CN108289873A - Method for improving cognition - Google Patents
Method for improving cognition Download PDFInfo
- Publication number
- CN108289873A CN108289873A CN201680069352.XA CN201680069352A CN108289873A CN 108289873 A CN108289873 A CN 108289873A CN 201680069352 A CN201680069352 A CN 201680069352A CN 108289873 A CN108289873 A CN 108289873A
- Authority
- CN
- China
- Prior art keywords
- mct
- mcfa
- composition
- fatty acid
- medium chain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
- A61K31/20—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
- A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
- A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
- A23L33/115—Fatty acids or derivatives thereof; Fats or oils
- A23L33/12—Fatty acids or derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/21—Esters, e.g. nitroglycerine, selenocyanates
- A61K31/215—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids
- A61K31/22—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acyclic acids, e.g. pravastatin
- A61K31/23—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acyclic acids, e.g. pravastatin of acids having a carboxyl group bound to a chain of seven or more carbon atoms
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Biomedical Technology (AREA)
- Epidemiology (AREA)
- Food Science & Technology (AREA)
- Polymers & Plastics (AREA)
- Nutrition Science (AREA)
- Hospice & Palliative Care (AREA)
- Mycology (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Psychiatry (AREA)
- Emergency Medicine (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Coloring Foods And Improving Nutritive Qualities (AREA)
- Edible Oils And Fats (AREA)
- Bakery Products And Manufacturing Methods Therefor (AREA)
- Dairy Products (AREA)
- Confectionery (AREA)
- Seasonings (AREA)
- Non-Alcoholic Beverages (AREA)
- Beans For Foods Or Fodder (AREA)
- Grain Derivatives (AREA)
Abstract
The present invention provides a kind of medium chain triglyceride (MCT) or medium chain fatty acid (MCFA), the MCT or MCFA are for improving the cognition being damaged because UBE3A lacks.
Description
Technical field
The present invention relates to medium chain triglyceride (MCT) or medium chain fatty acid (MCFA) for improve due to UBE3A lacks by
The purposes of the cognition (for example, subject or aging subjects with cognitive disorder) of damage.In particular it relates to MCT
Purposes for treating Angelman syndrome and/or Prader-Willi syndromes.
Background technology
UBE3A coding for targeting specific albumen with degrade ubiquitin E3 ligases (de Bie, P. and
Ciechanover A.(2011)Cell Death Differ.18：1393-402), and since it is as main general in cynapse
The protein-bonded effect of element, thus it is most important in terms of cognitive function of bringing into normal play.UBE3A removes cynapse signal conductive protein
The ability of (for example, Arc) allows for the homologous adjusting of neurite outgrowth.The forfeiture of UBE3A expression can be destroyed via transcription factor
The long-term enhancing of Arc, and also result in the imbalance of glutamate receptor activity.Over time, UBE3A missings cause cynapse to be dropped
Solution and epileptic attack.
The attenuation of correlation of UBE3A functional disturbances and cognitive function joins.In particular, it with certain obstacles (for example,
Angelman syndrome) the origin cause of formation it is related.
Angelman syndrome is a kind of genetic block, leads to functionally serious hypoevolutism, it is characterised in that serious
Disfluency, movement or disequilibrium and abnormal behaviour.
It is estimated that only America ＆ Canada just has 1000 to 5000 Angelman syndrome cases.
Drug can be used sometimes with the relevant epileptic attack of Angelman syndrome or controlled using high fat diet, so
And improved Atkins diet has also been attempted in this context, but the success of these methods is variable.
The nearest certain cancer drugs of studies have shown that can induce UBE3A, and in Angelman syndrome mouse mould
Show that behavior improves (Huang, H.S. et al. (2011) Nature 481 using particular cancers drug in type：185-9).So
And these drugs are not that brain is bioavailable, such cancer drug inhibits cell division in addition, and is not suitable for
The long-term treatment of Angelman syndrome patient.
Using antibiotic, to methylate nutriment and antioxidant several for treating Angelman syndrome to carry out
Clinical test, these substances be all proved to cognition or behavior almost without any effect.Therefore, it there is no at present for the disease
The reliable treatment of disease.
Prader-Willi syndromes are a kind of and relevant genetic block of Angelman syndrome.Prader-Willi is comprehensive
Simulator sickness patient has significant cognition, nerve, endocrine and abnormal behavior.Further, since hypotony, patient may be in baby
Phase is difficult to feed, and leads to growth retardation, but due to the uncontrollable craving of food, becoming fertilizer afterwards in the life that they can be
It is fat.
The whole world about 400,000 patients suffer from Prader-Willi syndromes.
Although behavior therapy and other treatments can reduce the influence of Prader-Willi syndromes, do not have for the disease
Effective treatment.
Therefore, for up-regulation brain in UBE3A expression with improve cognitive function method continue there is notable demands.Separately
Outside, hence it is evident that also need to for treating disease such as Angelman syndrome and Prader-Willi syndromes, being specifically used for
The method for solving the treatment of its relevant cognitive impairment.
Invention content
The present inventor unexpectedly confirms that medium chain triglyceride (MCT) diet can increase the expression of the UBE3A in brain.
In addition, inventors have established that MCT diet improves cognitive performance.
In particular, the inventors discovered that, compared with control diet, including the diet of C8 and/or C10 triglycerides increases
UBE3A protein expressions in cortex and hippocampus.It has been found that MCT diet improves the UBE3A expressions in aging subjects,
Reach with being on close level of being found in young subject or more preferably horizontal.
Importantly, the present inventors have additionally discovered that, MCT diet generates improved cognitive function in rat model.It is undesirable
Bound by theory, the cognition observed, which improves, to be increased and be caused by the horizontal of UBE3A in brain, so as to cause transcription because
The foundation level of sub- Arc is lowered and/or the improved control to Arc stable states.
Therefore, in one aspect, the present invention provides the medium chain triglycerides for improving the cognition being damaged because UBE3A lacks
Three esters (MCT) or medium chain fatty acid (MCFA).
In one aspect, the present invention provides for improving the medium chain triglyceride of cognition by raising UBE3A expression
(MCT) or medium chain fatty acid (MCFA).
For example, caused by UBE3A shortages may be the UBE3A activity deficiencies in brain, such as due to the expression water of UBE3A
The expression of flat inadequate or UBE3A enzymes invalid form.UBE3A lack can with advancing age and occur and/or can be easily
It is assessed (for example, as described herein) by technical staff using expression or the insufficient molecular genetic test of function is for example shown.
In one embodiment, cognition is improved by using the MCT of the present invention.In another embodiment, lead to
Cross improves cognition using the MCFA of the present invention.
In one embodiment, MCT or MCFA improves the cognition of the subject with cognitive disorder.Cognitive disorder can be with
UBE3A activity in brain is insufficient associated or is induced by it.
In one embodiment, MCT or MCFA, which improves, suffers from Angelman syndrome or Prader-Willi syndromes
Subject cognition.
In another embodiment, MCT or MCFA improves the cognition of aging subjects.For example, aging subjects can be with
It is the human experimenter within the scope of 30,35,40,45,50,55,60,65,70,75,80,85,90,95 or 100 years old.
On the other hand, the present invention provides for treating in Angelman syndrome or Prader-Willi syndromes
Chain triglyceride (MCT) or medium chain fatty acid (MCFA).
MCT or MCFA can for example improve recognizing for the subject with Angelman syndrome or Prader-Willi syndromes
Know, and/or reduces the incidence of epileptic attack.
Can be for example comprising three fatty acid parts for MCT in accordance with the purpose of the invention, each fatty acid part is independent
Ground has 6 to 12,6 to 11,6 to 10,7 to 12,7 to 11,7 to 10,8 to 12,8 to 11 or 8 to 10 carbon atoms.Preferably
It includes three fatty acid parts for MCT in accordance with the purpose of the invention to be, each fatty acid part independently has 8 to 10
A carbon atom.
Can be for example comprising three fatty acid parts for MCT in accordance with the purpose of the invention, each fatty acid part is independent
Ground has only 6,7,8,9,10,11 or 12 carbon atoms.Preferably, the MCT being used in accordance with the purpose of the invention includes three
Fatty acid part, each fatty acid part independently have only 8 or 10 carbon atoms, that is, are preferably, for according to the present invention
Purposes MCT only include C8 and/or C10 fatty acid parts.Preferably, fatty acid moieties are divided into octanoic acid and/or capric acid part.
Can be homogeneity triglycerides (homotriglyceride) (that is, MCT for MCT in accordance with the purpose of the invention
All fatty acid parts can homogeneity having the same, for example, C8 homogeneity triglycerides may include 3 sad parts).
In one embodiment, the MCT being used in accordance with the purpose of the invention includes three fat with only 8 carbon atoms
Fat acid moieties.In a preferred embodiment, all three fatty acid moieties are divided into sad part.
In another embodiment, the MCT being used in accordance with the purpose of the invention has only 10 carbon atoms comprising three
Fatty acid part.In a preferred embodiment, all three fatty acid moieties are divided into capric acid part.
For MCFA in accordance with the purpose of the invention can for example with 6 to 12,6 to 11,6 to 10,7 to 12,7 to 11,7 to
10,8 to 12,8 to 11 or 8 to 10 carbon atoms.Preferably, the MCFA being used in accordance with the purpose of the invention has 8 to 10
Carbon atom.
It can be for example with only 6,7,8,9,10,11 or 12 carbon atoms for MCFA in accordance with the purpose of the invention.It is preferred that
, there are only 8 or 10 carbon atoms for MCFA in accordance with the purpose of the invention, that is, be preferably, for according to the present invention
Purposes MCFA be C8 and/or C10 aliphatic acid.
In one embodiment, the MCFA being used in accordance with the purpose of the invention has only 8 carbon atoms.Preferably at one
Embodiment in, MCFA be octanoic acid.
In another embodiment, the MCFA being used in accordance with the purpose of the invention has only 10 carbon atoms.At one
In preferred embodiment, MCFA is capric acid.
For in accordance with the purpose of the invention MCT or MCFA can enteral or parenteral administration.Preferably, MCT
Or MCFA is enteral.For example, MCT or MCFA can be applied in the form of foodstuff or replenishers.
For in accordance with the purpose of the invention MCT or MCFA can be for example to include about 1%-10%, 2%-10%, 3%-
10%, the MCT and/or MCFA of the present invention of 4%-10%, 5%-10%, 6%-10%, 7%-10% or 8%-10% (w/w)
Diet application.For in accordance with the purpose of the invention MCT or MCFA can be for example to include this hair of about 1.5%-8% (w/w)
The diet of bright MCT and/or MCFA is applied.Preferably, MCT in accordance with the purpose of the invention or MCFA are used for comprising about
The diet application of the MCT and/or MCFA of the present invention of 3%-8% (w/w).
On the other hand, the present invention provides include the present invention's for improving the cognition being damaged because UBE3A lacks
The composition of medium chain triglyceride (MCT) and/or medium chain fatty acid (MCFA).
For example, caused by UBE3A shortages may be the UBE3A activity deficiencies in brain, such as due to the expression water of UBE3A
The expression of flat inadequate or UBE3A enzymes invalid form.
In one embodiment, the composition includes the MCT of the present invention.In another embodiment, described group
Close the MCFA that object includes the present invention.
In one embodiment, the cognition of subject of the composition for improved with cognitive disorder.Cognitive disorder can
It is insufficient associated or be induced by it with the UBE3A activity in brain.
Preferably, subject of the composition for improved with Angelman syndrome or Prader-Willi syndromes
Cognition.
In another embodiment, the cognition of the composition for improved aging subjects.For example, aging subjects can be with
It is the human experimenter within the scope of 30,35,40,45,50,55,60,65,70,75,80,85,90,95 or 100 years old.
On the other hand, the present invention provides comprising for treating Angelman syndrome or Prader-Willi syndromes
The present invention medium chain triglyceride (MCT) or medium chain fatty acid (MCFA) composition.
The composition can for example improve the subject's with Angelman syndrome or Prader-Willi syndromes
Cognition, and/or reduce the incidence of epileptic attack.
MCT or MCFA can be as described herein.
In one embodiment, composition of the invention includes containing C8 fatty acid parts (that is, having 8 carbon atoms
Fatty acid part), the homogeneity triglycerides of preferably sad part.
In one embodiment, composition of the invention includes containing C10 fatty acid parts (that is, having 10 carbon originals
The fatty acid part of son), the homogeneity triglycerides of preferably capric acid part.
In one embodiment, the composition includes containing C8 fatty acid parts (that is, the fat with 8 carbon atoms
Fat acid moieties), preferably sad homogeneity triglycerides, and with C10 fatty acid parts (that is, with 10 carbon atoms
Fatty acid part), the homogeneity triglycerides of preferably capric acid.
In one embodiment, including the ratio of the homogeneity triglycerides of C8: C10 aliphatic acid be about 90: 10 (w/w) extremely
About 10: 90 (w/w).In another embodiment, including the ratio of the homogeneity triglycerides of C8: C10 aliphatic acid is about 80: 20
(w/w) is to about 20: 80 (w/w).In another embodiment, including the ratio of the homogeneity triglycerides of C8: C10 aliphatic acid is
About 70: 30 (w/w) to about 30: 70 (w/w).In another embodiment, include the homogeneity triglycerides of C8: C10 aliphatic acid
Ratio be about 60: 40 (w/w) to about 40: 60 (w/w).In another embodiment, include the homogeneity of C8: C10 aliphatic acid
The ratio of triglycerides is about 50: 50 (w/w) to about 40: 60 (w/w).
In one embodiment, including the ratio of the homogeneity triglycerides of C8: C10 aliphatic acid be about 90: 10,80: 20,
70: 30,60: 40,50: 50,40: 60,30: 70,20: 80 or 10: 90 (w/w).Preferably, including C8: C10 aliphatic acid it is same
The ratio of matter triglycerides is about 50: 50 or 40: 60 (w/w).
For composition in accordance with the purpose of the invention can for example comprising about 1%-100%, 1%-50%, 1%-30%,
1%-10%, 2%-10%, 3%-10%, 4%-10%, 5%-10%, 6%-10%, 7%-10% or 8%-10% (w/w)
The present invention MCT and/or MCFA.It can be for example comprising about 1.5%-8% (w/w) for composition in accordance with the purpose of the invention
The present invention MCT and/or MCFA.Preferably, the composition being used in accordance with the purpose of the invention includes about 3%-8% (w/
W) MCT and/or MCFA of the present invention.
In one embodiment, it is used for the form that composition in accordance with the purpose of the invention is powder.Powder can be such as
For spray-dried powders or freeze-dried powder.
In one embodiment, it is used for the form that composition in accordance with the purpose of the invention is lotion.The lotion can
For example, emulsion oil-in-water.
Preferably, it is used for the form that composition in accordance with the purpose of the invention is foodstuff.Preferably, the foodstuff is
Human foodstuffs.Foodstuff can use the MCT and/or MCFA of the present invention to strengthen.
In one embodiment, be used for composition in accordance with the purpose of the invention be beverage, mayonnaise, margarine,
Low-fat spreads, dairy products, cheese cream, processing cheese, dairy dessert, flavoured milk, cream, fermented dairy product, cheese,
It is butter, condensed milk products, icecream mix, bean product, pasteurize egg liquid, baked product, confectionary product, candy bar, skilful
Gram force stick, stick high in fat, liquid meat gruel (liquid emulsion), spray-dried powders, freeze-dried powder, UHT puddings, bar
Family name sterilizes the form of pudding, gel, jelly, Yoghourt or the food with lipid filler or aqueous filler.
On the other hand, the present invention provides the medium chain triglyceride (MCT) of the present invention and/or medium chain fatty acids (MCFA)
Purposes for manufacturing the drug or composition that are used for improving the cognition being damaged because UBE3A lacks.As described herein, cognition
Improve can the subject with cognitive disorder, the subject with Angelman syndrome or Prader-Willi syndromes or
It is realized in person aging subjects.
On the other hand, the present invention provides the medium chain triglyceride (MCT) of the present invention and/or medium chain fatty acids (MCFA)
Purposes for manufacturing drug or composition for treating Angelman syndrome or Prader-Willi syndromes.
On the other hand, the present invention provides a kind of method for the cognition of subject for improving and being damaged because UBE3A lacks,
This method include to subject apply a effective amount of present invention medium chain triglyceride (MCT) or medium chain fatty acid (MCFA) or
The composition of the present invention.As described herein, cognition improve can with cognitive disorder subject, with Angelman integrate
It is realized in the subject or aging subjects of sign or Prader-Willi syndromes.
On the other hand, the present invention provides a kind of Angelman syndrome for treating subject or Prader-Willi are comprehensive
The method of simulator sickness, this method include that the medium chain triglyceride (MCT) or Medium chain fatty of a effective amount of present invention are applied to subject
The composition of sour (MCFA) or the present invention.
On the other hand, the present invention provides it is a kind of increase subject UBE3A expression method, this method include to by
Examination person applies the combination of the medium chain triglyceride (MCT) or medium chain fatty acid (MCFA) or the present invention of a effective amount of present invention
Object.
This method can for example increase the UBE3A in brain and express, rather than the UBE3A in other tissues (for example, periphery)
Expression.
Description of the drawings
Fig. 1
The social recognition and chronic medium chain triglyceride (MCT) the supplement diet (5 of feeding at baseline in 24 months old rats
Weight %) social recognition after 8 weeks.
Compared with those of fed control diet, the cognitive performance in MCT processing groups improves (single factor test ANOVA analyses).F
=10.56；*, p ＜ 0.01MCT10 (Triglyceride DDD) with compare (CON)；*, p ＜ 0.05MCT8 (Trivent OCG)
With compare (CON).
Fig. 2
UBE3a protein expressions (single factor test ANOVA analyses) in the cortex of 24 months old rats.F=4.891；*, MCT8 or
MCT10 is compared with compareing (CTL), p ＜ 0.05.
Fig. 3
Medium chain triglyceride (MCT) processing group and control (CON) group in 24 months old rats prefrontal cortex in UBE3A
The mRNA expression of the relevant transcript of activity；Group：MCT10 (Triglyceride DDD), MCT8 (Trivent OCG), " mixture "
(MCT8 and MCT10 of ratio 40: 60).For Arc hipp, compared with the control group, 10 processing groups of MCT are reduced, p ＜ 0.05
(single factor test ANOVA).For Snrpn hipp, compared with the control group, " mixture " MCT8 and MCT10 processing groups increase, p ＜
0.05 (single factor test ANOVA).
Fig. 4
Treated the object cognition of chronic (8 weeks) medium chain triglyceride (MCT).Compared with those of fed control diet,
Cognitive performance in MCT processing groups improves (single factor test ANOVA analyses).F=10.56；* p ＜ 0.05MCT10 (capric acid glycerine three
Ester) with compare (con).
Fig. 5
UBE3a protein expressions in the cortex of 17 months old rats.F=4.891；*, MCT10 is compared with compareing (CTL), p ＜
0.05.UBE3A protein expressions in the rat handled through MCT10 are suitable with young age (6 monthly age) rat (CTL young ages).
Fig. 6
It is eaten by MCT supplements diet (being delivered via MCT placentas and via breast milk) by parent and in introduction stage is exposed to MCT
1 monthly age mouse cortex and liver in UBE3a protein expressions comparison.Student t check analyses：*, with compare (Con)
It compares, p ＜ 0.05.
Fig. 7
It is eaten by MCT supplements diet (being delivered via MCT placentas and via breast milk) by parent and in introduction stage is exposed to MCT
2 monthly age mouse Morris water mazes test performance.The time spent in platform quadrant indicates after 4 days labyrinths
Memory keep horizontal.Female C8-OTG (Trivent OCG) mouse take significantly more in target quadrant (platform quadrant)
The long time is more than the 25% horizontal t of chance (11)=3.533, p=0.005.
Fig. 8
With octanoic acid or capric acid processing after, relative to control (DMSO) processing, the UBE3A of mankind's iCell neurons and from
The multiple of 1 (GRIN1) level of subtype glutamate receptor N- methyl D-apartates salt changes, 0.05 (single factor tests of * p ＜
ANOVA)。
Fig. 9
It is examined using t, MCT C8/C10 significantly increase the expression (being normalized to beta-actin) of UBE3A；*=p ＜
0.05。
Figure 10
In the case of glucose is not present in the medium, octanoic acid/C8 and capric acid/C10 significantly increase UBE3A expression water
Flat (being normalized to beta-actin).There are the low glucose of 4mM, 5 μM and 50 μM of capric acid/C10 significantly increases
UBE3A expression (being normalized to beta-actin) is added.Single factor test ANOVA；*=p ＜ 0.1；*=p ＜ 0.05；* *=p ＜
0.01
Specific implementation mode
The various preferred features and embodiment of the present invention now are described by by way of non-limiting example.
Unless otherwise specified, practice of the invention will use conventional chemical, biochemistry, molecular biology, microbiology
With immunologic technology, these technologies are within the limit of power of those of ordinary skill in the art.Such technology is in the literature
It is illustrated.Referring to：Such as J., Fritsch, E.F.and Maniatis, T. (1989) " Molecular Cloning：A
Laboratory Manual ", 2nd Edition, Cold Spring Harbor Laboratory Press；Ausubel,
F.M.et al.(1995and periodic supplements)Current Protocols in Molecular
Biology, Ch.9,13and 16, John Wiley＆Sons；Roe, B., Crabtree, J.and Kahn, A. (1996) DNA
Isolation and Sequencing：Essential Techniques, John Wiley＆Sons；Polak, J.M.and
McGee, J.O ' D. (1990) In Situ Hybridization：Principles and Practice, Oxford
University Press；Gait, M.J. (1984) Oligonucleotide Synthesis：A Practical
Approach, IRL Press；And Lilley, D.M.and Dahlberg, J.E. (1992) Methods in
Enzymology：DNA Structures Part A：Synthesis and Physical Analysis of DNA,
Academic Press.Each in these general texts is hereby incorporated herein by.
In one aspect, the present invention provides the medium chain triglycerides for improving the cognition being damaged because UBE3A lacks
(MCT) or medium chain fatty acid (MCFA).
On the other hand, the present invention provides for treating in Angelman syndrome or Prader-Willi syndromes
Chain triglyceride (MCT) or medium chain fatty acid (MCFA).
Medium chain triglyceride (MCT) and medium chain fatty acid (MCFA)
Triglycerides (also referred to as triacylglycerol or triacylglyceride) is the ester derived from glycerine and three kinds of aliphatic acid.
Medium chain triglyceride (MCT) is the triglycerides that wherein all three fatty acid moieties are divided into medium chain fatty acid part.
Medium chain fatty acid (MCFA) is the aliphatic acid for having 6-12 carbon atom.Preferably, fatty acid part is aliphatic fatty acid moieties
Point.Therefore, MCT is the ester formed by glycerol molecule and three Medium chain fatty acid molecules.
Term " fatty acid " part " refers to the part for the MCT that aliphatic acid generates in the esterification with glycerine.For example,
Glycerine and the esterification only between octanoic acid will obtain the MCT with sad part.
Can be for example comprising three fatty acid parts for MCT in accordance with the purpose of the invention, each fatty acid part is independent
Ground has 6 to 12,6 to 11,6 to 10,7 to 12,7 to 11,7 to 10,8 to 12,8 to 11 or 8 to 10 carbon atoms.Preferably
It includes three fatty acid parts for MCT in accordance with the purpose of the invention to be, each fatty acid part independently has 8 to 10
A carbon atom.
It may include that three fatty acid parts, each fatty acid part independently have for MCT in accordance with the purpose of the invention
There are only 6,7,8,9,10,11 or 12 carbon atoms.Preferably, the MCT being used in accordance with the purpose of the invention includes three fat
Acid moieties, each fatty acid part independently have only 8 or 10 carbon atoms, that is, are preferably, and are used for use according to the present invention
The MCT on way only includes C8 and/or C10 fatty acid parts.Preferably, fatty acid moieties are divided into octanoic acid and/or capric acid part.
For MCT in accordance with the purpose of the invention can be homogeneity triglycerides (that is, all fatty acid parts of MCT can have
There is identical homogeneity, for example, C8 homogeneity triglycerides may include 3 sad parts).
Preferably, the MCT being used in accordance with the purpose of the invention includes three fatty acid moieties with only 8 carbon atoms
Point.In a preferred embodiment, all three fatty acid moieties are divided into sad part.
Preferably, the MCT being used in accordance with the purpose of the invention includes three fatty acid moieties with only 10 carbon atoms
Point.In a preferred embodiment, all three fatty acid moieties are divided into capric acid part.
Octanoic acid (also referred to as sub-sheep resin acid) is formula CH3(CH2)6The saturated fatty acid of COOH.
Capric acid (also referred to as turning sour) is formula CH3(CH2)8The saturated fatty acid of COOH.
MCT exists in such as palm oil and coconut oil with low amounts.Capric acid and octanoic acid respectively constitute the aliphatic acid of coconut oil
The about 5%-8% and 4%-10% of composition.
UBE3A
UBE3A codings are used for ubiquitin E3 ligase (de Bie, P.and of the targeting specific albumen to degrade
Ciechanover A.(2011)Cell Death Differ.18：1393-402), and since it is as main general in cynapse
The protein-bonded effect of element, thus it is most important in terms of cognitive function of bringing into normal play.
The ability of UBE3A removing cynapse signal conductive proteins (for example, Arc) allows for the homologous adjusting of neurite outgrowth.
The forfeiture of UBE3A expression can destroy the long-term enhancing via transcription factor Arc, and also result in the mistake of glutamate receptor activity
It adjusts.Over time, UBE3A missings can lead to cynapse degradation and epileptic attack.
Exemplary UBE3A sequences are stored with NCBI accession number NP_000453.2.
Exemplary UBE3A sequences are：
Cognition
The medium chain triglyceride (MCT) or medium chain fatty acid (MCFA) and composition of the present invention can be used for improving cognition.Tool
It says to body, MCT of the invention and composition can be used for improving with cognitive disorder, Angelman syndrome or Prader-Willi
Syndrome or subject with the risk for suffering from cognitive disorder, Angelman syndrome or Prader-Willi syndromes and/or
The cognition of aging subjects.
Term " cognition " refers to the set of all mental abilities and process, including knowledge, attention, long-term memory and work
Memory, judgement and evaluation, reasoning and " calculating ", Resolving probiems and decision-making, understanding and generation language.
The improvement level of cognition can use any suitable nuerological known in the art and cognition by technical staff
Test is easily assessed, and includes the recognition tests designed for assessing information processing rate, executing function and memory.Suitably
Exemplary test include simple mental state checklist (MMSE), the automatic test system (CANTAB) of Cambridge Neuropsychological test,
Alzheimer disease assess scale-recognition tests (ADAScog), Wisconsin Card Sorting Test, vocabulary and figure smoothness
Property test and trail making test, electroencephalogram (EEG), magneticencephalogram graphical method (MEG), positron emission fault development (PET), single photon
Emission computed tomography (SPECT), magnetic resonance imaging (MRI), functional mri (fMRI), computed tomography
It is acted on long term potentiation.
Cognition and performance testing for assessing Angelman and Prader-Willi syndrome children include measuring to pay attention to
The test of power, independent behaviour, locomitivity and memory, such as Bayley Scales of Infant and Toddler
Development, Third Edition (BSID-III), Bayley, H. (2005) (Bayley early child developments assess scale,
The third edition (BSID-III), Bayley, H., 2005)；Preschool Language Scale, Fourth Edition
(PLS-4), Zimmerman, I.L.et al. (2002) (preprimary child's language development scale, fourth edition (PLS-4),
Zimmerman, I.L. et al., 2002)；And Vineland Adaptive Behavior Scales, Second
Edition (VABS-II), Sparrow, S.S.et al. (2005) (Vineland Adaptive Behavior Scales, the second edition (VABS-
II), Sparrow, S.S. et al., 2005 years).
Improved cognition can for example be interpreted suitable test (for example, assessing scale based on Bayley early child developments)
In with baseline performance statistically-significant difference.
Heredity test
The heredity test of Angelman syndrome
The diagnosis of Angelman syndrome can be insufficient by the expression or function that show the UBE3A allele of matrilinear inheritance
Molecular genetic test carry out.To parent's specific DNA in 15q11.2-q13 chromosomal regions methylate the marking analysis detection
To about 80% individual with Angelman syndrome, including there is missing, uniparental disomy (UPD) or marking defect (ID)
Those individuals；There is the visible chromosomal rearrangement of cytogenetics (that is, indexing or inversion) less than 1% individual.UBE3A sequences
Pathogenicity variant in the individual of analysis detection other about 11%.Therefore, molecular genetic test (for example, methylation analysis and
UBE3A sequence analyses) recognizable about 90% individual change.
The heredity test of Prader-Willi syndromes
The heredity test of Prader-Willi syndromes can measure the 5 ' islands CpG of SNRPN locus, and control UBE3A turns
It records (via the non-coding RNA encoded in SNRPN transcripts).Promoter, exons 1 and the introne 1 region of SNRPN is in parent
It does not methylate on the allele of expression, and methylates on the allele of maternal inhibition.It is comprehensive with Prader-Willi
The subject of simulator sickness only has maternal methylated alleles.
Physiology is tested
EEG is the measurement to the electrical activity of brain, big by placing an electrode on scalp at each position and recording
The brain signal of width amplification is realized.MEG is similar to EEG, because it measures magnetic field associated with electric field.MEG is for measuring
Spontaneous brain activity, including the synchronous waves in nervous system.
PET provides the measurement to oxygen utilization and glucose metabolism.In this technique, it is sent out using radioactivity positive electron
Tracer is penetrated, and the tracer absorption of brain is related to brain activity.These tracers are sent out the sensing on besieged head
The gamma-rays that device detects, to obtain the 3D figures of brain activation.After tracer is absorbed by brain, conduct will be detected
The radioactivity of local cerebral blood flow flow function.During activation, cerebral blood flow (CBF) and neuron glucose generation can be detected in a few seconds
The increase thanked.
Suitable analysis can also be based on neuropsychiatry test, clinical examination and individual cognitive function is lost (for example,
Subjective memory lose) complaint.
Other suitable tests can be based on to motoricity, memory and attention, seizure susceptibility and society mutually
Dynamic and/or cognition assessment.These tests are particularly suitable for assessment obstacle such as Angelman syndrome and/or Prader-Willi
Syndrome and its therapeutic effect.
Cognitive disorder
The medium chain triglyceride (MCT) or medium chain fatty acid (MCFA) and composition of the present invention can be used for improving with cognition
The cognition of the subject of obstacle.
Term " cognitive disorder " refers to the obstacle for causing cognition impaired, especially it is main influence study, memory, perception and/
Or the obstacle of Resolving probiems.
The medium chain triglyceride (MCT) or medium chain fatty acid (MCFA) and composition of the present invention, which can be used for improving, to be suffered from
The cognition of the subject of Angelman syndrome or Prader-Willi syndromes.
MCT, MCFA and composition of the present invention can be used for treating Angelman syndrome or Prader-Willi syndromes.
Angelman syndrome
Angelman syndrome is a kind of genetic block, can lead to functionally serious hypoevolutism, it is characterised in that tight
Disfluency, movement or disequilibrium, intelligent disability, epilepsy and abnormal behaviour again.The behavior of Angelman syndrome children
Feature includes frequent laugh and/or smile and passionnate personality, often with action of waving.It is most of
Angelman syndrome patient can undergo epileptic attack, usually start before 3 years old.What nearly all patient showed abnormality
Electroencephalogram (EEG), can be used the electroencephalogram during diagnosis.Patient with Angelman syndrome is usually to meet self-closing disease
The mode of diagnostic criteria shows socialization and links up insufficient.
Angelman syndrome is caused by the functional disturbance of UBE3A, which is located at the areas q11-q13 of chromosome 15.
Mutation in UBE3A can spontaneous generation or matrilinear inheritance.It is maternal in about 80% of the patient with Angelman syndrome
The areas UBE3A are lacked in chromosome, and male parent chromosome is complete.UBE3A is transcribed during the gestational period from both chromosomes, but
Postnatal last year, male parent gene are epigenetics silence in the brain.As a result, Angelman syndrome patient is outside
Week expression UBE3A, but do not show that UBE3A is expressed in the brain.
Prader-Willi syndromes
Prader-Willi syndromes are a kind of and relevant genetic block of Angelman syndrome, it is since male parent is lost
The areas q11-q13 of the chromosome 15 of biography lack caused by the expression of multiple genes.
As Angelman syndrome, the areas chromosome 15q11-q13 are subjected to epigenetics silence by the marking.So
And for Prader-Willi syndromes, the gene on maternal chromosome usually carries the marking.Therefore, if male parent gene
Functional disturbance, this may lead to seizure of disease.
Prader-Willi syndrome patients have significant cognition, nerve, endocrine and abnormal behavior.Further, since
Hypotony, patient may be difficult to feed in infancy, lead to growth retardation, but due to the uncontrollable craving of food, he
Can become fat in life afterwards.
Composition
On the other hand, the present invention provides include the present invention's for improving the cognition being damaged because UBE3A lacks
The composition of medium chain triglyceride (MCT) or medium chain fatty acid (MCFA).
On the other hand, the present invention provides comprising for treating Angelman syndrome or Prader-Willi syndromes
The present invention medium chain triglyceride (MCT) or medium chain fatty acid (MCFA) composition.
Composition may include multiple MCT and/or MCFA as herein defined.
Composition may include the MCT and/or MCFA of the present invention of a concentration of about 5g/L to 150g/L.Concentration can be about 5g/
L、10g/L、15g/L、20g/L、30g/L、40g/L、50g/L、60g/L、70g/L、80g/L、90g/L、100g/L、110g/L、
120g/L, 130g/L, 140g/L, 150g/L, 175g/L, 200g/L, 225g/L or 250g/L the present invention MCT and/or
MCFA。
Composition may include containing C8 fatty acid parts (that is, aliphatic acid with 8 carbon atoms), preferably sad part
Homogeneity triglycerides.
Composition may include containing C10 fatty acid parts (that is, aliphatic acid with 10 carbon atoms), preferably capric acid portion
The homogeneity triglycerides divided.
Composition may include containing C8 fatty acid parts (that is, aliphatic acid with 8 carbon atoms), preferably octanoic acid is same
Matter triglycerides, and the homogeneity with C10 fatty acid parts (that is, aliphatic acid with 10 carbon atoms), preferably capric acid
Triglycerides.
In one embodiment, including the ratio of the homogeneity triglycerides of C8: C10 aliphatic acid be about 90: 10 (w/w) extremely
About 10: 90 (w/w).In another embodiment, including the ratio of the homogeneity triglycerides of C8: C10 aliphatic acid is about 80: 20
(w/w) is to about 20: 80 (w/w).In another embodiment, including the ratio of the homogeneity triglycerides of C8: C10 aliphatic acid is
About 70: 30 (w/w) to about 30: 70 (w/w).In another embodiment, include the homogeneity triglycerides of C8: C10 aliphatic acid
Ratio be about 60: 40 (w/w) to about 40: 60 (w/w).In another embodiment, include the homogeneity of C8: C10 aliphatic acid
The ratio of triglycerides is about 50: 50 (w/w) to about 40: 60 (w/w).
In one embodiment, including the ratio of the homogeneity triglycerides of C8: C10 aliphatic acid be about 90: 10,80: 20,
70: 30,60: 40,50: 50,40: 60,30: 70,20: 80 or 10: 90 (w/w).Preferably, including C8: C10 aliphatic acid it is same
The ratio of matter triglycerides is about 50: 50 or 40: 60 (w/w).
Composition can be free of or substantially free of monounsaturated fatty acids or polyunsaturated fatty acid.
Composition can be with 0.2: 1 to 0.3: 1 life ketone ratio.In other embodiments, which can be 0.5: 1 or 1:
1 to 5: 1.Term " raw ketone ratio " refers to the ratio between the total weight of the weight and carbohydrate and protein of lipoid.
Composition can be tablet, dragee, capsule, capsule and pill, powder, particle, solution, lotion, suspension, coated granule,
The form of spray-dried granules or pill.
Composition can be the form of powder.Powder may be, for example, spray-dried powders or freeze-dried powder.
Composition can be the form of lotion.Lotion may be, for example, emulsion oil-in-water.Composition can be used for reconstructing in water.
Composition can be mixed or is mixed into food substance.The composition can be the form of foodstuff.Preferably, foodstuff is
Human foodstuffs.
Composition can be the form of nutritional supplement.Term " nutritional supplement " refers to the common drink for being intended to supplement subject
The product of food.
Composition can be the form of whole nutritional prod.Term " whole nutritional prod " refers to being intended as subject to eat only
The product of one article, diet or diet.
Composition can be beverage, mayonnaise, margarine, low-fat spreads, dairy products, cheese cream, processing cheese, breast
Product dessert, flavoured milk, cream, fermented dairy product, cheese, butter, condensed milk products, icecream mix, bean product, Pasteur
It is sterilization egg liquid, baked product, confectionary product, candy bar, chocolate bars, stick high in fat, liquid meat gruel, spray-dried powders, cold
Freeze dried powder, UHT puddings, pasteurize pudding, gel, jelly, Yoghourt or with lipid filler or aqueous filler
The form of food.
Composition can be infant formula.
Composition can use the MCT and/or MCFA of the present invention to strengthen.
Term " reinforcing " means to add MCT and/or MCFA in the composition.For example, MCT and/or MCFA can be incorporated into
In composition (that is, add or be added in composition in the composition).
Composition such as food or food extracts natively includes an embodiment of MCT and/or MCFA wherein
In, meaning that the amount for the MCT or MCFA that the composition strengthened includes is more than in composition with MCT or MCFA reinforcings includes naturally
The amount of MCT or MCFA.
For example, MCT and/or MCFA that fortified compositions, food or food extracts include can be the equivalent without reinforcing
At least 1.5 times, at least 2 times, at least 5 times of MCT and/or MCFA in natural composition, food or food extracts, at least 10
Again, at least 20 times, at least 50 times or at least 100 times.
The present invention provides the medium chain triglycerides (MCT) of the present invention and/or medium chain fatty acid (MCFA) to be used for manufacturing
In the purposes for the drug or composition for improving the cognition being damaged because UBE3A lacks.The present invention also provides the middle chains of the present invention
Triglycerides (MCT) and/or medium chain fatty acid (MCFA) are for manufacturing for treating Angelman syndrome or Prader-
The drug of Willi syndromes or the purposes of composition.
Term " drug " includes composition as described herein, including nutritional supplement and whole nutritional prod.Drug can wrap
Containing suitable pharmaceutically acceptable carrier, diluent and/or excipient.
Using
The medium chain triglyceride (MCT) or medium chain fatty acid (MCFA) and composition of the present invention can be enteral or parenteral
Using.Preferably, MCT, MCFA or composition are enteral.For example, MCT or MCFA can be applied in the form of foodstuff or replenishers
With.
In general, using MCT, MCFA or composition of the present invention can for example by oral route or another way into
Enter gastrointestinal tract, such as application can also be fed by stomach tube and be carried out.
Therapy
In some aspects, the present invention relates to the treatments of Angelman syndrome or Prader-Willi syndromes.It is described to control
The cognition of the subject with Angelman syndrome or Prader-Willi syndromes can for example be improved by treating, and/or be reduced insane
The incidence of epilepsy breaking-out.
It should be understood that herein referring to all for the treatment of including curative, retentivity and prophylactic treatment；Although in this hair
It is more commonly associated with prophylactic treatment to referring to for prevention in bright context.Treatment may also include inhibition disease aggravation
Progress.
It is preferred that mammal, the specifically treatment of the mankind.However, human treatment and veterinary treatment are in the scope of the present invention
Within.
Subject to be treated may be, for example, children or infants.
Embodiment
Embodiment 1
Material and method
Animal
The male Wistar rat at 21 monthly ages is had subscribed from Janvier Labs (France), and is tamed 7 days in facility.
During this, they are housed in cage in pairs.
After domestication, according to cognition and weight, rat is randomly divided into four groups.Pass through society using regulation described below
It can recognize to test baseline cognitive.
Rat is individually housed in the standard cage that can freely obtain food and water, and holds it in 12 hour photoperiod
Under, temperature is 20 DEG C -24 DEG C, and relative humidity is 50%-60%.Rat is given via the animal normal diet especially prepared
The diet of 5% medium chain triglyceride (MCT)：Trivent OCG (C8), Triglyceride DDD (C10), C8 and C10 triglycerides
40: 60 combination or control (5% sunflower oil), continue 8 weeks.
Social recognition
It is acted on by social interaction's test to test the MCT behaviors of rat within 3 days before execution.The test is related to strange children
Year rat is introduced into the inhabitation cage for testing rat 4 minutes.The contact of infant rats, the amount of sniff and all-round exploration are recorded, and will
The total period of social interaction is used as social and anxiety index.After 1 hour, by the infant rats previously explored and new children
Year rat is introduced into inhabitation cage 4 minutes, and by exploring new childhood in the overall amount of time that two infant rats of exploration are spent
The time spent in rat, amount calculated social recognition (JNEW/ (JNEW+JOLD)), this be referred to as " new exploration of infant rats with
All-round exploration ".
Western blotting
Use NuPAGE Novex Midi gels (4%-12%；Life Technologies companies) carry out protein point
From.Use following antibody：Synaptophysin(D35E4)Rabbit monoclonal antibody (Cell Signaling companies, catalogue
Number #5461), Ube3a (Abgent companies, #346954), 'beta '-tubulin antibody (TUB 2.1, Santa Cruz companies, product
Catalog number (Cat.No.) #sc-58886) and beta-actin antibody (Sigma companies, catalog number #A1978).
With the corresponding IR fluorescence secondary antibody (#926-32213 from Li_COR Biosciences companies
800CW donkey anti-rabbits IgG and #926-68072680RD donkeys anti-mouse IgG) together incubate after, detect specific protein
White signal is simultaneously quantitative on Odyssey CLx imagers (LI-COR companies).
Gene expression detection is carried out by PCR
It is extracted using RNAdvance Tissue kits (Agencourt, Beverly, MA, USA) and purifies total serum IgE.Pass through
RNA sample is checked using fragment analyser (Advanced Analytical Technologies, Inc, Ames, IA, USA)
Quality.Using the PrimeScript kits (catalog number #RR037A) from Katara Clontech companies, according to system
The explanation for making quotient carries out reverse transcription using each RNA sample of 500ng.It is being added1536DNA Green
After Master (Roche companies, catalog number #5573092001), to gene expression on Roche LightCycler480
It is quantified.PCR reactions are carried out using the primer of following gene：Using Arc, snrpn, ube3a1 and beta-actin in
Source property compares.
Rat-Arc-F：acagacacagcagatccagc(SEQ ID NO：2)；
Rat-Arc-R：tgagtcatggagccgaagtc(SEQ ID NO：3)
Rat-Actin-F：gtcgtaccactggcattgtg(SEQ ID NO：4)；
Rat-Actin-R：ctctcagctgtggtggtgaa(SEQ ID NO：5)
Rat-Snrpn-F：TTGGTTCTGAGGAGTGATTTGC(SEQ ID NO：6)
Rat-Snrpn-R：CCTTGAATTCCACCACCTTG(SEQ ID NO：7)
Rat-Ube3a-F：GGCACCCTTGTTTGAAACTT(SEQ ID NO：8)
Rat-Ube3a-R：GCTCATGACCCTGTCCTTTC(SEQ ID NO：9)
As a result
Social recognition according to 8 weeks after baseline and chronic MCT treatments compares, compared with those of fed control diet, MCT
Cognitive performance in processing group improves (Fig. 1).
In addition, compared with those of fed control diet, observed in the cortex of 24 months old rats of MCT processing groups
UBE3a protein expressions increase (Fig. 2).
MRNA expression analysis shows that compared with the control group, MCT processing leads to the downward of transcription factor Arc, and to non-volume
The corresponding up-regulation (Fig. 3) of code RNA snrpn and ube3a1.
In short, these studies show cognitions to improve, wherein UBE3A expression can be played a role by lowering Arc.
The increase of UBE3A expression is attributable to the variation of non-coding RNA, snrpn and ube3a1.
Embodiment 2
Material and method
Animal
Have subscribed the male Wistar rat and 6 monthly age male rats at 15 monthly ages from Janvier Labs (France), and
It is tamed 7 days in facility.During this period, they are housed in cage in pairs.
After domestication, according to cognition and weight, rat is randomly divided into four groups.It is logical using regulation described in embodiment 1
Social recognition is crossed to test baseline cognitive.
Rat is individually housed in the standard cage that can freely obtain food and water, and holds it in 12 hour photoperiod
Under, temperature is 20 DEG C -24 DEG C, relative humidity 50%-60%.Give the diet of 5% medium chain triglyceride of rat (MCT)：It is pungent
Acid glycerol three ester (C8), Triglyceride DDD (C10), 50: 50 combinations of C8 and C10 triglycerides or control (sunflower oil), hold
It is 8 weeks continuous.
As a result
Compared according to the object cognition after baseline and chronic MCT treatments, compared with those of fed control diet, is observed
Cognitive performance in MCT processing groups improves (Fig. 4).
In addition, compared with those of fed control diet, observed in the cortex of 17 months old rats of MCT processing groups
UBE3a protein expressions increase (Fig. 5).
Embodiment 3
The UBE3A expression in prematurity mouse is analyzed, the prematurity mouse is between the gestational period and age at weaning (via shield
Reason) it is exposed to sad homogeneity triglycerides (MCT8) diet.
Material and method
Animal
So that female C57 mouse is mated, and pregnant tracking is carried out by vaginal smear.MCT8 is blended in animal normal diet
(1.5%) in, and it was administered between the 28th day postpartum within the 10th day the female mice of pregnancy in gestation, while pregnant mouse connects
By the normal diet (control) for being supplemented with 1.5% sunflower oil.
The 28th day postpartum, young rat brain and liver are collected, fixed, freezed and handled, to carry out UBE3A tables
It reaches.
In order to assess the cognitive performance effect for the treatment of, the 60th day postpartum using Morris water maze tasks to some animals
It is tested.Equipment for performance testing is made of a gallon can and the platform being placed in one of quadrant.By tank
Warm water (24 DEG C) is filled, keeps its opaque.Animal activity in camera record tank.Vision is arranged in several quadrants of tank to carry
Show.
Four experiments are carried out to every mouse daily, it is made to find platform.Experiment has carried out adding up four days, and at last
It carries out exploratory experiment (in the case where platform removes), and to assess space bias, (target quadrant is (that is, platform initial alignment
Position) in average duration %).
As a result
It observes that the UBE3A after MCT8 processing in brain is expressed to increase, but does not increase (Fig. 6) in liver.
These discoveries mean that the male parent UBE3A allele in brain is activated by MCT processing.
In the exploratory experiment of Morris water mazes, the female mice handled with MCT8 (C8-OTG) is spent in target quadrant
The time of expense is more than that horizontal (if mouse forgets platform quadrant position, 25% is expected average percent for 25% chance
Duration) (Fig. 7).
Embodiment 4
Material and method
People iCell neurons (Cellular Dynamics Intemational) are inoculated into 24 orifice plates, and are passed through
Culture 2 weeks, grows to neuronal maturation.Then octanoic acid or (100 μM) of capric acid processing cell 6 days are used, wherein every 2 days to Kong Zhongtian
Add primary fresh medium chain fatty acid (MCFA).Scraping cells are simultaneously stored in Trizol, and extract mRNA.According to above-mentioned side
Case carries out qPCR, horizontal to explore UBE3A and GRIN1.
GRIN1 is positive：TCTACAATGGCACCCACGTCATC(SEQ ID NO：10)
GRIN1 is reversed：GGTGCAGATCACCTTCTTGAC(SEQ ID NO：11)
As a result
It has been observed that both octanoic acid and capric acid increase UBE3A and ionotropic glutamate salt receptor N- methyl D-apartates
The expression of salt 1 (GRIN1) subunit (Fig. 8) (marker of synaptic plasticity).
Embodiment 5
Male Sprague-Dawley rat (is compareed into) domestication at least 5 days through 8MCT processing, and using 8 sunflower oils.
During entire research, the tap water that can be freely eaten is provided for all groups of animals.During entire research, also provided for animal
Standard diet (RM1, SDS Dietex).The use of administered by oral gavage syringe is that the animal that do not anaesthetize is administered orally (P.O.).
It is administered once per day for the treatment of MCT C8/C10 (1.8g/kg weight) or the conventional sunflower oils (1.8g/kg that ratio is 60/40
Weight), continue 5 days.After 5 days, animal is put to death, and collect brain and be stored at -80 DEG C.It is (preceding from the cerebral tissue of dissection
Frontal cortex/PFC) extraction RNA, and handle to carry out real-time PCR.It is examined according to t, MCT C8/C10 combinations significantly increase
The expression (being normalized to beta-actin) of UBE3A；*=p ＜ 0.05, as shown in Figure 9.
Embodiment 6
People iCell neurons (Cellular Dynamics International) are inoculated into 24 orifice plates, and are cultivated
2 weeks.Then under 3 kinds of different concentration of glucose (25mM, 4mM, 0mM), with various concentration (C8：0.25μM、2.5μM、25μM；
C10：0.5 μM, 5 μM, 50 μM) octanoic acid (C8) or capric acid (C10) processing cell 3 days.
Harvest cell is simultaneously handled, to carry out real-time PCR.Use following probe：UBE3A and beta-actin.
In the case of glucose is not present in the medium, octanoic acid/C8 and capric acid/C10 significantly increase UBE3A expression water
Flat (being normalized to beta-actin).
There are the low glucose of 4mM, 5 μM and 50 μM of capric acid/C10 significantly increases UBE3A expression and (returns
One turns to beta-actin 9, is such as measured using single factor test ANOVA).*=p ＜ 0.1；*=p ＜ 0.05；* *=p ＜ 0.01,
As shown in Figure 10.
All publications mentioned in the above specification are herein incorporated by reference.In the model for not departing from the present invention
In the case of enclosing with essence, the various modifications form and variations of the composition of the invention or purposes are for this field
Technical staff will be apparent.Although having combined specific preferred embodiment, invention has been described, should
Understand, claimed invention should not undeservedly be limited to such specific embodiment.In fact, to bioid
It learns with biotechnology or those skilled in the relevant art it is evident that the various of the pattern for putting into practice the present invention
Modification is intended to fall in the range of following claims.
Claims (15)
1. a kind of medium chain triglyceride (MCT) or medium chain fatty acid (MCFA), the MCT or MCFA are for improving because UBE3A is lacked
Weary and impaired cognition.
2. for the MCT or MCFA of purposes according to claim 1, recognize wherein the MCT or MCFA improves to suffer from
Know the cognition of the subject and/or aging subjects of obstacle.
3. for the MCT or MCFA of purposes according to claim 1 or 2, wherein the MCT or MCFA improvement suffers from
The cognition of the subject of Angelman syndrome or Prader-Willi syndromes.
4. a kind of medium chain triglyceride (MCT) or medium chain fatty acid (MCFA), the MCT or MCFA are comprehensive for treating Angelman
Simulator sickness or Prader-Willi syndromes are reduced for treating with the relevant cognition of aging.
5. for the MCT or MCFA of purposes according to any one of the preceding claims, wherein the MCT includes three
Independently there are only 8 or 10 carbon atoms, the preferably described fatty acid moieties to be divided into for a fatty acid part, each fatty acid part
Octanoic acid and/or capric acid part, or the wherein described MCFA are octanoic acid or capric acid.
6. for the MCT of purposes according to any one of the preceding claims, wherein the MCT is homogeneity glycerine three
Ester.
7. for the MCT or MCFA of purposes according to any one of the preceding claims, wherein the MCT or MCFA
Enteral or parenteral administration.
8. composition of the one kind comprising medium chain triglyceride (MCT) or medium chain fatty acid (MCFA), the composition is for improving
The cognition being damaged because UBE3A lacks.
9. for the composition of purposes according to claim 8, wherein the composition for improved suffers from cognitive disorder
Subject and/or aging subjects cognition.
10. for the composition of purposes according to claim 8 or claim 9, wherein the composition for improved suffers from
The cognition of the subject of Angelman syndrome or Prader-Willi syndromes.
11. composition of the one kind comprising medium chain triglyceride (MCT) or medium chain fatty acid (MCFA), the composition is for treating
Angelman syndrome or Prader-Willi syndromes are reduced for treating with the relevant cognition of aging.
12. for the composition of the purposes according to any one of claim 8 to 11, wherein the composition includes
Homogeneity triglycerides containing C8 aliphatic acid, preferably sad, and/or the homogeneity glycerine containing C10 aliphatic acid, preferably capric acid
Three esters.
13. for the composition of purposes according to claim 12, wherein the homogeneity comprising C8: C10 aliphatic acid is sweet
The ratio of oily three esters is about 50: 50 (w/w) to about 40: 60 (w/w).
14. for the composition of the purposes according to any one of claim 8 to 13, wherein the composition is food
The form of material.
15. for the composition of the purposes according to any one of claim 8 to 14, wherein the composition is drink
Material, mayonnaise, margarine, low-fat spreads, dairy products, cheese cream, processing cheese, dairy dessert, flavoured milk, milk
Oil, fermented dairy product, cheese, butter, condensed milk products, icecream mix, bean product, pasteurize egg liquid, baked product,
Confectionary product, candy bar, chocolate bars, stick high in fat, liquid meat gruel, spray-dried powders, freeze-dried powder, UHT puddings, bar
Family name sterilizes the form of pudding, gel, jelly, Yoghourt or the food with lipid filler or aqueous filler.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP15197930 | 2015-12-04 | ||
| EP15197930.9 | 2015-12-04 | ||
| PCT/EP2016/078313 WO2017093060A1 (en) | 2015-12-04 | 2016-11-21 | Method for improving cognition |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108289873A true CN108289873A (en) | 2018-07-17 |
Family
ID=54782585
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201680069352.XA Pending CN108289873A (en) | 2015-12-04 | 2016-11-21 | Method for improving cognition |
Country Status (6)
| Country | Link |
|---|---|
| EP (1) | EP3383382A1 (en) |
| JP (1) | JP2019500024A (en) |
| CN (1) | CN108289873A (en) |
| AU (1) | AU2016363511A1 (en) |
| CA (1) | CA3004996A1 (en) |
| WO (1) | WO2017093060A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110427536A (en) * | 2019-08-12 | 2019-11-08 | 深圳忆海原识科技有限公司 | One type brain decision and kinetic control system |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11406616B2 (en) | 2016-06-08 | 2022-08-09 | Sunregen Healthcare Ag | Lipids with odd number of carbon atoms and their use as pharmaceutical composition or nutritional supplement |
| JP2023525712A (en) * | 2020-05-19 | 2023-06-19 | ソシエテ・デ・プロデュイ・ネスレ・エス・アー | MCT Formulations to Improve Cognitive Function |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070179197A1 (en) * | 2000-05-01 | 2007-08-02 | Accera, Inc. | Compositions and methods for improving or preserving brain function |
| WO2009002145A1 (en) * | 2007-06-26 | 2008-12-31 | N.V. Nutricia | Lipid composition for improving function of brain functioning |
| CN101405054A (en) * | 2005-12-15 | 2009-04-08 | 雀巢技术公司 | Compositions and methods for preserving brain function |
| CN101820754A (en) * | 2007-10-04 | 2010-09-01 | 雀巢产品技术援助有限公司 | Compositions and methods for enhancing cognitive function |
| CN102781438A (en) * | 2009-12-30 | 2012-11-14 | 贝勒研究院 | Anaplerotic therapy for alzheimer's disease and the aging brain |
| CN107427485A (en) * | 2015-02-20 | 2017-12-01 | 雀巢产品技术援助有限公司 | For treating the medium chain fatty acid and its triglycerides of anxiety disorder |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20020006959A1 (en) * | 2000-05-01 | 2002-01-17 | Henderson Samuel T. | Use of medium chain triglycerides for the treatment and prevention of Alzheimer's Disease and other diseases resulting from reduced Neuronal Metabolism |
-
2016
- 2016-11-21 WO PCT/EP2016/078313 patent/WO2017093060A1/en active Application Filing
- 2016-11-21 JP JP2018525727A patent/JP2019500024A/en active Pending
- 2016-11-21 CN CN201680069352.XA patent/CN108289873A/en active Pending
- 2016-11-21 AU AU2016363511A patent/AU2016363511A1/en not_active Abandoned
- 2016-11-21 EP EP16798218.0A patent/EP3383382A1/en not_active Withdrawn
- 2016-11-21 CA CA3004996A patent/CA3004996A1/en not_active Abandoned
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070179197A1 (en) * | 2000-05-01 | 2007-08-02 | Accera, Inc. | Compositions and methods for improving or preserving brain function |
| CN101405054A (en) * | 2005-12-15 | 2009-04-08 | 雀巢技术公司 | Compositions and methods for preserving brain function |
| WO2009002145A1 (en) * | 2007-06-26 | 2008-12-31 | N.V. Nutricia | Lipid composition for improving function of brain functioning |
| CN101820754A (en) * | 2007-10-04 | 2010-09-01 | 雀巢产品技术援助有限公司 | Compositions and methods for enhancing cognitive function |
| CN102781438A (en) * | 2009-12-30 | 2012-11-14 | 贝勒研究院 | Anaplerotic therapy for alzheimer's disease and the aging brain |
| CN107427485A (en) * | 2015-02-20 | 2017-12-01 | 雀巢产品技术援助有限公司 | For treating the medium chain fatty acid and its triglycerides of anxiety disorder |
Non-Patent Citations (4)
| Title |
|---|
| J. CLAYTON-SMITH等: "angelman syndrome: a review of the clinical and genetic aspects", 《J. MED. GENEL.》 * |
| KATE WILLIAMS等: "dramatic loss of ube3a expression during aging of the mammalian cortex", 《FRONTIERS IN AGING NEUROSCIENCE》 * |
| KUI XU等: "Diet-induced ketosis improves cognitive performance in aged rats", 《ADV. EXP. MED. BIOL.》 * |
| SC CUNNANE等: "brain fuel metabolism, aging and alzheimer"s disease", 《NUTRITION》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110427536A (en) * | 2019-08-12 | 2019-11-08 | 深圳忆海原识科技有限公司 | One type brain decision and kinetic control system |
| CN110427536B (en) * | 2019-08-12 | 2022-03-04 | 深圳忆海原识科技有限公司 | Brain-like decision and motion control system |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2016363511A1 (en) | 2018-05-10 |
| EP3383382A1 (en) | 2018-10-10 |
| CA3004996A1 (en) | 2017-06-08 |
| JP2019500024A (en) | 2019-01-10 |
| WO2017093060A1 (en) | 2017-06-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lien et al. | DHA and ARA addition to infant formula: Current status and future research directions | |
| Cornish et al. | Consumption of seaweeds and the human brain | |
| Smuts et al. | A randomized trial of docosahexaenoic acid supplementation during the third trimester of pregnancy | |
| EP3218524B1 (en) | Faecalibacterium prausnitzii strains for treating and preventing gastrointestinal pain | |
| US11857527B2 (en) | Medium chain triglyceride compositions | |
| CN102740865A (en) | Mitochondrial function improver | |
| CN108289873A (en) | Method for improving cognition | |
| Ashwell | Diet and heart disease: a round table of factors | |
| CA3101266A1 (en) | Mct formulations for increasing ketone exposure and methods of making and using such formulations | |
| JP2022523560A (en) | Human milk oligosaccharides for use in improving executive function | |
| TW201813656A (en) | Composition for changing the expression of a clock gene capable of making the subject having changes that the afternoon drowsiness is decreased, the lucidity, will, mood and concentration ability are increased, and early morning tendency becomes stronger | |
| JP2018511558A (en) | Medium chain fatty acids and their triglycerides for the treatment of anxiety | |
| Caputo et al. | Hydrolyzed fat formula increases brain white matter in small for gestational age and appropriate for gestational age neonatal piglets | |
| CN108463234A (en) | The glucose metabolism activator of astroglia | |
| Rossholt et al. | Effect of arachidonic and docosahexaenoic acid supplementation on quality of growth in preterm infants: A secondary analysis of a randomized controlled trial | |
| Sinn et al. | Dietary supplementation with highly unsaturated fatty acids: Implications for interventions with persons with mental retardation from research on infant cognitive development, ADHD, and other developmental disabilities | |
| Corbett | Effects of dietary intervention on inflammation and intrauterine growth restriction in neonatal piglets | |
| US20200306324A1 (en) | Reducing body fat probiotic strain, composition thereof, and use thereof | |
| Izadi | Maryam Izadi Laybidi. melika izadi laybidi, J of Vac, Med & | |
| CN115697488A (en) | MCT formulations for improving cognitive function | |
| WO2022018094A1 (en) | Mct formulations for improving cognitive functions and methods of making and using such formulations | |
| Mulder | The complex relationship between omega-3 fatty acids and early neurodevelopment | |
| Gabbianelli et al. | 2nd European Summer School on Nutrigenomics | |
| CA3235524A1 (en) | Compositions and methods using a combination of nutrients to support cognition and emotional health in a mammal | |
| CN115590889A (en) | Bifidobacterium breve for regulating biological circadian rhythm and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20190716 Address after: Vevey Applicant after: SOCIETE DES PRODUITS NESTLE S. A. Address before: Vevey Applicant before: Nestle Products Technical Assistance Co., Ltd. |
|
| TA01 | Transfer of patent application right | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180717 |
|
| WD01 | Invention patent application deemed withdrawn after publication |