CN108330071A - Have Strain of Beauveria bassiana and its control of insect application of insect gut infection effect - Google Patents
Have Strain of Beauveria bassiana and its control of insect application of insect gut infection effect Download PDFInfo
- Publication number
- CN108330071A CN108330071A CN201710043852.2A CN201710043852A CN108330071A CN 108330071 A CN108330071 A CN 108330071A CN 201710043852 A CN201710043852 A CN 201710043852A CN 108330071 A CN108330071 A CN 108330071A
- Authority
- CN
- China
- Prior art keywords
- insect
- beauveria bassiana
- spore
- composition
- pest
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
Abstract
The Strain of Beauveria bassiana for having insect gut infection effect the present invention relates to one plant and its control of insect application.Specifically, the present invention relates to beauveria bassianas (Beauveria bassiana) or its spore, mycelium or tunning that microbial preservation number is CGMCC No.13180, including composition of the bacterial strain or its spore and preparation method thereof and their applications in pest control.The bacterial strain and composition of the present invention uniquely plays the synergistic function of pest control (such as Lepidoptera and dipteral insect) by enteric infection and enteron aisle body wall double infection, is with a wide range of applications.
Description
Technical field
The invention belongs to biotechnologys and pesticide field.The present invention relates to it is a kind of have both enteron aisle virulence and body wall infection kill
Worm fungi new strains and its application in control of insect, and in particular to the beauveria bassiana new strains infected by insect anterior intestine
And its application in agricultural and entomophila control of insect.
Background technology
Insect is on earth in occupation of the population quantity of advantage, wherein there is many pests to cause the existence of the mankind and health
Great threat, such as cause crop production reduction, endanger forest development, spread the disease etc. (Pedigo＆Rice, 2014,
Entomology and pest management(Waveland Press).)。
Lepidoptera pest is the most mesh, such as pine moth, black cutworm, prodenia litura etc. of agriculture and forestry injurious insect, every year
It is required for the prevention for putting into a large amount of manpower, material resources and financial resources for pest, to reduce its harm.In addition, mosquito matchmaker's disease is a kind of tight
The disease, such as malaria, dengue fever, stockaded village's card and yellow fever etc. for threatening human health again all cause several hundred million people's infection and hundred every year
The death of ten thousand people.In view of the getting worse for lacking effective vaccine and drug resistance, the main method of control mosquito matchmaker's disease is
Its route of transmission is cut off, that is, reduces the quantity of mosquito.
Currently, the method that control of insect depends on chemical prevention, but with a large amount of uses of chemical pesticide, to people
The living environment of class causes prodigious pollution, and the pesticide residue in agricultural and sideline product brings great danger to the health of the mankind
Evil.Also, the problem of pest resistance, is also on the rise, and limits the application of chemical pesticide.
Compared with chemical prevention, biological control have many advantages, such as safely, effectively, it is lasting.In recent years, the method for biological control
It is more and more used for control of insect, natural enemies of insects, parasite or pathogenic bacteria, realization is mainly utilized to have pest for a long time
The control (Lorito, 2016, Annual Review of Phytopathology, 55) of effect.
In biological insecticides, biocontrol fungi preparation is most widely used, it is wide with host range, safety is good,
The advantages that being easy to produce and is formulation is used for the prevention of pest as biological insecticides earliest.From 1960, it to be used for biological control
Fungus insecticide product have 171, be mainly derived from：Beauveria bassiana (Beauveria bassiana), muscardine
(Beauveria brongniartii), green muscardine fungus (Metarhizium anisopliae) and fumosorosea (Isaria
funosorosea)(de Faria&Wraight,2007,Biological Control,43,237-256.).Currently, insect
Disease fungus is worldwide widely studied and is applied as a kind of important biological control means.
Beauveria bassiana and Luo Baici green muscardine fungus have been developed that into the prevention that several formulations are applied to agriculture and forestry injurious insect, but field
Between control effect restricted by environmental factor it is bigger.The summer especially largely broken out in pest, high temperature, intensive ultraviolet etc. because
Element can influence the survival rate and insecticidal toxicity of fungi, often result in that microbial inoculum control effect is unstable, and becoming influences fungi desinsection
The important limiting factor of agent promotion and application, also become international significant technology issues (Arthurs, 2001,
Entomologia Experimentalis et Applicata,100,69-76；Braga,2001,Photochemistry
and Photobiology,73,140-146；Jaronski,2009,In The ecology of fungal
entomopathogens(Springer),pp.159-185.)。
So far, the comparison that the process of insect pathogenic fungus integument invasion host infection and insecticidal mechanism have been studied is clear
Chu in turn results in the death (Ortiz-Urquiza＆ of host typically by the haemocoele of body wall penetrating infection host insect
Keyhani,2013,Insects,4(3),357-374.).Entire infection processs includes mainly conidium and host insect body
Wall adherency, spore germination, mycelia penetrates body wall, mycelia enters these stages of insect hemolymph mass propagation, final insect place
Main cause nutrition is largely exhausted and dead.It is entire to infect that the period is long, and larger by such environmental effects, this is also that fungi kills
A unstable important factor of worm agent control effect.
Since insect gut milieu is stablized relatively, can to avoid the influence of ambient climate condition, the alimentary canal at
For the main path of bacterium and virus infection.Insect gut is considered as the important place of pathogenic microorganism and host's interaction, especially
It is the important target position (Sober ó n et al., 2007, Science, 318,1640-1642) of the intrusion polypide such as virus, bacterium.
Bacterium or virus enter insect gut by ingesting, and funnel is the important barrier of bacterium enteric infection host.It causes a disease
Bacterium would generally synthesize chitinase help its penetrate funnel (Kelkenberg, Odman-Naresh,
Muthukrishnan,&Merzendorfer,2015,Insect Biochemistry and Molecular Biology,
56,21-28.), while various enzymes and detoxifying function are secreted in midgut epithelial cell, eventually enter into the haemocoele of insect, cause elder brother
Death (Richards the and Goodrich-Blair, 2010, Applied and Environmental of worm host
Microbiology,76,221-229.)。
For a long time, Many researchers, which are attempted to find, can pass through the high virulence disease fungus of enteric infection insect.But
Biocontrol fungi is generally deficient of special enteron aisle virulence factor, can only be infected by contact host by body wall.In recent years, with Filamentous true
Bacterium gene manipulation techniques are constantly progressive, and the genetic manipulation of fungi and genetic improvement research make great progress.Especially
The intestines toxalbumin VipAal of the Vip3A families of secreted from bacillus thuringiensis is imported to the transgenic engineered bacteria of beauveria bassiana
Strain, which give certain enteron aisle insecticidal activity, the realization for the double approach infection of insect pathogenic fungus has carried out good trial
(Qin et al.,2010,Applied and Environmental Microbiology,76,4611-4618.)。
Although in conclusion insect pathogenic fungus as a kind of important biological insecticides, especially beauveria bassiana and
Luo Baici green muscardine fungus has been developed that into several formulations and is applied to the prevention of agriculture and forestry injurious insect, but is infected in view of single insect body wall
Approach, field control effect is by the very big restriction of environmental factor, and limitation fungus insecticide large-scale promotion application
Technical bottleneck and international headache urgently to be resolved hurrily.So far, related insect pathogenic fungus passes through enteric infection host insect
Example is considerably less, the research of specific molecular mechanism or blank.In order to solve the limiting factor of biocontrol fungi in the application, seek
Look for the novel strain with enteron aisle virulence that will effectively expand the development and application of biocontrol fungi, this also has biological control non-
Often important meaning.
Invention content
Present invention provides just a kind of novel strains with enteron aisle virulence.
In some aspects of the invention, a kind of beauveria bassiana (Beauveria bassiana) is provided, wherein institute
The microbial preservation number for stating beauveria bassiana is CGMCC No.13180.
In certain embodiments of the present invention, there is the beauveria bassiana insect gut to infect virulence.
In certain embodiments of the present invention, the beauveria bassiana carries out enteric infection by the anterior intestine of insect.
In certain embodiments of the present invention, the beauveria bassiana has enteron aisle to Lepidoptera and Diptera pest
Infect the feature of virulence.
The present invention other in terms of in, provide a kind of insect control compositions, it includes：
(a) beauveria bassiana as described herein and/or its spore, mycelium or its tunning；
(b) acceptable carrier and/or adjuvant in Pesticide Science.
In certain embodiments of the present invention, the composition is adapted for through insect gut desinsection or through insect gut body
The dosage form of wall composite insecticidal.
In certain embodiments of the present invention, the composition is the dosage form that control effect is played by insect intake.
In certain embodiments of the present invention, the composition carries out enteric infection by insect anterior intestine.
In certain embodiments of the present invention, the dosage form of the composition is selected from：Solution, liquid suspension, is done missible oil
Suspending agent, wettable powder, dry powder doses, granula, aqua, poison bait, microcapsule formulations.
In certain embodiments of the present invention, the insect is selected from：Lepidoptera, Diptera or other classification insects, example
Such as the moth pests or butterfly-class pest, as pine moth, cutworm, prodenia litura, small heart-eating peach worm, smaller apple leafrol- ler, bollworm,
Cabbage butterfly, diamondback moth, snout moth, gelechiid, phthorimaea operculella, brachmia triannuella；Mosquito class, flies, horsefly class, buffalo gnat class, such as anopheles, library
Mosquito, housefly, flowerfly, latrine fly, rotten fly, stings fly, tsetse fly, calliphorid, sarcophagid, botfly, torsalo, stomach fly, hippoboscid, the gadfly, shakes at yellow-fever mosquito
Mosquito dislikes buffalo gnat, Simulium neavei, simulium ochraceum, golden buffalo gnat, Amazon buffalo gnat, the big buffalo gnat of spot, bright chest Ji buffalo gnat, brown foot dimension buffalo gnat, huge special buffalo gnat；Wherein, it is described its
Its classification insect includes but not limited to：Orthopteran, coleopteron, isoptera insect etc., such as locust, cockroach, cockchafer
Son, longicorn and termite etc..
In certain embodiments of the present invention, the carrier and/or adjuvant are selected from：Solvent, wetting agent, dispersant, breast
Agent, stabilizer, adhesive, filler, controlled release auxiliary agent, synergist, sticker, spreader-sticker, anti-drift agent, safener, antidote,
Antifoaming agent, spray adjuvants, warning coloration, attractant, antifreezing agent.
In certain embodiments of the present invention, the composition also includes one or more components selected from the group below：Agriculture
Medicine, plant growth regulator, fertilizer and soil conditioner.
In some aspects of the invention, the method for producing composition as described herein is provided, the method includes：
It cultivates, be proliferated or ferment beauveria bassiana as described herein, to obtain beauveria bassiana as described herein or its spore
Son, mycelium or tunning；
Products therefrom is mixed with acceptable carrier and/or adjuvant in Pesticide Science.
In some embodiments, the fermentation is selected from：Liquid state fermentation, solid state fermentation, liquid-solid two-phase fermentation.
In some embodiments, the method further includes being detached, being purified to culture, proliferation or tunning, reflected
Fixed, concentration and/or storage.
In some aspects of the invention, a kind of method of pest control is provided, the method includes：
By beauveria bassiana as described herein or its spore, mycelium or tunning or composition as described herein
Pest is applied to haunt or it is expected that the place for having pest to haunt.
In certain embodiments of the present invention, described to have that pest haunts or it is expected that the place for having pest to haunt is selected from the group
In one or more：Farmland, vegetable plot, orchard, the woods, pasture, warehouse, shelter, waters.
In certain embodiments of the present invention, the application, which passes through, sows, sprays, sprinkling and pour, fumigate, mix soil, seed dressing, apply
Brush.
In some aspects of the invention, beauveria bassiana described herein or its spore, mycelium or fermentation are additionally provided
The application of product or composition as described herein in pest control.
Those skilled in the art can carry out technical solution above-mentioned and technical characteristic arbitrary combination without departing from this hair
Bright inventive concept and protection domain.The other aspects of the present invention are due to this disclosure, to those skilled in the art
For be obvious.
Description of the drawings
The invention will be further described below in conjunction with the accompanying drawings, and wherein these show only for illustrating the reality of the present invention
Scheme is applied, rather than in order to limit to the scope of the present invention.
Fig. 1：Colonial morphologies of the beauveria bassiana Bb-bm01 on SDAY culture mediums.
Fig. 2：With micropipettor oral Gavage silkworm beauveria bassiana Bb-bm01 spore suspensions.
Fig. 3：Beauveria bassiana Bb-bm01 enteric infection silkworm toxicity tests.
A：With the death rate of the Bb-bm01 spore oral Gavage silkworms of different number；
B：The death rate of beauveria bassiana Bb-bm01, Bb2860 and Bb252 oral Gavage silkworm；
C：The death rate of beauveria bassiana Bb-bm01 enteric infection silkworms mature larva (the 4th day five ages), wherein photo
It show mycelia growing state after the silkworm larva handled through Bb-bm01 is pupated.
Fig. 4：The death rate of beauveria bassiana Bb-bm01 enteric infections beans pellet, wherein photo are shown with Triton X-
Red and after Bb-bm01 processing is dead in three days beans pellets the mycelia growth of the beans of 100 processing.
Fig. 5：The infection of beauveria bassiana Bb-bm01 body walls, enteric infection and body wall and enteron aisle compound infection silkworm it is dead
Die rate.
Fig. 6：The death rate of beauveria bassiana Bb-bm01 enteric infection anopheles stephensis, wherein photo are shown through Bb-bm01
Mycelia growth after processing is dead in three days anopheles stephensis.
Fig. 7：Anterior intestine paraffin section PAS dyes micro- sem observation after beauveria bassiana Bb-bm01 spore oral Gavage silkworms.
A：200 times of amplification；B：400 times of amplification.
Fig. 8：The virulence of beauveria bassiana Bb-bm01, Bb2860 and Bb252 body wall infected silkworm compares.
Specific implementation mode
Provide that a kind of (such as agriculture and forestry injurious insect and entomophila pest, especially lepidoptera pest are (as serious to insect in the present invention
Harm the crops and the lepidoptera pests such as forest) and Diptera pest (such as propagation malaria dengue fever and yellow fever mosquito matchmaker's disease
The Diptera pest of disease) have both the beauveria bassiana new strains Bb-bm01 that enteron aisle and the double approach of body wall infect.The present invention is also simultaneously
Provide a kind of approach parsing of Bb-bm01 enteric infections insect.
By the enteron aisle virulence test to beauveria bassiana Bb-bm01, show Bb-bm01 to lepidoptera pest, Diptera
Pest etc. all has enteric infection virulence.By tissue section strain observation demonstrate Bb-bm01 by insect anterior intestine position into
The new way of row enteric infection.Also, Bb- is effectively improved by body wall and the double approach compound infection host insects of enteron aisle
The insecticidal toxicity of bm01.Bb-bm01 of the present invention thus can be made to biological insecticides, be used for the prevention of pest.To make worm
The product of raw fungus insecticide is more persistently effective, reduces the use of chemical pesticide, has important application value.
Beauveria bassiana new strains Bb-bm01 and Microorganism Deposit Information
The beauveria bassiana new strains Bb-bm01 of the present invention is the ball spore that inventor isolates and purifies from silkworm bombys batryticatus
Muscardine new strains.There is the bacterial strain insect gut to infect virulence after tested, thus can be double via enteric infection and enteron aisle body wall
Double infection contaminates pest control, and Synergistic insecticidal effect is formed between both approach.Also, Bb-bm01 is only just to the body wall of insect
Also it has been better than other known in the art or common beauveria bassianas for infection virulence.
The Bb-bm01 bacterial strains of the present invention are sent on November 22nd, 2016 to China Committee for Culture Collection of Microorganisms
Common micro-organisms center (CGMCC) carries out microbial preservation, and preserving number is CGMCC No.13180, and qualification result is survival.
Composition and its preparation
The present invention also provides the composition for including bacterial strain of the present invention, the composition can be used for the prevention of insect pest, packet
Contain：Beauveria bassiana Bb-bm01 or its spore, mycelium or its tunning or the extract of the present invention；With can in Pesticide Science
The carrier and/or adjuvant of receiving.
As used herein, term " active material of the invention " or " pest control active material of the invention " is interchangeable makes
With, refer to the present invention beauveria bassiana Bb-bm01 or its spore, mycelium or its tunning or its extract.
Method conventional in the art can be used to cultivate the bacterial strain of the present invention, be proliferated, ferment, collect.Such as
The bacterial strain of the present invention can be cultivated and is proliferated in culture medium appropriate, the culture medium can be liquid or solid culture medium, including
But it is not limited to：SDAY、PDA、SDB.Can be added in basal medium as needed carbon source appropriate, nitrogen source, trace element and
PH adjusting agent etc..
The beauveria bassiana of the present invention can also generate different types of spore or their mixing under different condition of culture
Object, such as generate blastopore (blastospores) and conidium (conidia).Under liquid culture condi, ball spore is white
Stiff bacterium is easy to generate blastopore.Blastopore cell wall is thin, and anti-adversity is poor, is easy inactivation.Under the conditions of solid culture, ball
Beauveria bassiana generates conidium, and conidium cell wall thickness has more biological stability under usual conditions than blastopore.It is logical
Chang Eryan, the conidium of beauveria bassiana than blastopore to the resistance of poor environment more preferably, therefore it is excellent in pest control
Choosing uses its conidium.But under specific condition or specific controlling object, it is possible to use blastopore.
For the zymotechnique of beauveria bassiana, such as liquid deep layer fermenting, solid state fermentation and liquid-solid two-phase hair can be used
The methods of ferment, wherein it is preferred that using liquid-solid two-phase fermentation method.Liquid-solid two-phase ferments
Refer to, quickly produces a large amount of mycelia or blastopore by liquid fermentation first, inoculate Solid nutritional or inert base is enterprising
Row solid fermentation makes it generate closest to the raw conidium of gas for being inoculated with volume morphing naturally.The technique combines deep liquid hair
Ferment and solid state fermentation have given full play to the strong point of the two, overcome the blastopore environmental stability of simple liquid fermenting and producing
The shortcomings of poor, has maximally utilised generation gas sporogenic advantage estranged on the surface of solids, while shortening mycelia growth
In the period, production method is easy, and raw material is easy to get, and energy consumption cost is low.Therefore it is widely used in the conidial life of insect pathogenic fungus
Production.
Also include acceptable carrier and/or adjuvant in Pesticide Science in the present composition.As used herein, term " agriculture
It is pharmaceutically acceptable " ingredient be suitable for pesticide, without to active material activity generate excessively dysgenic object
Matter.As used herein, term " effective quantity " refers to the amount that can have to targeted insect preventive and therapeutic effect.It is " acceptable in Pesticide Science
Carrier and/or auxiliary material " refers to natural or synthetic organic or inorganic substance, and the active constituent is in connection in favor of will be active
Ingredient is used for plant.Therefore, carrier is typically inert and is agriculturally acceptable, especially in processed plant
On, such as can be solid (clay, natural or synthetic silicate, silica, resin, wax, solid fertilizer etc.) or liquid
(water, alcohols, ketone, petroleum distillate, aromatic hydrocarbons or alkane, chlorinated hydrocabon, liquefied gas etc.).These carriers or auxiliary material itself are not must
The active constituent wanted, and excessive harmful effect will not be generated to the activity of necessary active material.
Carrier and/or auxiliary material in the composition of the present invention may include but be not limited to：Solvent, wetting agent, dispersant, emulsification
Agent, adhesive, filler, controlled release auxiliary agent, synergist, sticker, spreader-sticker, anti-drift agent, safener, antidote, disappears at stabilizer
Infusion, spray adjuvants, warning coloration, attractant.
It also may include other one or more active matters in addition to the active material of the present invention in the composition of the present invention
Matter.Such combination can provide certain advantage, such as, but not limited to：Synergistic effect is generated to pest control, reduces insecticide
Rate of application, reduce to the harm of environment, improve operator safety, wide spectrum preventive and therapeutic effect is provided, makes the toxicity to plant
Safe, the tolerance for improving non-pest species (such as mammal and fish).
Other active materials that can be used in the present composition include but not limited to：Other pesticides, plant growth regulating
Agent, fertilizer, soil conditioners or other agricultural chemicals.
In some embodiments, active material of the invention can be applied with other one or more pesticide combinations, described
Other pesticides include but not limited to：Organic phosphate insecticide, such as chlopyrifos, diazinon, Rogor, malathion, one or six O of methyl
Five and Terbufos；Pyrethroid insectide is such as：Kill pyrethroids (fenvalerate), decis, Fenpropathrin, fluorine chlorine
Cyano chrysanthemate, flucythrinate, Biphenthrin, cypermethrin, soluble chlorine flucythrinate, ethofenprox, S- fenvalerates, tetrabromo chrysanthemum
Ester, Tefluthrin, cycloprothrin ,-cyfloxylate and acrinathrin；Carbamate insecticides, such as：Aldicarb,
Carbaryl, carbofuran and Methomyl；Organochlorine insecticide such as 5a,6,9,9a-hexahydro-6,9-methano-2,4, endrin, heptachlor and lindane；Benzoyl area kind
Insecticide is such as：Diflubenzuron, insecticidal lung, Teflubenzuron, UC 62644, flubenzuron, flufenoxuron and lufenuron；And other desinsections
Agent, such as：Double worm amidines, four worm mites, fenpyroximate, Hexythiazox, pleocidin and imidacloprid；Nematicide, such as carbofuran, fourth
Carbosulfan, Aldicarb, phonamiphos, worm amine phosphorus, oxamyl, isazofos, cadusafos.
In some embodiments, active material of the invention can with one or more plant growth regulator etc its
Its substance is applied in combination, and the plant growth regulator includes for example：Maleic hydrazide, cycocel, ethephon (CEPHA),2-(chloroethyl) phosphonic acid, gibberellin, chlormequat chloride,
Disleave spirit, inabenfide, triapenthenol, paclobutrazol, uniconazole P, DCPA, condensed ring acid and other plant growth regulator.
In some embodiments, active material of the invention can be administered in combination with one or more soil conditioners, institute
Stating soil conditioners includes：The organic matter of humus etc can promote the retentivity of soil middle-jiao yang, function of the spleen and stomach ion plant nutrition；Sun from
The mixture of sub- nutrient, such as the complex of calcium, magnesium, caustic potash, sodium and hydrogen；Or it can promote to be conducive to the edaphic condition of plant growth
Microbial composite.Such microbial composite includes but not limited to：Rod bacterium, pseudomonad, nitrogen-fixing bacteria, fixed nitrogen spiral shell
Bacterium, rhizobium and soil-borne cyanobacteria.
In some embodiments, active material of the invention can be applied with one or more Fertilizer Combinations.The fertilizer
Including but not limited to：Nitrogenous fertilizer, such as ammonium sulfate, ammonium nitrate and bone meal；Phosphate fertilizer, as perphosphate, triple perphosphates, ammonium sulfate and
Sulfuric acid diammonium；Potash fertilizer, such as the chloride, potassium sulfate and potassium nitrate of caustic potash.
The composition of the present invention can be the various forms for being suitable for preparation, preservation and application.The dosage form of composition can be selected from：It is molten
Liquid, missible oil, liquid suspension, dry suspending agent, wettable powder, dry powder doses, granula, aqua, poison bait, microcapsule formulations.For example, this
The composition of invention can be liquid, can be the form of concentrate composition, or be easy to be sprayed on plant to be processed
Diluted composition.
In certain embodiments of the present invention, composition of the invention is adapted for through insect gut desinsection or through insect intestines
The dosage form of road body wall composite insecticidal.In certain embodiments of the present invention, the composition be by insect intake play it is anti-
Control the dosage form of effect.In certain embodiments of the present invention, the composition is infected by insect gut.
The application of bacterial strain and composition
The bacterial strain and composition of the present invention can be used for the prevention of pest by enteric infection or enteron aisle body wall compound infection.
Can include but not limited to the insect of bacterial strain of the present invention or composition for preventing and controlling：Lepidoptera, Diptera or other classifications
Insect, such as the moth pests or butterfly-class pest, as pine moth, cutworm, prodenia litura, small heart-eating peach worm, smaller apple leafrol- ler,
Bollworm, cabbage butterfly, diamondback moth, bag moth, slug moth, Io moth, geometrid moth, snout moth, lappet moth, boat moth, fall webworms, Chinese scholar tree ruler
Moth, snout moth, gelechiid, phthorimaea operculella, brachmia triannuella etc.；Mosquito class, flies, horsefly class, buffalo gnat class, such as anopheles, culex, yellow-fever mosquito, family
Fly, latrine fly, rotten fly, stings fly, tsetse fly, calliphorid, sarcophagid, botfly, torsalo, stomach fly, hippoboscid, the gadfly, midge, dislikes buffalo gnat, crab at flowerfly
Buffalo gnat, simulium ochraceum, golden buffalo gnat, Amazon buffalo gnat, the big buffalo gnat of spot, bright chest Ji buffalo gnat, brown foot dimension buffalo gnat, huge special buffalo gnat etc..Other classification insects include but
It is not limited to：Locust, cockroach, chafer, longicorn and termite etc..
The bacterial strain of the present invention or composition can be applied to pest to haunt or it is expected that the place for having pest to haunt, to disappear
Remove, mitigate or prevent the insect pest caused by the pest.For example, can farmland (example be applied to for the bacterial strain of the present invention or composition
Such as cereal, cotton, vegetables and the crop plant area of fruit growth or the area for waiting planting these crops), the woods (such as with
Protected in forestry), pasture, warehouse, shelter, the needs such as waters place.Also the bacterial strain of the present invention or composition can be used for beast
Medicine field, such as the internal and external parasite for effectively controlling puzzlement animal, such as mosquito, fly, horsefly insect are created disturbances to..
The method of application of bacterial strain or composition of the present invention can be to sow, spray, sprinkling and pour, fumigate, mix soil, seed dressing, brush etc..
Those of ordinary skill in the art can need to select suitable dosage form and corresponding method of application according in practical application.
In addition, also can be as needed, the bacterial strain of the present invention or composition are applied with other active substance combinations, with additional
Certain advantage is provided, such as, but not limited to：Synergistic effect, the rate of application for reducing insecticide, reduction pair are generated to pest control
The harm of environment, the safety for improving operator provide wide spectrum preventive and therapeutic effect, make the toxicity safe to plant, improve non-evil
The tolerance of worm species (such as mammal and fish).Other active matters that can be applied with bacterial strain of the present invention or combination of compositions
Matter includes but not limited to：Other pesticides, plant growth regulator, fertilizer, soil conditioners or other agricultural chemicals are (as above
It is described).It can simultaneously, continuously or alternately apply the active material and other active materials of the present invention.
All numberical ranges provided herein be intended to include clearly fall all numerical value between endpoints of ranges and it
Between numberical range.The feature that the feature or embodiment that can be mentioned to the present invention are mentioned is combined.This specification is taken off
All features shown can be used in combination with any composition form, and each feature disclosed in specification any can provide phase
The alternative characteristics substitution of same, impartial or similar purpose.Therefore it is only impartial or similar except having special instruction, revealed feature
The general example of feature.
As used herein, " containing ", " having " or " comprising " include "comprising", " mainly by ... constitute ", " substantially
By ... constitute " and " by ... constitute "；" mainly by ... constitute ", " substantially by ... constitute " and " by ... constitute "
Belong to the subordinate concept of " containing ", " having " or " comprising ".
Recorded in herein is only several embodiments of the present invention.Those skilled in the art can not depart from this hair
Under the premise of bright spirit and design, various combinations, change or modification, such equivalent forms are made to the present invention and equally fall within this Shen
It please the appended claims limited range.
Embodiment
Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention
Rather than it limits the scope of the invention.Those skilled in the art can make the present invention modification appropriate, variation, these modifications
It is within the scope of the present invention with variation.
In the following examples, the experimental methods for specific conditions are not specified, the conventional method in this field can be used, such as join
It examines《Molecular Cloning:A Laboratory guide》(third edition, New York, CSH Press, New York：Cold Spring
Harbor Laboratory Press, 1989) or according to the condition proposed by supplier.The sequencing approach of DNA is that this field is normal
The method of rule also can provide test by commercial company.
Unless otherwise stated, otherwise percentage and number are calculated by weight.Unless otherwise defined, all used in text
Professional and scientific terms have the same meanings as commonly understood by one of ordinary skill in the art.In addition, any similar or equal to described content
Deng method and material can be applied to the method for the present invention.Preferred implement methods and materials described herein only present a demonstration it
With.
The separation and identification of 1. bacterial strain Bb-bm01 of embodiment
Bacterial strain Bb-bm01 of the present invention is the beauveria bassiana (Beauveria isolated and purified from silkworm bombys batryticatus
Bassiana) new strains.Bb-bm01 is screened especially by following method and is obtained：Aseptically, whole body is covered with into white bacterium
The stiff silkworm of silk, which is put into above sterilized SDAY culture medium flat plates, gently shakes, and SDAY tablets are then placed in 27 DEG C of incubators
Middle culture 3~4 days, picking single bacterium drops down onto pure medium (SDAY), and purifying culture is carried out in 27 DEG C of incubators.It was found that one plant of class
Bacterium colony of the bacterial strain on SDAY culture mediums like beauveria bassiana is round in velveteen shape, and color gradually becomes milky white or light by white
Yellow, mycelia is fluffy, and bisque is loose, is named as Bb-bm01 (Fig. 1).
Bb-bm01 is sent on November 22nd, 2016 into China Committee for Culture Collection of Microorganisms's common micro-organisms
The heart (CGMCC) carries out microbial preservation, and preserving number is CGMCC No.13180, and qualification result is survival.
Genome DNA extraction is carried out from the mycelia of SDAY culture medium picking bacterial strains Bb-bm01, PCR amplification ITS is (between internal transcription
Septal area, internal transcribed spacer) sequence, Bb-bm01 is identified by sequence alignment.PCR amplification special primer
For：
ITS-F(SEQ ID NO:1):5'-TCCGTAGGTGAACCTGCTGAGGGAT-3'；
ITS-R(SEQ ID NO:2):5'-TCCTCCGCTTATTGATATGCTTAA-3'。
The length for expanding the Bb-bm01 ribosomal DNA-ITSs obtained is 569bp；PCR product is cloned into pMD-18T to carry
On body (Takara), it is sent to Shanghai Sheng Gong bioengineering Co., Ltd and is sequenced.It is (SEQ by the way that obtained DNA sequence dna is sequenced
ID NO:3)：
TCCGTAGGTGAACCTGCTGAGGGATCATTACCGAGTTTTCAACTCCCTAACCCTTCTGTGAACCTACCT
ATCGTTGCTTCGGCGGACTCGCCCCAGCCCGGACGCGGACTGGACCAGCGGCCCGCCGGGGACCTCAAACTCTTGTA
TTCCAGCATCTTCTGAATACGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGC
ATCGATGAAGAACGCAGCGAAACGCGATAAGTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCA
CATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACCTCCCCTTGGGGAGGTC
GGCGTTGGGGACCGGCAGCACACCGCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGCAGTAAT
ACAGCTCGCACCGGGACCCCGACGCGGCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGAATCAGGTAGG
ACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA
Sequencing result and NCBI gene databases are compared into display Bb-bm01 ribosomal DNA-ITSs sequence and NCBI data
More plants of Strain of Beauveria bassiana ribosomal DNA-ITS sequence homologies in library may be up to 99%, this is the result shows that Bb-bm01 is
Beauveria bassiana (Beauveria bassiana).
Meanwhile also further demonstrating that Bb-bm01 is different from known beauveria bassiana by the measurement of ITS sequence and analysis
Bacterial strain.
The method of 2. oral Gavage insect beauveria bassiana spore of embodiment
The present invention establishes a kind of method of oral Gavage insect beauveria bassiana.It is with Lepidoptera model animal silkworm
Example：
The fresh beauveria bassiana spore suspension of a certain concentration is prepared with 0.01%Triton X-100 sterile waters.Choose five
The silkworm larva in second day age.1 μ l spore suspensions are drawn, slowly in the head of fixed larva with micropipettor (Gilson, P2)
It is injected into the mouth of silkworm larva (Fig. 2).Whole process avoids spore suspension from touching larva mouthpart and body wall, prevents ball spore
The spore of muscardine passes through body wall infected insect.Then it is placed into 27 DEG C of temperature, in the incubator of humidity 30-40%, and
The new fresh mulberry leaf of feeding.
Enteric infections of the 3. beauveria bassiana Bb-bm01 of embodiment to lepidopterous larvae
Beauveria bassiana Bb-bm01 is inoculated on SDAY culture mediums, cultivates 10 days in 27 DEG C of incubators, then uses
0.01% Triton X-100 sterile waters are made into conidiospore suspension, measure spore concentration with blood counting chamber, are made into 1 respectively
×109、1×108、1×107、1×106、1×105、1×104The spore suspension of a spore/ml (conidia/ml) concentration.
A. it is directed to silkworm P50 strains second day five age larva
It takes silkworm P50 strains second day five age larva and carries out beauveria bassiana Bb-bm01 enteron aisle toxicity tests, silkworm children
The rearing conditions of worm are 27 DEG C of temperature, humidity 40%.The Bb-bm01 spore suspensions for taking 1 μ l various concentrations respectively, utilize micro shifting
Liquid device oral Gavage silkworm P50 second day five age larvas, the Triton X-100 that blank control is 0.01%.Every group of 30 boss silkworms
Larva, three repetitions of each concentration record the death condition of larva daily.Enteron aisle toxicity test result is shown：Bacterial strain Bb-bm01
There is enteropathic to silkworm larva, when every boss silkworm feeds 10000 spores, silkworm larva is all dead after five days, and
Control group silkworm larva is without dead (Fig. 3 A).
Meanwhile we also often (are purchased from the U.S. to other two plants of laboratories with Strain of Beauveria bassiana Bb2860 and Bb252
Ministry of Agriculture insect pathogenic fungus collection ARSEF) enteron aisle toxicity test has been carried out, silkworm larva rearing conditions are as above.Respectively
Take 1 μ l a concentration of 1 × 108The spore suspension of Bb-bm01, Bb2860 and Bb252 of a spore/ml, utilize micropipettor
(Gilson, P2) oral Gavage silkworm P50 second day five age larvas, the Triton X-100 that blank control is 0.01%.Every group
30 boss's silkworm larvas, three repetitions of each concentration record the death condition of larva daily.Enteron aisle toxicity test result is shown：Bacterium
Strain Bb2860 and Bb252 does not have enteropathic (Fig. 3 B) to silkworm larva.
B. it is directed to silkworm mature larva (the 4th day five ages of silkworm P50 larva)
In addition to this, with 1 μ l a concentration of 1 × 107A spore/ml Bb-bm01 oral Gavage silkworm mature larva (silkworms
The 4th day five age of P50 strains larva), the Triton X-100 that control group is 0.01%, every group of 30 boss's silkworm larvas, three groups of weights
It is multiple.Toxicity test is the results show that Bb-bm01 also has enteric infection virulence to mature larva, and silkworm is all dead after infection 6 days
(Fig. 3 B)；Also, after silkworm larva is pupated, it can be seen that Bb-bm01 mycelia grows since the head of pupa, then slowly grows
Full whole body (Fig. 3 C).
C. it is red (killing bean hawkmoth larva) that beans are directed to
With lepidoptera pest beans red (Clanis bilineata) for research object, select three age beans red (killing bean hawkmoth larva)
Beauveria bassiana Bb-bm01 enteron aisle toxicity tests are carried out, the rearing conditions of beans pellet are 26 DEG C of temperature, humidity 30-40%.Take 1 μ l
Bb-bm01 spore suspensions (1 × 109A spore/ml), blank control 0.01% red using micropipettor oral Gavage beans
Triton X-100, every group of 30 beans pellets, each three repetitions, daily record beans pellet death condition.Measurement result shows, bacterium
Strain Bb-bm01 has enteric infection virulence to lepidoptera pest beans pellet, and the mycelia of Bb-bm01 gradually penetrates beans pellet after the red death of beans
Body wall is in its body surface raised growth (Fig. 4).
Conclusion：Above results proved that the bacterial strain Bb-bm01 of the present invention has preventive and therapeutic effect to lepidopterous insects, and can lead to
Enteric infection is crossed to play a role.
4. beauveria bassiana Bb-bm01 body walls of embodiment and enteron aisle compound infection have insecticidal enhancing effect
Using Lepidoptera model animal silkworm P50 strain second day five age larvas as research object, by way of spraying pair
Beauveria bassiana Bb-bm01 carries out the measurement of body wall infection insecticidal toxicity.Bb-bm01 spore suspensions a concentration of 1 × 107A spore
Son/ml, the Triton X-100 that control group is 0.01%, every group of 30 boss's silkworm larvas spray 5ml, are placed into temperature 27 respectively
DEG C, it is raised in the incubator of humidity 90%, three groups of repetitions.As a result it shows：Bb-bm01 also has silkworm larva by body wall infection
Have very high pathogenic (Fig. 5).
Meanwhile body wall infection, enteron aisle are carried out to silkworm P50 second day five age larvas respectively with beauveria bassiana Bb-bm01
Infection and body wall and enteron aisle compound infection.Wherein, body wall infects Bb-bm01 spore suspensions a concentration of 1 × 107A spore/ml,
It is 10 that enteric infection silkworm larva, which feeds Bb-bm01 spore quantity,4A spore/head, the Triton X- that blank control is 0.01%
100.Every group 30, each three repetitions record the death condition of silkworm daily.
Toxicity test is the results show that the virulence of beauveria bassiana Bb-bm01 body walls and enteron aisle compound infection is significantly higher than list
One body wall infects (p<0.001, Log-rank (Mantel-cox) Test) or enteric infection (p<0.0001,Log-rank
(Mantel-cox) Test) (Fig. 5).As a result killing for bacterial strain Bb-bm01 can be effectively improved by demonstrating double approach compound infections
Worm poison power has insecticidal enhancing effect.
5. beauveria bassiana Bb-bm01 of embodiment has Diptera pest anopheles stephensi (Anopheles stephensi)
There is enteric infection virulence
Fresh Bb-bm01 spore suspensions are prepared with 0.01% Triton X-100 sterile waters, are surveyed with blood counting chamber
Determine spore concentration, is made into 1 × 108Then the spore suspension of a spore/ml concentration mixes in equal volume with sterile 10% sucrose water.
Diptera pest anopheles stephensi adult is selected to carry out beauveria bassiana Bb-bm01 enteric infection toxicity tests.The feeding of anopheles stephensi
The condition of supporting is 26 DEG C of temperature, humidity 90%.With containing 5 × 10710% sucrose water of a spore/ml Bb-bm01 spores impregnates nothing
Cotton balls containing spore is placed into mosquito and raises the top of container for anopheles stephensi feeding by bacterium cotton balls；Blank control be containing
10% sucrose water of 0.01% Triton X-100, every group of 50 anopheles stephensi adults, each three repetitions record mosquito daily
Death condition.
Measurement result shows that bacterial strain Bb-bm01 has enteric infection virulence, mosquito dead Diptera pest anopheles stephensi
The mycelia of Bb-bm01 penetrates (Fig. 6) from the head of mosquito afterwards.The above result shows that the bacterial strain Bb-bm01 of the present invention can effectively prevent
Diptera pest is controlled, and the prevention can be carried out by enteric infection.
6. beauveria bassiana Bb-bm01 of embodiment carries out enteric infection by the anterior intestine of silkworm
The invention solves another major issue be clear beauveria bassiana Bb-bm01 enteric infection host insects
Concrete position and approach.
Fresh Bb-bm01 spore suspensions are prepared with 0.01% Triton X-100 sterile waters, are surveyed with blood counting chamber
Determine spore concentration, is made into 1 × 107The spore suspension of a spore/ml concentration.1 μ l Bb-bm01 spores are taken using micropipettor
Suspension (1 × 107A spore/ml) feeding silkworm P50 strain second day five age larvas, control group is no enteric infection virulence
Beauveria bassiana Bb252 (laboratory preserves bacterial strain, does not have enteric infection virulence after tested) spore suspension (1 × 107A spore
Son/ml).The rearing conditions of silkworm larva are 26 DEG C of temperature, humidity 30-40%.
Take respectively feeding spore after 12h, for 24 hours, the silkworm larva of 48h and 84h, immediately anatomical isolation infection after silkworm intestines
Road is put into fixer (60% absolute ethyl alcohol, 30% chloroform, 10% glacial acetic acid), and 4 DEG C are placed for 24 hours.With 70% after fixation
Ethyl alcohol rinse twice, be finally stored in 70% ethyl alcohol.Then tissue is transferred in 100% absolute ethyl alcohol, is put into mixing
1h is rotated in instrument to be dehydrated (3 times).Dewatered intestinal tissue is put into dimethylbenzene 15 minutes (3 times).By intestinal tissue
It is put into the paraffin of 65 DEG C of thawings, embeds 2d.Embedded sample is placed at room temperature for 2h, then places 20 minutes for 4 DEG C, uses slicer
It is cut into the thin slice of 5 μ m thicks.The thin slice cut is put on the glass slide for being coated with gelatin, (42 DEG C) is put on roasting piece machine and is baked
Piece 15 minutes, slice flattening sucks extra gelatin, in placing for 24 hours~36h on roasting piece machine.Then slice is put into dimethylbenzene
Middle impregnate 20 minutes dewaxes.Sample after dewaxing carries out rehydration, and 100%, 95%, 80%, 70% ethyl alcohol respectively rinses once,
5 minutes every time, ddH2O rinses 3 minutes (2 times).Slice is dyed with PAS finally, is put under microscope and carries out after dyeing
Observation.
The results show that Bb-bm01 is to carry out oral infection by the anterior intestine of silkworm.After Bb-bm01 feeds silkworm, Bb-
The spore of bm01 is adhered at the fold of the anterior intestine of silkworm, is sprouted and is penetrated the haemocoele formation hyphal body that anterior intestine intestinal wall enters insect,
And mass propagation (Fig. 7) in the haemocoele of insect.Meanwhile we also raise the control strain Bb252 of no enteric infection ability
The silkworm fed has carried out paraffin section.The results show that the phenomenon that spore of Bb252 is not sprouted in bombyx mori intestinal, with when
Between passage, the spore of Bb252 passes through anterior intestine, middle intestines and hindgut successively, last to be all excreted.
7. beauveria bassiana Bb-bm01, Bb2860 and Bb252 body wall infected silkworm virulence of embodiment compares
Take silkworm P50 strains second day five age larva, by way of spraying to beauveria bassiana Bb-bm01,
Bb2860 and Bb252 carries out the measurement of body wall infection insecticidal toxicity.The rearing conditions of silkworm larva are 27 DEG C of temperature, humidity
40%.Collect fresh beauveria bassiana Bb-bm01, Bb2860 and Bb252, spore respectively with 0.01% Triton X-100
Suspension concentration is 1 × 107A spore/ml, the Triton X-100 that control group is 0.01%.Every group of 30 boss's silkworm larvas, point
5ml is not sprayed, 27 DEG C of temperature is placed into, is raised in the incubator of humidity 90%, three groups of repetitions record the dead feelings of larva daily
Condition.
Toxicity test result is shown：Pass through body wall compared to other two plants of beauveria bassiana Bb2860 and Bb252, Bb-bm01
Infection also has very high pathogenic (Fig. 8) to silkworm larva.
It should be understood that listed above is only several specific embodiments of the present invention.It is clear that the invention is not restricted to
Upper embodiment, Bb-bm01 can also infect and thus prevent other insects, such as prodenia litura (Lepidoptera), corn borer (squama wing
Mesh), locust, cockroach (Orthoptera), chafer, longicorn (coleoptera), termite (Isoptera) etc..
In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can be to this hair
Bright to make various changes or modifications, these equivalent forms also fall within the scope of the appended claims of the present application.At this
It invents all documents referred to be incorporated herein by reference, be individually recited as reference just as each document
Like that.
Sequence table
<110>Shanghai Inst. of Life Science, CAS
<120>Have Strain of Beauveria bassiana and its control of insect application of insect gut infection effect
<130> 167998 1CNCN
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 25
<212> DNA
<213>Artificial sequence
<400> 1
tccgtaggtg aacctgctga gggat 25
<210> 2
<211> 24
<212> DNA
<213>Artificial sequence
<400> 2
tcctccgctt attgatatgc ttaa 24
<210> 3
<211> 569
<212> DNA
<213>Beauveria bassiana（Beauveria bassiana）
<400> 3
tccgtaggtg aacctgctga gggatcatta ccgagttttc aactccctaa cccttctgtg 60
aacctaccta tcgttgcttc ggcggactcg ccccagcccg gacgcggact ggaccagcgg 120
cccgccgggg acctcaaact cttgtattcc agcatcttct gaatacgccg caaggcaaaa 180
caaatgaatc aaaactttca acaacggatc tcttggctct ggcatcgatg aagaacgcag 240
cgaaacgcga taagtaatgt gaattgcaga atccagtgaa tcatcgaatc tttgaacgca 300
cattgcgccc gccagcattc tggcgggcat gcctgttcga gcgtcatttc aaccctcgac 360
ctccccttgg ggaggtcggc gttggggacc ggcagcacac cgccggccct gaaatggagt 420
ggcggcccgt ccgcggcgac ctctgcgcag taatacagct cgcaccggga ccccgacgcg 480
gccacgccgt aaaacaccca acttctgaac gttgacctcg aatcaggtag gactacccgc 540
tgaacttaag catatcaata agcggagga 569
Claims (10)
1. a kind of beauveria bassiana (Beauveria bassiana), wherein the microbial preservation number of the beauveria bassiana is
CGMCC No.13180。
2. a kind of insect control compositions, it includes：
(a) beauveria bassiana and/or its spore, mycelium or its tunning as described in claim 1；
(b) acceptable carrier and/or adjuvant in Pesticide Science.
3. composition as claimed in claim 2, wherein the composition is adapted for through insect gut desinsection or through insect gut
The dosage form of body wall composite insecticidal.
4. composition as claimed in claim 2, wherein the insect is selected from：Lepidoptera, Diptera or other classification insects,
Such as the moth pests or butterfly-class pest, such as pine moth, cutworm, prodenia litura, small heart-eating peach worm, smaller apple leafrol- ler, cotton boll
Worm, cabbage butterfly, diamondback moth, snout moth, gelechiid, phthorimaea operculella, brachmia triannuella；Mosquito class, flies, horsefly class, buffalo gnat class, as anopheles,
Culex, housefly, flowerfly, latrine fly, rotten fly, stings fly, tsetse fly, calliphorid, sarcophagid, botfly, torsalo, stomach fly, hippoboscid, the gadfly, shakes at yellow-fever mosquito
Mosquito dislikes buffalo gnat, Simulium neavei, simulium ochraceum, golden buffalo gnat, Amazon buffalo gnat, the big buffalo gnat of spot, bright chest Ji buffalo gnat, brown foot dimension buffalo gnat, huge special buffalo gnat；Wherein, it is described its
Its classification insect includes but not limited to：Orthopteran, coleopteron, isoptera insect etc., such as locust, cockroach, cockchafer
Son, longicorn and termite etc..
5. composition as claimed in claim 2, the carrier and/or adjuvant are selected from：Solvent, wetting agent, dispersant, emulsification
Agent, adhesive, filler, controlled release auxiliary agent, synergist, sticker, spreader-sticker, anti-drift agent, safener, antidote, disappears at stabilizer
Infusion, spray adjuvants, warning coloration, attractant, antifreezing agent.
6. composition as claimed in claim 2 also includes one or more components selected from the group below：Pesticide, plant growth
Conditioning agent, fertilizer and soil conditioner.
7. a kind of method of composition of production as described in any one of claim 2~6, the method includes：
It cultivates, be proliferated or ferment beauveria bassiana described in claim 1, it is stiff in vain to obtain ball spore as described in claim 1
Bacterium or its spore, mycelium or tunning；
Products therefrom is mixed with acceptable carrier and/or adjuvant in Pesticide Science.
8. a kind of method of pest control, the method includes：
By beauveria bassiana as described in claim 1 or its spore, mycelium or tunning or such as claim 2~6
Any one of described in composition be applied to pest and haunt or it is expected that the place for thering is pest to haunt.
9. method as claimed in claim 8, it is described have pest haunt or it is expected that the place for having pest to haunt is selected from the group in
One or more：Farmland, vegetable plot, orchard, the woods, pasture, warehouse, shelter, waters.
10. in beauveria bassiana as described in claim 1 or its spore, mycelium or tunning or such as claim 2-6
Application of any one of them composition in pest control.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710043852.2A CN108330071B (en) | 2017-01-19 | 2017-01-19 | Beauveria bassiana strain with insect intestinal infection effect and pest control application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710043852.2A CN108330071B (en) | 2017-01-19 | 2017-01-19 | Beauveria bassiana strain with insect intestinal infection effect and pest control application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108330071A true CN108330071A (en) | 2018-07-27 |
| CN108330071B CN108330071B (en) | 2021-10-08 |
Family
ID=62922120
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710043852.2A Active CN108330071B (en) | 2017-01-19 | 2017-01-19 | Beauveria bassiana strain with insect intestinal infection effect and pest control application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108330071B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110004069A (en) * | 2019-05-14 | 2019-07-12 | 西南林业大学 | A kind of Strain of Beauveria bassiana and its application |
| CN110896964A (en) * | 2019-12-19 | 2020-03-24 | 河南农贝得农业科技有限公司 | Seed dressing agent without pesticide residue and preparation method thereof |
| CN113150999A (en) * | 2020-12-17 | 2021-07-23 | 华南农业大学 | Entomogenous fungus strain with high pathogenicity to prodenia litura and application thereof |
| CN113564054A (en) * | 2021-06-11 | 2021-10-29 | 吉林省农业科学院 | Method for improving disease resistance of plants by using beauveria bassiana blastospores |
| CN114306391A (en) * | 2020-09-25 | 2022-04-12 | 中国科学院分子植物科学卓越创新中心 | Novel anti-malarial serratia and application thereof in blocking malaria transmission |
| CN114532349A (en) * | 2022-03-21 | 2022-05-27 | 金陵科技学院 | Compound pesticide containing spinosad and hexythiazox and application thereof |
| WO2023214867A1 (en) * | 2022-05-06 | 2023-11-09 | Becerra Carranza Luis Rodrigo | Isolated strain of beauveria bassiana, mixture and method, for the biocontrol of phytopathogenic insects |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101245319A (en) * | 2008-04-07 | 2008-08-20 | 河北省农林科学院植物保护研究所 | Macrophomina beauveria bassiana HFW-05 bacterial strain and uses thereof |
| CN103981108A (en) * | 2014-06-04 | 2014-08-13 | 河北省农林科学院植物保护研究所 | Beauveria bassiana for preventing radysia odoriphaga and application thereof |
-
2017
- 2017-01-19 CN CN201710043852.2A patent/CN108330071B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101245319A (en) * | 2008-04-07 | 2008-08-20 | 河北省农林科学院植物保护研究所 | Macrophomina beauveria bassiana HFW-05 bacterial strain and uses thereof |
| CN103981108A (en) * | 2014-06-04 | 2014-08-13 | 河北省农林科学院植物保护研究所 | Beauveria bassiana for preventing radysia odoriphaga and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| YI QIN等: "Integration of insecticidal protein Vip3Aa1 into Beauveria bassiana enhances fungal virulence to Spodoptera litura larvae by cuticle and per Os infection", 《APPL ENVIRON MICROBIOL》 * |
| 秦毅: "表达苏云金芽孢杆菌营养期杀虫蛋白Vip3Aal的球孢白僵菌工程菌株的构建及其对斜纹夜蛾幼虫的肠道与体壁侵染力", 《中国博士学位论文全文数据库》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110004069A (en) * | 2019-05-14 | 2019-07-12 | 西南林业大学 | A kind of Strain of Beauveria bassiana and its application |
| CN110896964A (en) * | 2019-12-19 | 2020-03-24 | 河南农贝得农业科技有限公司 | Seed dressing agent without pesticide residue and preparation method thereof |
| CN114306391A (en) * | 2020-09-25 | 2022-04-12 | 中国科学院分子植物科学卓越创新中心 | Novel anti-malarial serratia and application thereof in blocking malaria transmission |
| CN114306391B (en) * | 2020-09-25 | 2023-12-12 | 中国科学院分子植物科学卓越创新中心 | Novel anti-Serratia and application thereof in blocking malaria transmission |
| CN113150999A (en) * | 2020-12-17 | 2021-07-23 | 华南农业大学 | Entomogenous fungus strain with high pathogenicity to prodenia litura and application thereof |
| CN113564054A (en) * | 2021-06-11 | 2021-10-29 | 吉林省农业科学院 | Method for improving disease resistance of plants by using beauveria bassiana blastospores |
| CN114532349A (en) * | 2022-03-21 | 2022-05-27 | 金陵科技学院 | Compound pesticide containing spinosad and hexythiazox and application thereof |
| WO2023214867A1 (en) * | 2022-05-06 | 2023-11-09 | Becerra Carranza Luis Rodrigo | Isolated strain of beauveria bassiana, mixture and method, for the biocontrol of phytopathogenic insects |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108330071B (en) | 2021-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108330071A (en) | Have Strain of Beauveria bassiana and its control of insect application of insect gut infection effect | |
| CN102776130B (en) | Metarhizium anisopliae and application thereof | |
| Burge | Fungi in biological control systems | |
| CN102363750B (en) | Insecticidal fungus and application thereof | |
| WO2006121350A1 (en) | Entomopathogenic fungi and uses thereof | |
| KR20180118266A (en) | Microbial pesticides against thrips | |
| CN101654658B (en) | Pesticidal metarhizium anisopliae strain | |
| CN102021122B (en) | High-efficiency insecticidal fungus and applications thereof | |
| MX2007008234A (en) | New trichoderma atroviride strain, culture medium containing it, and use of the strain in particular as a stimulant for the germination and/or growth of plants . | |
| KR101680638B1 (en) | New microorganism Beauveria bassiana FG274 and Microbial control agent for the prevention of Spodoptera exigua larva | |
| CN114317293A (en) | Spaceflight entomogenous fungus strain SCAUHT18 with high pathogenicity and high ultraviolet resistance to common thrips and application thereof | |
| CN112553086B (en) | Violet purpurea bacterial strain and application thereof in preventing and treating phyllotreta striolata | |
| AU2006350196A1 (en) | Metarhizium anisopliae var. dcjhyium and uses thereof | |
| KR102126582B1 (en) | Microbial agent for simultaneous control of both Colletotrichum acutatum and Thrips spp. using Isaria javanica FT333 and its culture media | |
| TW201006388A (en) | Lecanicillium muscarium strain v-5, pest extermination method using the same, and microorganism pesticide comprising the same | |
| CN101513193B (en) | Compound desinsection primary agent and pesticide consisting of verticillium lecanii and beta-cypermethrin | |
| CN100420738C (en) | Natural insect carcase separating bacillus and use thereof | |
| Heviefo et al. | Comparative efficacy of endophytic versus foliar application of the entomopathogenic fungus Beauveria bassiana against the crucifer diamondback moth larvae for sustainable cabbage protection | |
| CN114317294A (en) | Spaceflight entomogenous fungus strain SCAUHT56 with high pathogenicity and high ultraviolet resistance to common thrips and application thereof | |
| CN114292760A (en) | Spaceflight entomogenous fungus strain SCAUHT38 with high pathogenicity and high ultraviolet resistance to common thrips and application thereof | |
| KR101680639B1 (en) | New microorganism Isaria fumosorosea FG340 and Microbial control agent for the prevention of Spodoptera exigua larva | |
| CN107267424B (en) | A kind of process for preparing microbial insecticide | |
| CN111549004A (en) | Composite biocontrol bacterium agent of masson pine caterpillar cytoplasmic polyhedrosis virus DpCPV and beauveria bassiana and application thereof | |
| CN109699683A (en) | A kind of talcum matrix Java cordyceps sinensis spore preparation | |
| CN114540200B (en) | Space breeding beauveria bassiana strain SCAUHT30 with high pathogenicity to common thrips and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20200609 Address after: 200032 building 4, No. 300 Fenglin Road, Xuhui District, Shanghai Applicant after: Center for excellence and innovation in molecular plant science, Chinese Academy of Sciences Address before: 200031, 319 Yueyang Road, Shanghai, Shanghai, Xuhui District Applicant before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |