCG-3' and reverse primer 5'-GCGGCCATTTCATCAGGGATA-3'.

In the specific embodiment of the present invention, the genetic chip includes at least the nucleic acid with circ_0079591 The probe of sequence hybridization.

In the specific embodiment of the present invention, the product can be by detecting circ_0079591 tables in serum Diagnose whether patient suffers from URSA, occurrence and development and pregnancy outcome phase of the circ_0079591 low expressions with URSA up to level It closes.

In the another embodiment of the present invention, the expression of circ_0079591 in the detection serum Product includes：Detect circ_0079591's by RT-PCR, real-time quantitative PCR, in situ hybridization, genetic chip or gene sequencing Expression is to diagnose URSA and/or assess the product of URSA Pregnancies.

Wherein, the gene sequencing can detect the opposite variation of gene expression dose, such as Illumina sequencings. Illumina platforms are a kind of sequencing sides based on the sequencing technologies (Sequencing-By-Synthesis, SBS) in synthesis Method.Since reversible block technology may be implemented only to synthesize a base every time, and mark fluorescent group, recycle corresponding laser Fluorophor is excited, exciting light is captured, to read base information.The original image data file that high-flux sequence obtains is through alkali Base identification (Base Calling) analysis be converted into primitive sequencer sequence, referred to as Raw Data or Raw Reads, as a result with FASTQ (referred to as fq) stored in file format.Clean Reads and specified reference gene group are subjected to sequence using hisat2 It compares, obtains the location information in reference gene group or gene, and the sequencing distinctive sequence signature information of sample.One base Because the directly embodiment of expression is exactly the abundance situation of its transcript, Transcript abundance degree is higher, then gene expression dose It is higher.In transcript profile sequencing analysis, can by navigate to transcript exon 1 sequencing sequence (reads) counting come Estimate the expression of gene.The calculating of transcript expression quantity uses FPKM methods (Fragments Per kb Per Million Reads), it is fragments numbers in every million fragments from a certain transcript per kilobase length.FPKM is simultaneously The influence that sequencing depth and transcript length count fragments is considered, common transcript expression water is presently the most Flat evaluation method.FPKM calculation formula are as follows：

In the exemplary embodiment of the present invention, provide a kind of for diagnosing URSA and/or assessment URSA patient The characteristics of product of pregnancy outcome, the product is：The product can express water by the circ_0079591 detected in serum It puts down to diagnose URSA and/or assessment URSA Pregnancies, high-throughput testing result shows circ_0079591 in URSA groups Expression is significantly reduced compared with normal pregnant women.

In the specific embodiment of the present invention, the product is chip or detection kit；Its chips is at least It include the probe with the nucleic acid array hybridizing of circ_0079591.

In the specific embodiment of the present invention, for detection kit, detection architecture includes reverse transcription reaction body System and qPCR reaction systems, the detection kit include reagent for preparing reverse transcription reaction system and for preparing qPCR The reagent of reaction system.

In one particular embodiment of the present invention, reverse transcription is included at least for preparing the reagent of reverse transcription reaction system Buffer solution (MLV-5 × buffer), dNTP mixed liquors, RNA enzyme protein inhibitor (RNAsin), reverse transcription enzyme solution (M-MLV) With poly thymidine (OligodT).

In one particular embodiment of the present invention, for prepare qPCR reaction systems reagent include at least be directed to The forward primer liquid and reverse primer liquid of circ_0079591 further includes SYBR Green mixed liquors, nuclease free pure water.

In the typical embodiment of the present invention, circ_0079591 is provided in the drug for preparing treatment URSA Application.

In the specific embodiment of the present invention, the drug is the agonist of circ_0079591, the circ_ 0079591 agonist is the product for referring to improve circ_0079591 expressions, which includes：circ_0079591 Over-express vector, circ_0079591 transcriptional activations type Cas9-VP64-sgRNA coexpression vectors and raising circ_0079591 Compound, compositions or agents of expression etc..Wherein, circular rna over-express vector (such as Lentiviral, gland Virus expression carrier) and transcriptional activation type Cas9-VP64-sgRNA coexpression vectors be commercialized, can also pass through conventional skill Art means are prepared.

In order to enable those skilled in the art can clearly understand technical scheme of the present invention, below with reference to tool The embodiment of the body technical solution that the present invention will be described in detail.

In following embodiments, if not specially show that reagent used is that analysis is pure, and agents useful for same can be from commercial channel It obtains.Test method without specific conditions in text, the science that such as J. Pehanorm Brookers are write usually according to normal condition What publishing house year published《Molecular Cloning:A Laboratory guide》Condition described in one book, or according to the condition proposed by manufacturer.It removes Non- separately to define, all professional and scientific terms used in text have the same meanings as commonly understood by one of ordinary skill in the art.This Outside, any method and material similar or impartial to described content all can be applied in the present invention.

1. experimental subjects is included in and exclusion criteria：

(1) case source

All cases derive from 01 month 2016 to 06 month 2017 gynaecology of Hospital Attached to Shandong Chinese Medical Univ. and are hospitalized With outpatient, totally 60.Normal group blood sample both from Hospital Attached to Shandong Chinese Medical Univ. normal pregnancy physical examination person, Not to be in the mood for, brain, lung, liver, kidney diaseases and thrombotic diseases, no known effect research index disease, totally 60.

(2) inclusion criteria：

(1) URSA patient selections standard：

1. patient has 2 times or 2 times or more history of spontaneous abortion, no life birth history；

2. Mr. and Mrs both sides and (or) embryo chromosome are normal, no family's hereditary disease and consanguineous marriage history；

3. the inspections exclusion patient such as the inspection of gynaecological examination leukorrhea, ultrasonic examination and (or) hysterosalpingography organic disease, Reproductive organs anatomical abnormalities and infectious factors；

4. the menstrual cycle is normal, basal body temperature two-phase, ultrasonic monitoring ovulation is normal；

5. bridegroom's or husband's side semen analysis is normal；

6. the Endocrinological inspections such as sex hormone, thyroid function, blood glucose, insulin are normal；

7. autoantibody such as antinuclear antibodies, anticardiolipin antibodies, anti-thyroid antibody, anti-2- glycoprotein I Antibodies check equal It is negative；

8. the related inspection of prethrombotic state, including d-dimer, fibrin (original) catabolite, blood clotting are serial, complete Haemanalysis is normal；

9. Torch series IgM is negative；

10. not carrying out active immunity treatment in the past.

(2) normal control inclusion criteria：

Normal pregnancy physical examination women within gestation 12 weeks, previously without spontaneous abortion, stillborn foetus, stillbirth history, no heredity, dissection, It is abnormal in terms of endocrine, no infection, autoimmune disease history；The threatened abortions such as this gestation Non-vaginal bleeding, abdominal pain Sings and symptoms；Ultrasound confirms that embryonic development is normal, and intentionally pipe is beaten.

2. high-throughput chip detection：

URSA and normal pregnant women peripheral blood are collected, total serum IgE utilizes NanoDrop ND-2000 (Thermo Scientific) quantitative and complete through Agilent Bioanalyzer 2100 (Agilent Technologies) detections RNA Property.After RNA quality inspection qualifications, total serum IgE reverse transcription is marked at double-strand cDNA, further synthesis Cyanine-3-CTP (Cy3) cRNA.CRNA and Agilent Human lncRNA Microrray V6 (4*180K, the Design ID marked:084410) Chip hybridization obtains original graph after elution using Agilent Scanner G2505C (Agilent Technologies) scannings Picture.

It is handled using Feature Extraction softwares (version10.7.1.1, Agilent Technologies) Original image extracts initial data.Followed by Genespring softwares (version 13.1, Agilent Technologies quantile standardization and subsequent processing) are carried out.Data after standardization are filtered, every for what is compared At least one group 100% probe labeled as " P " leaves carry out subsequent analysis in group sample.Become using the T p values examined and multiple Change value carries out difference circRNA and LncRNA, the standard of screening be raise or lower fold change value >=2.0 and P values≤ 0.05。

3.qPCR verifies difference circRNA expression：

(1) cell extraction RNA：

Take 5 × 10⁶~1 × 10⁷A cell is added 1ml Trizon, mixes well, be stored at room temperature 5~10min；It is added 200 μ l/1mlTrizon chloroforms cover tightly EP and manage and acutely sway 15s；4 DEG C of centrifugations：12000rpm × 10min takes upper strata aqueous phase In a new EP pipes；Isometric isopropanol is added, mildly overturns mixing, is placed at room temperature for 10min；4 DEG C of centrifugations：12000rpm× 10min；Supernatant is abandoned, 1ml 75 (v/v) % ethyl alcohol (absolute ethyl alcohols are added：DNase/RDase-free water=3:1), gently Mixing；4 DEG C of centrifugations：12000rpm×5min；Supernatant is abandoned, 1ml absolute ethyl alcohols are added；4 DEG C of centrifugations, 12000rpm × 5min；It abandons Supernatant (as possible removes residual liquid), 10~20min of room temperature or vacuum drying；Appropriate DNase/ is added according to RNA precipitate amount RDase-free water (being usually 30-50 μ l) dissolving RNA；Concentration is surveyed after mixing and is recorded, and reverse transcription is carried out.

(2) RT is tested

0.2mlEP pipe marker samples titles and date are taken, RNA, DNase/RDase-free water, OligodT are pressed It is required that being added in the EP pipes marked；Operation RT-1 programs, 70 DEG C, 5min (table 1)；By the prepared MLV-5 of system × The MIX of buffer, dNTP, RNAsin, M-MLV are added in above-mentioned EP pipes, run RT-2 programs, and 42 DEG C, 1h obtains cDNA, Carry out PCR experiment (table 2).

Table 1.RNA and OligodT

System volume	20μl
		RNA	11μl
DNase/RDase-free water	11-V1
		OligodT	1μl
RNA uses volume V1	2000ng/C1

2. reverse transcription reaction system of table

System volume	20μl
		MLV-5×buffer	4μl
dNTP	2μl
		RNAsin	1μl
M-MLV	1μl
		RNA+OligodT	11μl

(3) qPCR is tested：After SYBR, primer and cDNA dissolvings, brief centrifugation, mixing is placed on ice；DNase/RDase- free water。

Table 3.PCR reaction systems (20 μ l)

Reaction system	20μl
		Primers F (10 μm)	1.2μl
Primer R (10 μm)	1.2μl
		SYBR	10μl
cDNA	2μl
		DNase/RDase-free water	5.6μl

Brief centrifugation；Run 7500 programs, the setting of condition according to the form below.

Table 4.PCR programs

Table 5.circ_0079591 primer sequences

circ_0079591	Sequence(5'->3')
		Forward primer	ATCAGTCGGTGCCATCATCG(SEQ ID NO:2)
Reverse primer	GCGGCCATTTCATCAGGGATA(SEQ ID NO:3)
		Product length	154bp

4. statistical analysis：

Using SPSS22.0 softwares (SPSS Inc., USA).Continuous variable is using the peaceful mean value ± of median (Median) Standard deviationIt indicates；Measurement data is examined using t, and enumeration data uses χ²It examines.It is special by drawing subject's work Sign (ROC) curve judges diagnosis capability with corresponding area under the curve (AUC) is calculated.Best cutoff values are chosen for sensitivity With the value corresponding to the sum of specificity maximum.Using medcale10.4.7.0 comparison area under the curve AUC othernesses.P< 0.05 (bilateral) is to have significant difference.Using R software analytical control efficiency and sample size, R >=0.8 is to be imitated with inspection Energy.

As a result

1. high-throughput testing result

It is high-throughput the results show that circ_0079591, circ_0082660, LncRNA NONHSAT167899.1, LncRNA ENST00000514235 are dramatically different in the more normal pregnancy controls group of URSA groups expression, wherein as shown in Figure 1, Circ_0079591 expresses more normal pregnancy controls group in URSA groups and significantly reduces, P<0.05.And about circ_0082660, The specific technical solution of LncRNA NONHSAT167899.1 and LncRNA ENST00000514235, applicant is It is protected as other patent applications.

2.qPCR verifies circ_0079591 expression

As shown in Fig. 2, compared with Normal group, the circ_0079591 expression of URSA groups significantly reduces (P<0.05)；Such as Shown in Fig. 3, in URSA patient, circ_0079591 is expressed compared with Pregnancy Success group in Pregnancy failure group and is significantly reduced, P<0.05.

3. analysis of clinical between group

(1) age：Not statistically significant (the P of age comparing difference between group>0.05), there is comparativity (being shown in Table 6, table 7).

6. normal groups of table is between URSA group groups compared with the age

Note：The age carries out t inspections, P between two groups>0.05.

In table 7.URSA between Pregnancy Success and ineffective group group compared with the age

Note：The age carries out t inspections, P between two groups>0.05.

4.Logistic regression analyses：Normal pregnancy group is shown in Table with URSA group Logistic regression analyses in 8, URSA pregnant Success group is shown in Table 9 with Pregnancy failure group Logistic regression analyses.

8. normal pregnancy group of table and URSA group Logistic regression analyses

Model 1:Single factor test Logistic regression models are built by independent variable of circ_0079591；

Model 2:Using age, circ_0079591 Influencing factors model is built as independent variable；

Single factor test Logistic regression models are built using circ_0079591 as independent variable and correct institute's structure after the age simultaneously The Influencing factors model result built shows, correction and does not correct obtained statistical result and is consistent, because This determines that circ_0079591 has the potentiality of diagnosis URSA.

Pregnancy Success group and Pregnancy failure group Logistic regression analyses in table 9.URSA

Single factor test Logistic regression models are built using circ_0079591 as independent variable and correct institute's structure after the age simultaneously The Influencing factors model result built shows, correction and does not correct obtained statistical result and is consistent, because This determines that circ_0079591 has the potentiality of prediction URSA pregnancy outcomes.

5.ROC tracing analysis power of test and best cutoff values：

The results are shown in Figure 4, and circ_0079591ROC area under the curve is 0.917, is higher than progestational hormone (0.703), p< 0.05.Circ_0079591 relative expression quantities are less than 1.833, are diagnosed as URSA；Relative expression quantity is higher than 1.833, is not diagnosed as URSA；Diagnosis efficiency is 91.70%.

The results are shown in Figure 5, and circ_0079591ROC area under the curve is 0.887, is higher than progestational hormone (0.838), p< 0.05.Circ_0079591 relative expression quantities are Pregnancy failure less than 1.794, URSA Prognostics；Relative expression quantity is high In 1.794, URSA Prognostics be Pregnancy Success；Prognosis evaluation efficiency is 88.70%.

The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment Limitation, it is other it is any without departing from the spirit and principles of the present invention made by changes, modifications, substitutions, combinations, simplifications, Equivalent substitute mode is should be, is included within the scope of the present invention.

SEQUENCE LISTING

<110>Basic Medical Science Inst., Shandong Prov. Academy of Medical Science

<120>Circ_0079591 is diagnosed as URSA in serum and pregnancy outcome assesses the application of marker

<130> 2018

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 919

<212> DNA

<213>Circ_0079591 sequences

<400> 1

agcactagac aaactgaatg gatttcagtt agagaatttc accttgaaag tagcctatat 60

ccctgatgaa atggccgccc agcaaaaccc cttgcagcag ccccgaggtc gccgggggct 120

tgggcagagg ggctcctcaa ggcaggggtc tccaggatcc gtatccaagc agaaaccatg 180

tgatttgcct ctgcgcctgc tggttcccac ccaatttgtt ggagccatca taggaaaaga 240

aggtgccacc attcggaaca tcaccaaaca gacccagtct aaaatcgatg tccaccgtaa 300

agaaaatgcg ggggctgctg agaagtcgat tactatcctc tctactcctg aaggcacctc 360

tgcggcttgt aagtctattc tggagattat gcataaggaa gctcaagata taaaattcac 420

agaagagatc cccttgaaga ttttagctca taataacttt gttggacgtc ttattggtaa 480

agaaggaaga aatcttaaaa aaattgagca agacacagac actaaaatca cgatatctcc 540

attgcaggaa ttgacgctgt ataatccaga acgcactatt acagttaaag gcaatgttga 600

gacatgtgcc aaagctgagg aggagatcat gaagaaaatc agggagtctt atgaaaatga 660

tattgcttct atgaatcttc aagcacattt aattcctgga ttaaatctga acgccttggg 720

tctgttccca cccacttcag ggatgccacc tcccacctca gggccccctt cagccatgac 780

tcctccctac ccgcagtttg agcaatcaga aacggagact gttcatctgt ttatcccagc 840

tctatcagtc ggtgccatca tcggcaagca gggccagcac atcaagcagc tttctcgctt 900

tgctggagct tcaattaag 919

<210> 2

<211> 20

<212> DNA

<213>Artificial sequence

<400> 2

atcagtcggt gccatcatcg 20

<210> 3

<211> 21

<212> DNA

<213>Artificial sequence

<400> 3

gcggccattt catcagggat a 21

Claims

1.circ_0079591 being prepared as URSA diagnosis and/or URSA Pregnancies assessment marker for diagnosing URSA and/or for assessing the application in URSA Pregnancies product.

2. application as described in claim 1, it is characterized in that：The circ_0079591 is the circ_ in serum sample 0079591。

3. the kit or the genetic chip that detect circ_0079591 are pregnant for diagnosing URSA and/or assessment URSA patient in preparation Application in final result of being pregnent product.

4. application as claimed in claim 3, it is characterized in that：The kit includes at least the forward direction for circ_0079591 Primer 5'-ATCAGTCGGTGCCATCATCG-3' and reverse primer 5'-GCGGCCATTTCATCAGGGATA-3'.

5. application as claimed in claim 3, it is characterized in that：The genetic chip includes at least the nucleic acid with circ_0079591 The probe of sequence hybridization.

6. application as claimed in claim 3, it is characterized in that：The product can be by detecting circ_0079591 tables in serum Whether patient is diagnosed with URSA and/or assessment URSA Pregnancies up to level.

7. application as claimed in claim 6, it is characterized in that：The production of the expression of circ_0079591 in the detection serum Product include：The table of circ_0079591 is detected by RT-PCR, real-time quantitative PCR, in situ hybridization, genetic chip or gene sequencing Up to level to diagnose URSA and assess the product of URSA Pregnancies.

8. a kind of product for diagnosing URSA and/or assessing URSA Pregnancies, it is characterized in that：The product can lead to It crosses and detects the circ_0079591 expressions in serum to diagnose URSA and/or assessment URSA Pregnancies.

9. product as claimed in claim 8, it is characterized in that：The product is chip or detection kit；Its chips is at least It include the probe with the nucleic acid array hybridizing of circ_0079591；The detection kit, which includes at least, is directed to circ_0079591 Forward primer 5'-ATCAGTCGGTGCCATCATCG-3' and reverse primer 5'-GCGGCCATTTCATCAGGGATA-3'.

10.circ_0079591 the application in the drug for preparing treatment URSA, it is characterized in that：The drug is circ_ 0079591 agonist.