CN108338986B - Small-molecule RNA for treating cancer and application thereof - Google Patents

Abstract

The invention discloses a small RNA for treating cancer and application thereof, wherein the small RNA has the function of knocking down the protein content of DHX33, and the sequence of the small RNA is as follows: TTGGGAAGCTGGTTGGCTATA are provided. The small molecular RNA has the function of knocking down the protein content of DHX33 to reach the basic level so as to reduce the carcinogenicity of c-Myc and maintain the characteristics of the cancer, thereby achieving the purpose of treating the cancer.

Description

Small-molecule RNA for treating cancer and application thereof

Technical Field

The invention relates to the technical field of biology, and mainly relates to a small molecular RNA for treating cancer and application thereof.

Background

In the past decade, the number of new cancer patients in China has been on the rise year by year, but the five-year average survival rate of cancer patients is far below the level of more than five adults in developed countries. And displaying according to the latest statistical data: the new cancer population in China has leaped the top of the world. The critical form makes it extremely urgent to understand and explore cancer treatments from a completely new perspective.

c-Myc is one of oncogenes highly expressed in various cancers, and gene amplification or translocation (translocation) may occur in various cancers; meanwhile, Myc overexpression can also be caused by deletion mutation of Myc arrestin Mga gene. The c-Myc is mainly combined with Max in cells to form a transcription factor of a c-Myc/Max dimer complex, and plays a role in regulating and controlling downstream genes so as to stimulate cell proliferation and metabolism, and the dysfunction is almost appeared in all human cancers. Aiming at the growth dependence (oncogene diagnosis) of cancer cells on oncogenes, the treatment drug targeting different oncoproteins is used for patients, so that the development of cancer can be specifically inhibited, the service life of the patients is prolonged, and accurate personalized treatment is realized. The most prominent example is the tyrosine kinase receptor inhibitor EGFR-TKI of EGFR, which has been clinically well treated. However, although the inhibition of c-Myc in a mouse model proves to be effective in inhibiting the occurrence and development of cancer, c-Myc itself is difficult to target as a transcription factor, so that no effective medicine for specifically inhibiting the activation of a c-Myc signaling pathway exists in medicine so far.

Since the oncogene c-Myc itself is difficult to target and control, it is important to screen anticancer drugs for its upstream or downstream signaling pathway. Currently, the upstream signaling pathways of some more classical oncogene or oncogene-suppressor pathways are known clearly in cancer research, but the downstream signaling pathways of oncogenes/oncogenes are not known fully. The downstream molecules are crucial to maintaining the character of cancer cells, can synthesize various upstream signal channels to regulate the growth of the cells, and are potential sources for developing future anti-cancer drugs. For example, protein translation is one of the most conserved vital activities in cells, wherein 4E-BP regulates the translation of cap-dependent protein (one of the pathways for maintaining normal functions of cells) by binding with eIF4E, but this important control pathway is out-of-regulation in many cancers, so that the growth and division of cancer cells are strongly dependent on protein synthesis, and the research on the eIF 4E-mediated protein translation regulation mechanism has become a hotspot in cancer biology at present. For example, the expression quantity of the protein PKM2 for regulating the cell metabolism in cancer cells is many times higher than that in normal cells, and the protein PKM2 participates in glycolysis Warburg effect, regulation and metabolic recombination and the like of the cancer cells; inhibition of PKM2 was shown to inhibit the proliferation of cancer cells without significant side effects on normal cells. Ribosome production has been considered as one of the cell-conserved life activities (housekeeping), and the transcription of RNA polymerase i can be regulated by the signal pathways of various oncogenes, cancer suppressor genes, which show enhanced transcription activity in many cancer cells. RNA polymerase I has been considered as a potential drug target for cancer treatment in recent years, wherein CX5461 is the first clinical RNA polymerase I transcription inhibiting drug entering phase I, has specific targeting effect on cancer cells, has little damage to normal cells, and is incomparable with common chemotherapeutic drugs.

In summary, the phenomenon of abnormal activity in cancer cells, such as protein translation, Warburg effect, and ribosome production, can be studied, and inhibition of these downstream pathways can also be used to inhibit cancer progression, thereby providing a concept for the development of potential cancer therapeutic means. With the development of individual cancer treatment, part of the medicines can achieve the aim of effectively inhibiting the development of the cancer. However, many cancers caused by the amplification or activation of the oncogene c-Myc are still lack of effective therapeutic drugs so far. We previously found that DHX33, a member of the RNA helicase family, is involved in protein translation and ribosomal RNA generation, and further found that this protein is actively involved in inhibiting apoptosis. DHX33 is a gene downstream of c-Myc and plays a crucial role in c-Myc-induced carcinogenesis.

Disclosure of Invention

In view of the above-mentioned shortcomings of the prior art, the present invention aims to provide a small molecule RNA for treating cancer and its application, aiming to provide a novel drug for treating cancer.

The technical scheme of the invention is as follows:

a small RNA for treating cancer, wherein the small RNA molecule has the effect of knocking down the protein content of DHX33, and the sequence is as follows:

TTGGGAAGCTGGTTGGCTATA。

the use of the small molecule RNA for the treatment of cancer as described above, wherein the small molecule RNA is used for preparing a medicament for treating cancer, and the cancer is caused by the amplification or activation of the oncogene c-Myc.

The application of the small-molecule RNA for treating cancer is disclosed, wherein the cancer is lung adenocarcinoma.

Has the advantages that: the invention relates to a gene targeting drug, a lentivirus plasmid and a lentivirus for treating cancer, wherein the lentivirus plasmid contains a small RNA sequence targeting DHX 33: sh-DHX33-2: 5'-TTGGGAAGCTGGTTGGCTATACTCGAGTATAGCCAACCAGCTTCCCAA-3'. The small molecular RNA has the function of knocking down the protein content of DHX33 to reach the basic level so as to reduce the carcinogenicity of c-Myc and maintain the characteristics of the cancer, thereby achieving the purpose of treating the cancer.

Drawings

FIG. 1 is a graph showing the results of detection of protein content in example 1 of the present invention.

FIG. 2 is a graph showing the results of detection of apoptosis of cells under a microscope in example 1 of the present invention.

FIG. 3 is a diagram showing an analysis of apoptosis by flow cytometry in example 1 of the present invention.

FIG. 4 is a graph showing the results of detecting the amount of pendulum BT549 protein in example 2 of the present invention.

FIG. 5 is a graph showing the results of detecting the content of H1299 protein in example 2 of the present invention.

FIG. 6 is a graph showing the results of measuring the levels of apoptosis genes Bcl-2 and BAD messenger RNA in example 2 of the present invention.

FIG. 7 is a diagram showing the electrophoresis results of PCR products of the chromosome immunoprecipitation experiment analyzing the binding of DHX33 to Bcl-2 and BAD gene promoters in example 2 of the present invention.

FIG. 8 is a graph showing the results of real-time fluorescence PCR detection of the amount of DHX33mRNA in example 3 of the present invention.

FIG. 9 is a graph showing the results of measurement of the amount of DHX33 protein in example 3 of the present invention.

FIG. 10 is a diagram showing the respective bases in the conserved region E-box in which the c-Myc transcription factor binds to the promoter DNA in example 3 of the present invention.

FIG. 11 is a diagram showing the E-Box site and the sequence contained in the promoter proximal to DHX33 gene in example 3 of the present invention.

FIG. 12 shows the result of analysis of the change in the electrophoretic mobility rate of the DHX33 promoter by direct binding of c-Myc protein in example 4.

FIG. 13 is a graph showing the comparison of the expression of DHX33 with the expression of c-Myc in examples of normal lung tissue and lung cancer tissue in example 4 of the present invention.

FIG. 14 is a graph showing the analysis of the amounts of the respective proteins in example 4 of the present invention.

FIG. 15 shows cell migration assay in example 4 of the present invention

FIG. 16 shows BrdU cell proliferation assay in example 4 of the present invention

FIG. 17 is a graph comparing the independent growth experiments of soft agar suspension of cells in example 4 of the present invention.

FIG. 18 is a graph comparing the inhibition of cell migration caused by DHX33 depletion in lung adenocarcinoma cells analyzed in example 4 of the present invention.

FIG. 19 is a graph comparing the ability of the control group and the experimental group to form tumors in mice in example 5 of the present invention.

FIG. 20 is a graph showing the results of quantitative analysis of tumor formation in nude mice in the control group and the experimental group in example 5 of the present invention.

FIG. 21 is a graph showing the results of analysis of inhibition of DHX33 protein expression by various small RNA molecules targeting DHX33 in example 6 of the present invention.

Detailed Description

The present invention provides a small-molecule RNA for treating cancer and applications thereof, and the present invention is further described in detail below in order to make the objects, technical schemes, and effects of the present invention clearer and clearer. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

The invention provides a small RNA molecule for treating cancer, which has the function of knocking down the protein content of DHX33 to reach a basic level so as to reduce the carcinogenicity of c-Myc and maintain the characteristics of the cancer, thereby achieving the purpose of treating the cancer.

The small RNA molecule is a small hairpin RNA, and the sequence of the small RNA molecule is as follows:

TTGGGAAGCTGGTTGGCTATA(SEQ ID NO:17)。

the invention provides a gene-targeted drug for treating cancer, which is a nucleic acid sequence of a small molecular RNA with the function of knocking down the protein content of DHX33, and the nucleic acid sequence is as follows:

(5’-3’)sh-DHX33-2:5’-TTGGGAAGCTGGTTGGCTATACTCGAGTATAGCCAACCAGCTTCCCAA。

the gene targeting drug is introduced into cells by adopting the existing lentivirus. The cancer is a cancer caused by amplification or activation of an oncogene c-Myc, such as lung adenocarcinoma. The gene targeting drug has the effect of knocking down the protein content of DHX33 to reach the basic level so as to reduce the carcinogenicity of c-Myc and maintain the characteristics of the carcinogenicity, thereby achieving the purpose of treating lung adenocarcinoma. Because c-Myc is difficult to target as a transcription factor, experimental research shows that DHX33 is a target site for cancer treatment caused by c-Myc, DHX33 regulation is one of downstream pathways of oncogene c-Myc, and the gene targeting drug provided by the invention prevents cancer from developing from the downstream signaling pathway. Therefore, the invention also provides application of the small RNA molecule for treating cancer, and the small RNA molecule for treating cancer is used for preparing a medicament for treating cancer. The cancer is a cancer caused by amplification or activation of the oncogene c-Myc, more particularly, the cancer is lung adenocarcinoma.

The invention also provides a lentiviral plasmid for treating cancer, wherein the lentiviral plasmid contains a gene which codes a small RNA sequence targeting DHX33, the small RNA has the effect of knocking down the expression level of DHX33 protein, and the lentiviral plasmid contains a small RNA sequence which codes a targeting DHX33 (wherein sh-DHX33-1 is a previously disclosed sequence and is used as an experimental control in the invention):

sh-DHX33-1:(5’-3’):GCTATCGCAAAGTGATCATTTCTCGAGAAATGATCACTTTGCGATAGC(SEQ ID NO:1)；

sh-DHX33-2:(5’-3’):TTGGGAAGCTGGTTGGCTATACTCGAGTATAGCCAACCAGCTTCCCAA(SEQ ID NO:2)。

further, the lentiviral plasmid preparation required pLKO.1-vector, pCMV-VSV-G and pCMV-dR8.2dvpr (all available commercially). In this application, the type of lentiviral plasmid is not required or limited, as long as it is a lentiviral vector capable of expressing the gene for the small RNA sequence and transfecting cells.

In the present invention, pLKO.1 plasmid is used as a specific example, and the gene of the small RNA sequence is cloned into pLKO.1 plasmid through restriction enzyme sites AgeI/EcoRI. Are added to the restriction sites AgeI/EcoRI of pLKO.1 plasmid. To construct lentiviral plasmids of sh-DHX33-1 and sh-DHX33-2, the DNAs synthesized by Huada Gene Inc were:

sh-DHX 33-1-preagonucleotide: 5 '-CCGGGCTATCGCAAAGTGATCATTTCTCGAGAAATGATCACTTTGCGATAGCTTTTTG 3' (SEQ ID NO: 3);

sh-DHX 33-1-late oligonucleotide: 5 '-AATTCAAAAAGCTATCG CAAAGTGATCATTTCTCGAGAAATGATCACTTTGCGATAGC 3' (SEQ ID NO: 4);

sh-DHX 33-2-preagonucleotide: 5'-CCGGTTGGGAAGCTGGTTGGCTATACTCGAGTATAGCCAACCAGCTTCCCAATTTTTG-3' (SEQ ID NO: 5);

sh-DHX 33-2-late oligonucleotide: 5'-AATTCAAAAA TTGGGAAGCTGGTTGGCTATACTCGAGTATAGCCAACCAGCTTCCCAA-3' (SEQ ID NO: 6); .

Then, cloning the RNA sequence of the sequence into a restriction enzyme cutting site AgeI/EcoR of pLKO.1 plasmid to obtain the plasmid pLKO.1-shRNA.

The invention also provides a lentivirus for treating cancer, wherein the lentivirus is a gene targeting medicament and is a lentivirus with the function of knocking down the expression level of DHX33 protein, and the lentivirus contains the lentivirus plasmid.

The invention also provides a specific preparation method of the lentivirus, which comprises the following steps:

the plasmid mixture was transfected in 293T cells using Lipofectamine 2000(Life Technologies) liposome introduction technology: the specific operation method is that a 10 cm cell culture dish is used for transfection, when 293T cells grow to 90% fusion degree, the following plasmids are mixed, wherein the plasmids comprise pLKO.1-shRNA (namely the lentivirus plasmid) and pCMV-VSV-G, pCMV-dR8.2dvpr, and the mixing ratio of the plasmids is 9: 8: 1, the total DNA amount reaches 12 micrograms per culture dish;

and replacing the culture medium with a culture medium containing antibiotics (penicillin and streptomycin) after 16-18 hours, collecting the cell culture medium by using a sterile pipette after 24 or 48 hours, centrifuging at a low speed for 1000-2000 r/min for two minutes, subpackaging the virus in a 5 ml sterile centrifuge tube, and storing in a refrigerator at 80 ℃ below zero.

The following examples further illustrate the present invention.

Example 1: deletion of DHX33 in cancer cells rapidly leads to apoptosis

The method comprises the following steps:

1) synthesizing a gene sequence for coding the target small RNA sequence according to the target small RNA sequence; the small RNA sequence is a small RNA sequence targeting DHX 33;

2) cloning the gene sequence into a virus plasmid;

3) transfecting a viral plasmid onto a viral vector;

4) the virus vectors are used for infecting a cancer cell line BT549(HTB-122) and HCC1806 (CRL-2335);

5) after the dip dyeing is finished, replacing a new culture medium, and carrying out subculture;

6) after a certain period of culture, total protein was extracted and the expression level of DHX33 protein was analyzed by immunoblotting.

1. Construction of lentiviral plasmids:

experimental groups: the sequence of the DHX 33-targeting RNA is as follows:

sh-DHX33-1 (5 '-3'): GCTATCGCAAAGTGATCATTT (as positive control);

sh-DHX33-2:(5’-3’):TTGGGAAGCTGGTTGGCTATA。

control group: the sequence of small RNA (shScrambled) used as a negative control is:

(5’-3’):CCTAAGGTTAAGTCGCCCTCG。

the small hairpin RNA sequences coding the sequences are respectively cloned on restriction enzyme cutting sites AgeI/EcoRI of pLKO.1vector.

The method comprises the following specific steps:

(1) dissolving the oligomeric nucleic acid with water to obtain a solution with the concentration of 20 micromoles, and adding the matched pre-oligomeric nucleic acid and post-oligomeric nucleic acid into a sterile PCR small tube according to the following formula: 5 microliters each of the pre-oligo nucleic acids, 5 microliters of 10XNEB buffer 2 (purchased) and 35 microliters of water.

(2) The treatment was carried out at 100 ℃ for 10 minutes.

(3) Then slowly cooled to 70 ℃ for 10 minutes, and then slowly cooled to room temperature for 3 hours.

(4) 6. mu.g of pLKO.1 TRC plasmid (purchased) was added to 5. mu.l of 10XNEB buffer 1 (purchased), 1. mu.l of restriction enzyme AgeI, followed by addition of water to 50. mu.l, and the mixture was incubated at 37 ℃ for 2 hours. The cleaved plasmid fragment was purified using the Qiaquick gel extraction kit (purchased), then 5. mu.l of 10XNEB buffer (for EcoRI), 1. mu.l of EcoRI, water was added to 50. mu.l, and incubation was carried out at 37 ℃ for 2 hours.

(5) The resulting DNA fragments were separated on a 0.8% low melting agarose gel, two fragments were visualized, the 7KB fragment was cleaved and then purified to determine the DNA concentration.

(6) Using 2. mu.l of the previously prepared annealed oligo-nucleic acid, 20 ng of the purified DNA fragment was added, 2. mu.l of 10 XDNA ligase buffer and 1. mu.l of DNAT4 ligase were added, and then water was added to 20. mu.l, which was left at room temperature overnight.

(7) The next day, 2. mu.l of the ligation was used to transform 50. mu.l of XL-10gold E.coli competent cells (purchased). The transformation product was plated on LB agar plates containing 100. mu.g of ampicillin per ml of the medium, and then left to incubate overnight at 37 ℃.

(8) The next day, single colonies were picked with sterile toothpicks in LB medium containing ampicillin at the above concentration, incubated at 37 ℃ for 10 hours, and then plasmid DNA was extracted with a plasmid extraction kit of QIAGEN.

(9) Using 500 ng of plasmid DNA, 0.5. mu.l each of EcoRI/NcoI and 2. mu.l of 10NEB buffer (for EcoRI) were added, and water was added to 20. mu.l. Incubate at 37 ℃ for 1 hour.

(10) Positive clones were screened by agarose gel electrophoresis, with a band of 5KB and 2KB, and sequencing analysis to identify correct nucleic acid sequences.

(11) Amplifying positive clones, and extracting high-purity plasmids by using a QIAGEN large-extraction plasmid extraction kit.

2. Preparation of lentivirus: the plasmid mixture was transfected in 293T cells using Lipofectamine 2000(Life Technologies) liposome introduction technology. The specific operation method is that a 10 cm cell culture dish is used for transfection, when 293T cells grow to 90% fusion degree, the following plasmids are mixed, wherein the plasmids comprise pLKO.1-shRNA, pCMV-VSV-G and pCMV-dR8.2dvpr, and the mixing ratio of the plasmids is 9: 8: 1, total DNA amounts of 12. mu.g per dish were achieved. Changing the culture medium containing antibiotics (penicillin and streptomycin) after 16-18 hours, collecting the cell culture medium by using a sterile pipette after 24 or 48 hours, centrifuging at low speed for 2000 r/min for two minutes, and storing the virus in a refrigerator at minus 80 ℃ after subpackaging in a 5-milliliter sterile centrifuge tube.

3. The cancer cell lines BT549 and HCC1806 were obtained from ATCC in the united states. These two cells were infected with lentiviruses encoding small hairpin RNAs, respectively, and after 72 hours the cells were harvested and total protein extracted. Specifically, the protein was extracted by suspending the cells in a cell lysate (20 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 1% Triton-X-100, 1% SDS, supplemented with protease and phosphatase inhibitors). And constructing a DHX33 stable deletion and expression cell line. The expression level of DHX33 protein in each sample was analyzed by immunoblotting, and the total protein loading was analyzed by anti-GAPDH antibody.

The results are shown in FIG. 1, the control group DHX33 stable expression systems shSCR-BT549 and shSCR-HCC1806 can detect DHX33 protein; the experimental group shows that almost no DHX33 protein can be detected in the DHX33 stable deletion system 1-sh-DHX33-BT549, 1-sh-DHX33-HCC1806, 2-sh-DHX33-BT549 and 2-sh-DHX33-HCC 1806.

4. In order to analyze the phenotype of cancer cells lacking DHX33, the death of the cells was observed under a microscope after the cancer cells lacked DHX33. The results are shown in FIG. 2, in the control groups shSCR-BT549 and shSCR-HCC1806, the cells without DHX33 are vigorous in growth and high in fusion degree; and two groups of cells without DHX33, namely 1-sh-DHX33-BT549, 1-sh-DHX33-HCC1806, 2-sh-DHX33-BT549 and 2-sh-DHX33-HCC1806, show very obvious death phenomena. It is demonstrated that the lack of DHX33 in cancer cells rapidly leads to cell death.

To further analyze whether the cells had apoptotic phenomenon after deletion of DHX33, the cells were further stained with annexin v. The specific method is to suspend the cells in phosphate buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na)₂HPO₄1.8 mmole KH₂PO₄) To achieve a concentration of 1 x 10 per ml⁶And (4) cells. Annexin V-FITC was then added to the cell suspension, and after 15 minutes of treatment at room temperature, the cells were filtered through a 70 μm sieve and then analyzed by flow cytometry. The results are shown in FIG. 3, the cells had obvious apoptosis phenomenon after the DHX33 is deleted, and the apoptosis proportion of the control group is small.

Example 2: DHX33 regulates important genes Bcl-2 and BAD for controlling apoptosis

Apoptosis is a programmed death process initiated by a change in the environment of a cell, either external or internal to the cell. Mitochondrial proteins play a very important role in the process of apoptosis by endogenous causes. Bak/Bax on the inner membrane of mitochondria form polymer channels, release cytochrome c in mitochondria to cytoplasm, and then initiate the generation of apoptotic bodies and the activation of caspase, thereby causing an irreversible series of protease digestion reactions and apoptosis of cells. Two proteins regulate the polymerization or activation of Bak/Bax, Bcl-2 can inhibit the activation of Bak/Bax, while BAD inhibits the activity of Bcl-2. Cancer cells typically have higher levels of Bcl-2 protein or lower levels of BAD to inhibit their apoptosis.

1. To analyze the apoptosis inhibitory effect of DHX33, two cancer cells with vigorous growth were selected in this experiment. The cancer cell lines H1299 (CRL-5803) and BT549(HTB-122) were obtained from ATCC in the United states. These two cells were treated with lentiviruses encoding small hairpin RNAs (lentiviruses cloned with sh-DHX33-1 or sh-DHX33-2, prepared in the examples used herein, and shScrambled control), respectively, and after 96 hours, the cells were harvested and total protein was extracted. Total protein was extracted as described above. The expression level of BAD and Bcl-2, important factors for apoptosis, in each sample was analyzed by immunoblotting technique.

The deletion efficiency of DHX33 and markers reflecting apoptosis were also analyzed in this example: cleaved PARP, total protein loading was analyzed with anti-tubulin antibodies. As shown in FIGS. 4 and 5, the control group shSCR-BT549 showed low BAD expression and the control group shSCR-H1299 showed high Bcl-2 expression; while the expression level of BAD is high in the 1-sh-DHX33-BT549 and the 2-sh-DHX33-H1299 which lack DHX33, and the expression level of Bcl-2 is low in the 1-sh-DHX33-H1299 and the 2-sh-DHX33-BT 549. It is proved that DHX33 has a regulation effect on genes BAD and BCL-2 for controlling apoptosis.

2. We also analyzed the expression levels of BAD and Bcl-2 messenger RNA in the above cells in the absence of DHX33. In this experiment we first extracted total RNA from the cells using the Clontech kit (Nucleospin RNA II). Messenger RNA is reverse transcribed into its corresponding complementary DNA using reverse transcriptase. The content of Bcl-2 and BAD messenger RNA in each sample was then analyzed by quantitative PCR. We chose GAPDH as an internal control and analyzed the messenger RNA content of DHX33 to determine that DHX33 has been deleted.

The PCR primers used were as follows:

human Bcl-2 (front primer) -5'-ACAGTCCCATCAAAACTCCTG-3' (SEQ ID NO: 7);

human Bcl-2 (rear primer) -5'-TTACAGGCACAGAACATCCAG-3' (SEQ ID NO: 8);

human BAD (front primer) -5'-GACCTTCGCTCCACATCC-3' (SEQ ID NO: 9);

human BAD (rear primer) -5'-AGTACTTCCGCCCATATTCAAG-3' (SEQ ID NO: 10).

The results are shown in FIG. 6, at the level of messenger RNA, a decrease in DHX33 results in a change in transcription of both genes; moreover, the lentivirus cloned with sh-DHX33-2 has a better effect of inhibiting the expression of DHX33 than the lentivirus cloned with sh-DHX 33-1.

3. To investigate the mechanism of this regulation, we further analyzed whether DHX33 protein directly regulated the transcription of BAD and Bcl-2 genes. To this end, we used chromosomal immuno-co-precipitation to analyze whether DHX33 binds to the BAD and Bcl-2 promoters. We used the human lung cancer cell line H1299, 1 x 10⁷After trypsinizing the cells, the cells were suspended in complete 10 ml DMEM medium, and after mixing with 37% formaldehyde to 1% concentration, and 10 minutes after crosslinking, 2.5 mol glycine was added to 0.125 mol concentration immediately, and the crosslinking reaction was terminated after 5 minutes of treatment. The supernatant was then removed by centrifugation at 1000 rpm for 2 minutes and the cell pellet was washed twice with phosphate buffer, as before. The cells were then lysed, in particular with 2 ml of a lysis solution containing 1% SDS, 50 mM Tris-HCl, 2 mM EDTA, 150 mM NaCl, and inhibitors of proteases and phosphatases. After the cells were lysed for 10 minutes on ice, they were fully lysed with a 40% output sonicator, and the long-chain DNA was cut to a size of 500bp-1000 bp. Centrifuging cell lysate at high speed, extracting supernatant, diluting with RIPA lysate, and separating into three uniform fractionsIn portions, 50 μ l of protein a-agarose beads were added and mixed at4 degrees for 30 minutes, followed by centrifugation to obtain a supernatant. Antibodies including anti-DHX33 antibody (Santa Cruz), anti-TBP (Santa Cruz) and IgG were added as negative controls, respectively. After incubation at4 degrees overnight for binding of antibody to antigen, 25. mu.l of protein A-Sepharose was added to bind antibody to protein A-Sepharose, and after 1 and a half hour at4 degrees, the supernatant was centrifuged off. The precipitate was washed 5 times with RIPA buffer containing 0.5 mol NaCl. The immunoprecipitates were then eluted with an eluent (0.2 molar NaOH, 1% SDS) 100 microliters each for 2 total washes. 6 mol of NaCl was added to the eluted solution to a concentration of 0.6 mol. DNA and protein were then uncrosslinked overnight at 65 degrees. After extracting the DNA fragment with the PCR product extraction kit. The efficiency of DHX33 binding to BAD and Bcl-2 promoters was analyzed by PCR.

Analysis of primer sequences for BAD and Bcl-2 promoter sequences:

human BAD promoter (Pre-primer) -5'-CCACGCTCCTCTCTCCTAT-3' (SEQ ID NO: 11);

human BAD promoter (rear primer) -5'-GGCTATGGGCGGAAGTTT-3' (SEQ ID NO: 12);

human Bcl-2 (front primer) -5'-GGGAATCGATCTGGAAATCCTC-3' (SEQ ID NO: 13);

human Bcl-2 (rear primer) -5'-CCCATCAATCTTCAGCACTCT-3' (SEQ ID NO: 14).

The results are shown in FIG. 7, where DHX33 directly acts as a transcription factor regulating the transcription of both genes.

Example 3: the c-Myc can positively regulate the mRNA and protein expression of DHX33

Cells stably expressing this protein were selected using NIH3T3 cells, treated with lentivirus encoding c-Myc, and puromycin. After 96 hours, RNA and total protein were extracted, and DHX33mRNA and protein amounts were analyzed, using total GAPDH as an internal control. The results are shown in FIGS. 8 and 9, where FIG. 8 shows the amount of DHX33mRNA and FIG. 9 shows the amount of DHX33 protein. As a result, it was found that the c-Myc-treated cells had a high content of DHX33. when the oncogene c-Myc was expressed in the cells, the cells underwent cancerous transformation, during which the protein of DHX33 was rapidly increased.

FIG. 10: the c-Myc oncogene recognizes a specific base sequence as a transcription factor, and these specific base sequences are named E-box as shown in the figure. The conserved form (Y-axis) of each base in the conserved region E-box where the c-Myc transcription factor binds to the promoter DNA.

FIG. 11: multiple E-Box are found near the proximal promoter of DHX33 by analysis, as shown in the figure, the E-Box sites and sequences contained in the proximal promoter of DHX33 gene. These analyses indicate that it is likely that c-Myc can bind directly around the promoter of DHX33 to regulate transcription of the gene for DHX33.

FIG. 12: the EMSA experiment analyzed whether the c-Myc protein bound directly to the promoter of DHX33. 1) Preparation of probes to be labeled

The 2kb promoter region pGL3 control plasmid (purchased) proximal to DHX33 was cloned and then 3E-box proximal to DHX33 was mutated using the vertex mutagenesis kit (purchased) to obtain wild-type and mutant DHX33 promoter. Probes to be labeled were prepared by PCR using pGL3 control DHX33 wild type and pGL3 control DHX33 mutant as templates and 5'-CTAGCTAGCTAGTTTGGACAGAGAAGGGGAAAAC-3' (SEQ ID NO:15) and 5'-CCGCTCGAGCGGCCCTCTCAGGTGCAGACAAC-3' (SEQ ID NO:16) as primers, respectively, and then purified using a PCR product purification kit.

2) Biotin-labeled probe

(1) Heating the labeled probe at 95 ℃ for 2 minutes, and immediately carrying out ice bath to form a single strand;

(2) the probe labeling was carried out by the following method at 37 ℃ for 30 minutes

(3) The reaction was stopped by adding 2.5. mu.l of a labeled stop solution

(4) Adding 52.5 microliters of chloroform-isoamyl alcohol (24:1), vortexing, and centrifuging for 2 minutes at 12000-14000 g to obtain a supernatant which is a single-stranded DNA probe

(5) Adding annealing buffer solution, heating to 95 ℃, and slowly cooling to room temperature to obtain the biotin-labeled EMSA probe

3) EMSA detection was performed as follows

(1) 10 ml of 4% polyacrylamide gel is prepared

(2) The following samples were prepared. The labeled probe is added and mixed uniformly, placed at room temperature for 10 minutes, and allowed to react preferentially with the cold probe, and then the labeled probe is added and mixed uniformly, and placed at room temperature for 20 minutes. Add 1. mu.L of loading buffer (10X, colorless) and mix immediately before loading. The results are shown in Table 1 below, where the following numbers are all microliter.

TABLE 1

Example 4

To further analyze the correlation between the expression of DHX33 and the expression of oncoprotein c-Myc in cancer tissues, it was shown that c-Myc may be an upstream regulatory gene of DHX33, co-infecting c-Myc and DHX33 in lung cancer tissues, and FIG. 13 shows that the expression of DHX33 and the expression of c-Myc are positively correlated in many lung cancer tissues. FIG. 13 shows that the ratio of DHX33 protein positive to C-Myc positive lung cancer tissue is about 66% (10/15), the first row of normal tissue is normal lung tissue, and the second to fourth rows of lung cancer tissue are three examples of lung cancer tissue.

To show that DHX33 is important for the carcinogenicity and the maintenance of the cancerous characteristic of c-Myc, the protein content of DHX33 is knocked down to a basic level in a cell system with c-Myc over-expression, and whether the division growth of the cell with c-Myc over-expression is inhibited after DHX33 is deleted can be seen. The specific operation process is as follows: in NIH3T3 cells, cells were treated with c-Myc overexpressing lentivirus, and then treated with lentivirus encoding shSCR control (shScrambled) and shDHX33(sh-DHX33-2), respectively, to achieve near basal levels of DHX33 in the presence of c-Myc overexpression. FIG. 14 is an analysis chart of the amounts of the respective proteins. FIG. 15 is the result of an experiment for analyzing the migration rate of transformed cells. FIG. 16 is a BrdU cell proliferation assay, and FIG. 17 is a soft agar suspension independent growth assay of cells. From fig. 15 to fig. 17, it can be found that the cancerous characteristics and growth proliferation of the cells are inhibited after the deletion of DHX33. FIG. 18: after the deletion of DHX33 in H1299 lung adenocarcinoma cells, a significant inhibition of cell mobility was observed. DAPI labeled cells had higher mobility of blue-labeled cells on the shSCR plot, whereas almost no cell migration was seen in the shDHX33 sample, with few blue-labeled cells. The right brightfield plot is the number of all cells analyzed, which is nearly identical in the control and experimental groups.

Example 5: deletion of DHX33 reduced the ability of the cells to form tumors in nude mice after transformation with c-Myc

This example is used to demonstrate the importance of DHX33 in the development of cancer due to c-Myc overexpression. Cancer cells were treated with the lentivirus prepared in example 1 to construct a stable cell line with DHX33 gene silencing. Cells were injected subcutaneously into immunodeficient mice and tumor growth was monitored. Cells with higher c-Myc can form tumors in mice, but if DHX33 is silenced to a substantial level, the cells greatly reduce the ability to form tumors in mice. Figure 19 is the loss of the ability of cells to form tumors in mice following knockdown of DHX33. FIG. 20 is a quantitative analysis of tumor cell formation in nude mice.

Example 6: comparison of the Gene silencing efficiency of sh-DHX3-2 used in the present invention with a known small RNA targeting DHX33(sh-DHX 33-1). The knockdown efficiency of DHX33 protein was seen to be very significant.

In conclusion, the studies show that DHX33 regulation is one of the downstream pathways of oncogene c-Myc, DHX33 protein expression is high in partial non-small cell lung cancer, and DHX33 and c-Myc are co-positive in partial cancer tissues (prophase, FIG. 13- -namely, example 4). Cell experiments have shown that c-Myc can positively regulate the transcription of DHX33, and that a decrease in the amount of DHX33 protein in cells transformed with c-Myc results in inhibition of cell growth and carcinogenicity (prophase, FIGS. 14-18- -example 5).

DHX33 belongs to a family of DEAH/DEAD RNA helicases, whose amino acid sequences contain seven to eight highly conserved amino acid sequences, of which DEAD/DEAH peptide fragments are an important segment. The RNA helicase family, the family of DHX33, may be involved in regulating various aspects of RNA metabolism, including RNA splicing, RNA editing, RNA degradation, mRNA translation, ribosomal RNA generation, and RNA transcription. In recent years, it has been successively discovered that many RNA helicases play an important role in the development of cancer, for example, DDX5 is highly expressed in various cancers such as breast cancer, prostate cancer and T cell leukemia and plays an important role in the development and development of cancer. DHX9(RNA helicase a) is involved in cancer growth and mediates resistance to anticancer drugs in many cancers, such as neuroblastoma and lymphoma. Our previous studies show that DHX33 plays a very important role in promoting cell growth, and can regulate the transcription activity of RNA polymerase I, thereby promoting the production of ribosomal RNA in cells (reference MCB, 2011). DHX33 can also promote cell proliferation by regulating translation of mRNA (ref. MCB2015) and is regulated by oncoproteins Ras, Akt, and oncoproteins ARF, NF1 (ref. MCB 2013)

The present application seeks to investigate the importance of DHX33 for the development of carcinogenesis from the perspective of c-Myc regulation of DHX33. In terms of molecular mechanisms, the complete function of DHX33 helicase in promoting cell growth is not only shown in promoting ribosome production and protein translation, and our research further reveals that DHX33 regulates many important apoptosis factors.

In conclusion, the DHX33 plays a crucial role in the occurrence and development of cancer, and DHX33 is a potential target site for the treatment of cancer caused by c-Myc. The application provides a new path and key molecules for overcoming cancers, and provides a new visual angle, theory and material basis for experimental development.

It is to be understood that the invention is not limited to the examples described above, but that modifications and variations may be effected thereto by those of ordinary skill in the art in light of the foregoing description, and that all such modifications and variations are intended to be within the scope of the invention as defined by the appended claims.

SEQUENCE LISTING

<110> Shenzhen Shanyue Life technology Limited

<120> small molecular RNA for treating cancer and application thereof

<160>17

<170>PatentIn version 3.5

<210>1

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223> major nucleic acid sequence of sh-DHX33-1 for gene targeting DHX33

<400>1

gctatcgcaa agtgatcatt tctcgagaaa tgatcacttt gcgatagc 48

<210>2

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223> major nucleic acid sequence of gene targeting drug sh-DHX33-2

<400>2

ttgggaagct ggttggctat actcgagtat agccaaccag cttcccaa 48

<210>3

<211>58

<212>DNA

<213> Artificial sequence

<220>

<223> sh-DHX 33-1-pre-oligonucleotide sequence

<400>3

ccgggctatc gcaaagtgat catttctcga gaaatgatca ctttgcgata gctttttg 58

<210>4

<211>58

<212>DNA

<213> Artificial sequence

<220>

<223> sh-DHX 33-1-post oligonucleotide sequence

<400>4

aattcaaaaa gctatcgcaa agtgatcatt tctcgagaaa tgatcacttt gcgatagc 58

<210>5

<211>58

<212>DNA

<213> Artificial sequence

<220>

<223> sh-DHX 33-2-pre-oligonucleotide sequence

<400>5

ccggttggga agctggttgg ctatactcga gtatagccaa ccagcttccc aatttttg 58

<210>6

<211>58

<212>DNA

<213> Artificial sequence

<220>

<223> sh-DHX 33-2-post oligonucleotide sequence

<400>6

aattcaaaaa ttgggaagct ggttggctat actcgagtat agccaaccag cttcccaa 58

<210>7

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223> human Bcl-2 Pre-primer

<400>7

acagtcccat caaaactcct g 21

<210>8

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223> human Bcl-2 rear primer

<400>8

ttacaggcac agaacatcca g 21

<210>9

<211>18

<212>DNA

<213> Artificial sequence

<220>

<223> human BAD Pre-primer

<400>9

gaccttcgct ccacatcc 18

<210>10

<211>22

<212>DNA

<213> Artificial sequence

<220>

<223> human BAD rear primer

<400>10

agtacttccg cccatattca ag 22

<210>11

<211>19

<212>DNA

<213> Artificial sequence

<220>

<223> human BAD promoter pre-primer

<400>11

ccacgctcct ctctcctat 19

<210>12

<211>18

<212>DNA

<213> Artificial sequence

<220>

<223> human BAD promoter rear primer

<400>12

ggctatgggc ggaagttt 18

<210>13

<211>22

<212>DNA

<213> Artificial sequence

<220>

<223> human Bcl-2 promoter pre-primer

<400>13

gggaatcgat ctggaaatcc tc 22

<210>14

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223> human Bcl-2 promoter rear primer

<400>14

cccatcaatc ttcagcactc t 21

<210>15

<211>34

<212>DNA

<213> Artificial sequence

<220>

<223> PCR primers for DHX33 promoter

<400>15

ctagctagct agtttggaca gagaagggga aaac 34

<210>16

<211>32

<212>DNA

<213> Artificial sequence

<220>

<223> PCR primers for DHX33 promoter

<400>16

ccgctcgagc ggccctctca ggtgcagaca ac 32

<210>17

<211>21

<212>RNA

<213> Artificial sequence

<220>

<223> Small RNA molecule sequence having effect of knocking down protein content of DHX33

<400>17

ttgggaagct ggttggctat a 21

Claims (2)

1. A small RNA for treating lung adenocarcinoma, which has the function of knocking down the protein content of DHX33 and has the sequence: TTGGGAAGCTGGTTGGCTATA are provided.

2. The use of the small molecule RNA according to claim 1 for the preparation of a medicament for the treatment of lung adenocarcinoma, which is caused by the amplification or activation of the oncogene c-Myc.

Images