CN108203732B

CN108203732B - Application of TRIM24 in glioma diagnosis

Info

Publication number: CN108203732B
Application number: CN201711031231.9A
Authority: CN
Inventors: 冯海忠; 吕德官; 张伟伟
Original assignee: Renji Hospital Shanghai Jiaotong University School of Medicine
Current assignee: Renji Hospital Shanghai Jiaotong University School of Medicine
Priority date: 2017-10-27
Filing date: 2017-10-27
Publication date: 2021-07-27
Anticipated expiration: 2037-10-27
Also published as: CN108203732A

Abstract

The invention provides an application of co-expression of EGFR and TRIM24 in glioma diagnosis. The present invention provides a kit for diagnosing the malignancy of glioma or predicting the survival of a patient with glioma, characterized in that it comprises a reagent for detecting the expression level of TRIM24 gene and/or protein, or EGFR gene and/or protein, and TRIM24 gene and/or protein, TRIM24 gene and/or protein, and EGFRVIII gene and/or protein. The invention provides a new molecular marker of glioma, and aiming at the molecular marker, the invention also designs a molecular marker kit which can be used for judging the malignancy degree of glioma and predicting the survival time of a tumor patient, and is expected to develop a specific p-EGFR (epidermal growth factor receptor) in the future^Y1172Novel glioma treatment drug of/TRIM 24 signal channel and verification thereofHas therapeutic effect.

Description

Application of TRIM24 in glioma diagnosis

Technical Field

The invention relates to the use of EGFR-TRIM24 co-expression for the diagnosis and treatment of glioma.

Background

Gliomas are the most common primary intracranial tumors, mainly composed of 4 pathological types: astrocytomas, oligodendrogliomas, ependymomas, and mixed gliomas. According to the statistics of the American brain tumor registration center, malignant glioma accounts for about 70% of primary malignant brain tumor. Among the malignant gliomas, anaplastic astrocytomas (AA, WHO grade III) and glioblastoma multiforme (GBM, WHO grade IV) are most common, with GBM accounting for approximately 50% of all gliomas. Currently, glioma diagnosis relies primarily on CT and MRI. Some new MRIs, such as DTI, DWI, PWI, MRS, fMRI, help to improve diagnostic levels and prognosis. PET, SPECT helps to distinguish between tumor recurrence and radionecrosis. Ultimately, however, there is still a need to define the pathological diagnosis of gliomas by tumor resection or biopsy. That is to say: morphological observations have always been the basis for pathological diagnosis and grading of gliomas. The basic principle of glioma grading is the following 7 items: tumor cell density; polymorphism or atypical of neoplastic cells, including poorly differentiated and undifferentiated components; high heterogeneity or atypical of tumor nuclei, appearance of multinucleates and megakaryocytes; a high degree of nuclear fission activity; vascular endothelial cell proliferation (glomerular-like vascular proliferation occurs); necrosis (pseudorasped necrosis) and an increased proliferation index of Ki-67.

In order to cooperate with treatment, curative effect observation and prognosis judgment of glioma patients, the '2012 edition of China central nervous system glioma diagnosis and treatment guidelines' requires that all levels of hospitals in China carry out selective molecular biological markers according to local conditions according to actual conditions. LGG detection of IDH1 gene mutation and chromosome 1p/19q heterozygosity loss has important significance for clinical prognosis judgment. Gliomas characterized by differentiation into astrocytes and 60% -70% oligodendrogliomas express positive GFAP. Oligodendrocyte-specific nuclear transcription factor (Olig2) has certain reference value for identifying oligodendroglioma and astrocyte-derived glioma. The proliferation index of Ki-67 is closely related to the differentiation degree, infiltration or metastasis and prognosis of the tumor, and is one of the important reference indexes for judging the prognosis of the tumor. The neuron specific nucleoprotein (NeuN) has important significance for judging neuron components in tumors, and is mainly used for diagnosis and differential diagnosis of glial neuron tumors and neuroblastoma. In addition, according to the molecular biological markers related to the signal transduction pathway, the medulloblastoma can be divided into several molecular subtypes, such as Wnt type, Shh type and non-Wnt/Shh type. The classification is of great significance for clinical establishment of more optimal treatment schemes and accurate prognosis judgment, but is yet to be further verified for clinical pathology with large sample size.

At present, the treatment of glioma is mainly surgical resection, and radiotherapy, chemotherapy and the like are combined. Temozolomide (TMZ) concurrent radiotherapy combined with adjuvant chemotherapy has become the standard treatment for new GBM diagnosis. How to predict the responsiveness of malignant glioma to chemotherapeutic drugs and reduce the resistance to chemotherapy is the focus of chemotherapy. Endogenous O6-methylguanine-DNA methyltransferase (MGMT) methylation levels and chromosomal 1p/19q heterozygous deletions can be used to predict the chemotherapeutic response and prognosis of GBM and oligodendroglioma, respectively. Different types of gliomas also have different sensitivities to radiation therapy, and poorly differentiated tumors are generally considered to be more well differentiated. Medulloblastoma is most sensitive to radiation therapy, then ependymoma, glioblastoma multiforme is only moderately sensitive, and astrocytoma, oligodendroglioma, pinealoblastoma and the like are worse. For medulloblastoma and ependymoma, it is easy to spread with cerebrospinal fluid, and it should include irradiation of the whole spinal canal.

Therefore, only the progress in the molecular pathology and genetics of tumors provides more detailed information for the diagnosis of glioma, guides the clinical tumor grading and the selection of treatment methods, and makes more accurate assessment of the prognosis of patients. However, in China, particularly some small and medium-sized hospitals are lack of skilled neuropathologists, the postoperative pathological diagnosis is not accurate enough, and partial regions are not classified by WHO, so that the postoperative treatment of patients is lack of reliable pathological bases. This is very disadvantageous for the overall treatment and improvement of the efficacy of the treatment, and makes the evaluation of the clinical efficacy more difficult. On the other hand, highly heterogeneous glioma inevitably needs continuous discovery of a large number of new glioma molecular markers, so that an individualized comprehensive strategy, optimization and standard treatment scheme can be realized for the treatment of glioma, the maximum treatment benefit is achieved, the non-progress survival time of a patient is prolonged as much as possible, and the survival quality is improved.

Disclosure of Invention

The technical problem to be solved by the invention is to provide a novel molecular marker of glioma, which is used for diagnosing and treating glioma.

In order to solve the technical problems, the invention provides the following technical scheme:

a glioma malignancy diagnostic kit comprising a reagent for detecting the expression level of TRIM24 gene and/or protein, or EGFR gene and/or protein and TRIM24 gene and/or protein, TRIM24 gene and/or protein, and EGFRVIII gene and/or protein.

The invention also provides a life prediction kit for glioma patients, which is characterized by comprising a reagent for detecting the expression levels of TRIM24 gene and/or protein, EGFR gene and/or protein, TRIM24 gene and/or protein, TRIM24 gene and/or protein and EGFRVIII gene and/or protein.

The invention also provides application of a reagent for detecting the expression levels of the TRIM24 gene and/or protein, or the EGFR gene and/or protein and the TRIM24 gene and/or protein, the TRIM24 gene and/or protein and the EGFRVIII gene and/or protein in preparing a reagent for diagnosing the malignancy degree of glioma.

The invention also provides application of a reagent for detecting the expression levels of the TRIM24 gene and/or protein, or the EGFR gene and/or protein and the TRIM24 gene and/or protein, the TRIM24 gene and/or protein and the EGFRVIII gene and/or protein in preparing a survival prediction reagent for glioma patients.

Preferably, the EGFR protein is p-EGFR^Y1172。

The invention also provides application of a reagent capable of inhibiting the expression of the TRIM24 gene and/or protein, or the TRIM24 gene and/or protein and the EGFR gene and/or protein, or the TRIM24 gene and/or protein and the EGFRVIII gene and/or protein in preparation of a drug for treating glioma.

Preferably, the EGFR protein is p-EGFR^Y1172。

The invention also provides a glioma diagnostic kit, which is characterized by comprising a reagent for detecting the expression level of TRIM24 gene and/or protein, or EGFR gene and/or protein, TRIM24 gene and/or protein, TRIM24 gene and/or protein, and EGFRVIII gene and/or protein.

Preferably, the EGFR protein is p-EGFR^Y1172。

The principle of the invention is as follows: an important feature of human tumors is the amplification or high expression of oncogenes to abnormally activate oncogenic signaling pathways. In human gliomas, the Epidermal Growth Factor Receptor (EGFR) is frequently amplified and frequently co-expressed with its constitutively active mutant (Δ EGFR, also known as EGFRVIII or de2-7 EGFR). This activated oncogenic EGFR signaling pathway is involved in the development, progression and resistance of tumors to treatment. In general, EGFR induces tumors primarily through activation of the Akt pathway, which in turn stimulates tumor cell proliferation, survival, and resistance. In human gliomas, activation of the Akt pathway is mostly due to EGFR amplification and mutation, PI3KCA mutation, or PTEN deletion. In prostate and breast cancers, the Akt protein can be activated by ubiquitination modifications induced by the insulin-like growth factor-Tumor necrosis factor receptor-associated factor 6 (TRAF 6) or HER2-Skp2 axes, respectively. In addition to the aberrantly activated EGFR-Akt signaling axis and other oncogenic pathways identified in gliomas, it is likely that there are other more critical genes that contribute to tumorigenesis by participating in or acting in parallel to the above-identified oncogenic signaling pathways.

TRIM24 Trimotif protein family member 24(TRIM24) is also known as transcription mediator 1 α (TIF1 a). TRIM24 has an amino-terminal RBCC domain (Ring, B-Box and coded-Coil) characteristic of the TRIM family, as well as the PHD-bromo domain defining the TIF1 subfamily. TRIM24 has been shown to be a carcinogen or tumor suppressor. Although gene deletion in mouse TRIM24 promotes hepatocellular carcinoma (HCC), abnormal overexpression of human TRIM24 positively correlated with cancer progression and patient survival in patients with a variety of cancers, including gastric, bladder, non-small cell lung, head and neck, and breast cancers. In drosophila and human breast cancer, TRIM24 targets p53 as ubiquitin E3 ligase. TRIM24 is identified as a transcription cofactor for transcription factors such as estrogen receptors and androgen receptors in breast and prostate cancers, respectively, and activates downstream signaling associated with tumor progression. However, the function of TRIM24 in cancer remains largely unknown. From multiple database analyses we found that TRIM24 was highly expressed in gliomas and expression increased significantly with increasing grade. Proteomics studies of EGFR/EGFRVIII-stimulated different types of cancer cells have demonstrated that both TRIM24 gene and protein expression levels are significantly upregulated, suggesting that TRIM24 may play a role in EGFR-stimulated cancer cell behavior.

According to the invention, Oncomine data analysis and an immunohistochemistry method are used for detecting a glioma specimen, the proteomics expression level of the TRIM24 gene in a clinical glioma tumor specimen is found to be increased, in glioma derived cancer cell lines, EGF stimulates cell proliferation and survival to be mediated by TRIM24, TRIM24 transmits EGFR signals to participate in expression regulation of related oncogenes, and TRIM24 is a key factor for EGFR to drive tumor formation. The invention firstly discovers that the expression level of TRIM24 gene and protein is obviously increased by EGFR in glioma at home and abroad. The novel TRIM24 signaling pathway discovered by the present invention becomes a key relay for the EGFR oncogenic signaling pathway. The research of the invention shows that the EGFR (p-EGFR) with high expression and activation simultaneously^Y1172) With the gliomas of TRIM24, the higher the WHO pathological grade (higher the degree of malignancy), the significantly shorter the patient survival.

The invention also provides a method for preparing the polypeptide by using TRIM24 and p-EGFR^Y1172The immunohistochemical tumor detection kit can be used as an index and can be semi-quantitatively measuredThe expression levels of the two indexes in a patient glioma specimen are used for more accurately judging the malignancy degree of the tumor and more accurately predicting the life cycle of a tumor patient. The novel glioma diagnostic kit can be used for pathologists to quickly and accurately master TRIM24 and p-EGFR^Y1172The immunohistochemical staining operation method with two indexes can accurately detect the expression levels of the two proteins, accurately judge the malignancy degree of the tumor and accurately predict the life cycle of the tumor patient. The cancer screening method of the present invention can be readily combined with other methods to provide a more reliable diagnostic or prognostic indicator, thereby providing multi-marker testing.

Compared with the prior art, the invention has the beneficial effects that:

the invention provides a new glioma molecular marker TRIM24, and aiming at the molecular marker, the invention also designs a molecular marker kit which can be used for judging the malignancy degree of glioma and predicting the life cycle of a patient with tumor, and is expected to develop a novel glioma treatment drug specifically aiming at a TRIM24 signal channel in the future, and more carefully classify the patient through a detection result, so that the drug is more targeted and effective, the life cycle of the patient is cured or improved, and the life quality of the patient with glioma is improved.

Drawings

FIG. 1a analysis of normal brain and GBM expression levels of TRIM24mRNA from TCGA databases using oncomine. The data from the TCGA database indicated a significant increase in the expression level of TRIM24 gene in patients with glioblasts compared to normal brain tissue.

FIG. 1b is an analysis of the expression levels of TRIM24mRNA in normal brain, astrocytes class II-III and GBM from the GSE4290 dataset. P values were calculated by using paired two-way t-tests (a and b) and one-way analysis of variance with Newman-Keuls post-hoc tests. The results show that higher grade glioma patients express higher TRIM 24. TRIM24 may have an enzyme cutting relationship with glioma lesion and degeneration.

FIG. 2 qRT-PCR analysis of the effect of EGFRvIII on TRIM24mRNA expression in LN229 and U87GBM cells.

Exogenous EGFRvlII is stably overexpressed by lentivirus, and the expression of TRIM24 is analyzed by qRT-PCR, so that the overexpression of EGFRvlII can obviously promote the expression of TRIM24mRNA of glioma cells.

FIG. 3a is an immunoblot showing that we successfully over-expressed exogenous EGFRvlII, which can increase TRIM24 protein expression, in U87MG and LN229 glioma cells, while we successfully knocked down the U87/EGFRvIII cell TRIM24 protein expression with two different shRNAs. TRIM24 knock-down does not affect the expression and activation of EGFR of glioma cells and the expression of actin (beta-actin), but can obviously reduce the expression of TRIM24, which indicates that the vector has no off-target effect and the ShTRIM24 is effective.

Fig. 3b shows that EGFRvIII can significantly increase glioma U87 and LN229 cell proliferation, while knockout of TRIM24 can significantly inhibit U87 and LN229 cell proliferation caused by EGFRvIII.

Fig. 3c shows that EGFRvIII can significantly induce the proliferation and cloning formation of glioma cells U87 and LN229, while knockout of TRIM24 can significantly inhibit the clonogenic capacity caused by EGFRvIII, suggesting that TRIM24 is important for the growth of glioma driven by EGFRvIII.

FIG. 3 shows that EGFRvIII can remarkably induce local cell proliferation metastasis of glioma U87 and LN229, and the cell metastasis caused by EGFRvIII can be obviously weakened by knocking out TRIM 24.

Fig. 3e shows that FGFRvIII can significantly increase the growth of glioma U87 cells in vivo, while knockout of TRIM24 can inhibit the growth of glioma tumor caused by EGFRvIII.

FIG. 3f statistically shows that EGFRvIII increases glioma U87 and LN229 cell growth in vivo and that knockout of TRIM24 inhibits glioma tumor growth caused by EGFRvIII.

FIG. 4a We used mRNA-seq technique to analyze how TRIM24 mediates EGFRvIII regulates glioma hair development. EGFRvIII is overexpressed and TRIM24 is knocked down, mRNA-seq analyzes genes of EGFRvIII up-regulation and TRIM24 down-regulation, and we find that TRIM24 regulates the expression of 35 genes possibly to mediate the effect of EGFRvIII.

Figure 4b genes up-regulated by EGFRvIII and down-regulated by TRIM24 were found to be associated with cell proliferation pathways by functional annotation (GO) analysis.

FIG. 4c we analyzed the expression of the above genes in glioma patients. Hierarchical clustering analysis of patient gene expression data (GSE4290) shows that the 22 gene glioblastomas have obviously high expression compared with normal tissues, and the high expression of EGFR-TRIM24 has obvious positive correlation with glioma.

FIG. 5a immunohistochemical staining analysis of tumor specimens, p-EGFR, from clinical glioma patients^Y1172Tissue TRIM24 staining strongly positive (white circles) was also strongly positive (white circles), whereas p-EGFR^Y1172Tissue TRIM24 staining negative (shown in black box) was also negative (shown in black box). Suggesting p-EGFR^Y1172It also promotes the expression of TRIM24 in human gliomas.

FIG. 5b immunohistochemical staining with high expression of p-EGFR^Y1172And clinical glioma patients with TRIM24 had significantly reduced survival.

FIG. 6 is a diagram showing Q-PCR reaction conditions.

Detailed Description

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Furthermore, it should be understood that various changes and modifications can be made by those skilled in the art after reading the teachings of the present invention, and such equivalents also fall within the scope of the appended claims.

Example 1: elevated genomic expression levels of TRIM24 gene in clinical glioma tumor specimens

(1) Bioinformatic analysis 1:

opening an oncomine database (https:// www.oncomine.org /), inputting TRIM24 in a search bar for retrieval, selecting broad and CNS cancer in a Disease Summary for TRIM24 table, selecting cancer VS.

The results are shown in FIG. 1 a: analysis of data from TCGA showed that TRIM24mRNA had an average expression value (log) in 10 normal brain tissues₂)2.403, and the mean expression value in 542 patients with glioblastoma was 3.678 (log)₂) 2.503 times that of normal brain tissue, the expression level of TRIM24 in glioblastoma patients was significantly higher and statistically different (p ═ 1.17E-8).

(2) Bioinformatic analysis 2:

the data set GSE4290(Expression data of gliomasamples from Henry for Hot topic) is downloaded through a GEO database (https:// www.ncbi.nlm.nih.gov/GEO /), Expression information of TRIM24 of each patient is analyzed (pathological samples with incomplete information are not adopted), and is grouped by WHO pathological grading and is mapped through graphpad software, and the result is that the Expression of TRIM24 is obviously increased along with the increase of pathological grading (2 to 4) as shown in FIG. 1 b.

Example 2: exogenous EGFRvlII remarkably increases the expression level of glioma U87 and LN229 cell TRIM24 genes

EGFRvIII was infected by lentivirus into glioma U87 and LN229 cells, followed by RNA extraction and TRIM24 expression was detected by qRT-PCR.

2.1293 packaging of lentivirus particles by T cells:

293T cells (purchased from ATCC, ATCC number CRL-3216)^TM) Culturing in DMEM medium: containing 10% fetal bovine serum (Sigma, 12006C), 1% streptomycin (Gibco, 15140-122) and DMEM medium (Gibco, 10564011), was cultured at 37 ℃ in a sterile 5% CO2 incubator (thermo).

On the first day, 293T cells (cell number approximately 5X 10) seeded at the end of logarithmic growth on 10cm dishes were harvested⁶) The medium was aspirated off. Cells were gently washed with 2mL DPBS (Invitrogen, 14190250) to remove residual media, and the DPBS was gently aspirated (care was taken not to blow out 293T cells), repeated 3 times. After addition of 1ml of 0.25% trypsin (Gibco, 25200-072) and digestion at 37 ℃ for 2 minutes, 10ml of fresh DMEM were usedThe digestion was stopped in medium, the cells were dispersed evenly by repeated pipetting with a pipette or 1000ml alternate tip, counting 293T with a blood microplate counter plate, and then pipetting the appropriate volume of cell suspension into a six-well plate (Corning, 3516) with a cell count of approximately 5X 10⁵And the cells are allowed to grow for 24h, and the degree of cell confluence before transfection should be 80%.

The following day, following the instructions for the fugen-6 kit. The 293T cells were co-transfected with EGFRvlII viral plasmids (viral vector, Addgene, Plasmid 20737), psPAX2 (packaging Plasmid, Addgene, Plasmid 12260), pMT24G (coat Plasmid, Addgene, Plasmid 12259). Individual wells required 1ug of viral plasmid, psPAX20.75ug, pMT24G 0.25.25 ug, i.e., 4: 3: 1, respectively.

On the third day, 24h after transfection, the cells were replaced with 3ml of fresh DMEM medium per well and virus enrichment was started.

On day four, 48h after transfection, the culture medium, i.e., virus supernatant, was collected. The collected virus supernatant was aspirated by a 5mL syringe, filtered through a 0.45 μm filter (Millipore, SLHV013SL), and dispensed into 1.5mL centrifuge tubes to obtain 48h virus suspension, which was stored at 4 ℃ for 3-7 days or maintained at-80 ℃ for a long period of time for later use.

And continuously replacing 293T cells transfected with the virus with 3ml of fresh DMEM medium, and then, collecting virus supernatant after 24 hours, namely 72 hours after transfection, obtaining 72 hours of virus suspension according to the same operation steps as 48 hours of transfection, and storing at-80 ℃ for later use.

2.2 Experimental methods for lentivirus infection of LN229/EGFRvIII and U87/EGFRvIII cells:

1) LN229 and U87 cells (LN229, U87 cells purchased from ATCC, ATCC accession number CRL-2611, respectively) 18-24h prior to lentivirus infection^TMAnd HTB-14^TM) At 1 × 10⁵Spreading in 24-well plate, adding fresh DMEM medium, and culturing to make the number of cells in lentivirus transfection be 2 × 10⁵About hole. The fresh DMEM medium was composed of 10% fetal bovine serum (Sigma, 12006C) and 1% streptomycin (Gibco, 15140-122) in DMEM (Gibco, 10564011).

2) The following day, the medium was replaced with 2ml fresh DMEM medium containing 6. mu.g/ml polybrene (Sigma, H9628) and 100. mu.l of the virus suspension was added for 48H or 72H of transfection. Incubation was performed at 37 ℃.

3) After 24 hours, the medium containing the virus particles was replaced with fresh DMEM medium.

4) And (5) continuing culturing. Because the lentivirus contains GFP fluorescent protein, obvious fluorescent expression can be seen after 48 hours of transfection generally, and is more obvious after 72 hours. The lentivirus contains a puromycin resistance gene, puromycin (Sigma, P8833, final concentration of 400-800ng/ml) is added after 3 days of transfection, and the cells are overgrown and can be passaged. During this period, fresh medium containing the same puromycin concentration was replaced every 3 days and selection was continued for 2 weeks to obtain LN229/EGFRvIII, U87/EGFRvIII cells.

2.3qRT-PCR detection of TRIM24 Gene expression

After cells from which RNA was extracted were inoculated into a six-well plate (corning), and the walls of the wells were filled with the cells, mRNA was extracted according to the procedure of Trizol kit, and then mRNA was reverse-transcribed into cDNA according to the instruction of reverse transcription kit (RR037A) of Takara. The expression level of TRIM24 gene was detected by real-time quantitative PCR using an Applied Biosciences 7900HT real-time PCR system, with ACTB as an internal control. Threshold cycle numbers were calculated using Applied Biosystems SDS software 2.2.2.

The primer sequences are respectively (synthesized and identified by Shanghai biological engineering Co., Ltd.):

TRIM24 Sequence 1Forward Sequence: 5'-TGTGAAGGACACTACTGAGGTT-3' (SEQ ID NO: 1)

Sequence 2Reverse Sequence: 5' -GCTCTGATACACGTCTTGCAG-3(SEQ ID NO: 2)

ACTB Sequence 3Forward Sequence: 5'-CATGTACGTTGCTATCCAGGC-3' (SEQ ID NO: 3)

Sequence 4Reverse Sequence: 5'-CTCCTTAATGTCACGCACGAT-3' (SEQ ID NO: 4)

Q-PCR reaction System: the final concentration of the primers was 0.2. mu.M, and the total reaction volume was 50. mu.l

The Q-PCR reaction conditions are shown in FIG. 6.

The experiment was repeated 3 times. The results are shown in fig. 2, EGFRvIII significantly increased glioma cell TRIM24 gene expression by about 3-fold.

Example 3: in glioma-derived cancer cell lines, EGF requires TRIM 24-mediated stimulation of cell proliferation and survival

(1) Two shRNA viral plasmids of TRIM24 (shT24-1 viral Plasmid, Kjeldahl gene, 22927, shT24-2 viral Plasmid, Kjeldahl gene, 22930) and shRNA control viral Plasmid (shC viral Plasmid, Kjeldahl gene, CONO77) were infected with viruses formed by psPAX2 (packaging Plasmid, Addgene, Plasmid 12260), pMT24G (encapsium Plasmid, Addgene, Plasmid 12259) into LN229/EGFRv III and U87/EGFRvIII cells (LN229, U87 cells were purchased from ATCC, ATCC accession number CRL-2611, respectively) using fugen-6 kit (purchased from Roche, 04709705001) according to the experimental procedures of the specification^TMAnd HTB-14^TM)。

3.1293 packaging of lentivirus particles by T cells:

293T cells (purchased from ATCC, ATCC accession number CRL-3216)^TM) Culturing in DMEM medium: containing 10% fetal bovine serum (Sigma, 12006C), 1% streptomycin (Gibco, 15140-122) and DMEM medium (Gibco, 10564011) at 37 ℃ with 5% CO₂Culturing in sterile incubator (thermo).

On the first day, 293T cells (cell number approximately 5X 10) seeded at the end of logarithmic growth on 10cm dishes were harvested⁶) The medium was aspirated off. Cells were gently washed with 2ml of DPBS (Invitrogen, 14190250) to remove residual media, and the DPBS was gently aspirated (taking care not to blow out 293T cells) and repeated 3 times. After digestion at 37 ℃ for 2 minutes with 1ml of 0.25% trypsin (Gibco, 25200-⁵And the cells are allowed to grow for 24h, and the degree of cell confluence before transfection should be 80%.

The following day, following the instructions for the fugen-6 kit. The shRNA viral Plasmid of TRIM24, psPAX2 (packaging Plasmid, Addgene, Plasmid 12260), pMT24G (coat Plasmid, Addgene, Plasmid 12259) were co-transfected into 293T cells. A single well required 1ug of viral plasmid, psPAX20.75ug, pMT24G 0.25.25 ug, i.e., 4: 3: 1, respectively. Similarly, the shRNA control viral Plasmid, psPAX2 (packaging Plasmid, Addgene, Plasmid 12260), pMT24G (coat Plasmid, Addgene, Plasmid 12259) were co-transfected into 293T cells.

On the third day, 24h after transfection, virus enrichment was started by changing to 3ml fresh DMEM medium per well.

On day four, 48h post-transfection, the culture medium, i.e., virus supernatant, was collected. The collected virus supernatant was aspirated by a 5ml syringe, filtered through a 0.45 μm filter (Millipore, SLHV013SL), and dispensed into 1.5ml centrifuge tubes to obtain 48h virus suspension, which was stored at 4 ℃ for 3-7 days or maintained at-80 ℃ for a long period of time for later use.

Continuously replacing 293T of the transfected virus with 3ml of fresh DMEM medium, performing 24 hours again to obtain 72 hours after transfection, collecting virus supernatant, removing 293T cells in virus liquid according to the same operation steps of 48 hours after transfection to obtain 72 hours of virus suspension, and storing for later use.

3.2 Experimental methods for lentivirus infection of LN229/EGFRvIII and U87/EGFRvIII cells:

1) LN229/EGFRvIII and U87/EGFRvIII cells at 1X 10 h before lentiviral infection 18-24h⁵The cells were plated in 24-well plates and cultured in fresh DMEM medium so that the number of cells at the time of lentivirus transfection was 2X 10⁵About hole. The fresh DMEM medium composition of LN229/EGFRvIII and U87/EGFRvIII cells was DMEM medium (Gibco, 10564011) containing 10% fetal bovine serum (Sigma, 12006C), 1% penicillin (Gibco, 15140-122).

2) The following day, the medium was replaced with 2ml fresh DMEM medium containing 6. mu.g/ml polybrene (Sigma, H9628) and 100. mu.l of either 48H or 72H virus suspension was added. Incubation was performed at 37 ℃.

4) And (5) continuing culturing. Because the lentivirus contains GFP fluorescent protein, obvious fluorescent expression can be seen after 48 hours of transfection generally, and is more obvious after 72 hours. The lentivirus contains a puromycin resistance gene, puromycin (Sigma, P8833, final concentration of 400-800ng/ml) is added after 3 days of transfection, and the cells are overgrown and can be passaged. During the period, fresh culture medium containing the same concentration of puromycin is replaced every 3 days, and after continuous screening for 2 weeks, more than 90% of GFP positive cells (representing cells successfully infected by shRNA) are observed under a microscope.

3.3 immunoblotting to verify the efficiency of TRIM24 knockout by shRNA and the influence thereof on the expression of EGFR, p-EGFR, beta-actin

1) Collecting protein samples

Cells of LN229, U87, LN229/EGFRvIII, U87/EGFRvIII, LN229/EGFRvIII/shTRIM24 and U87/EGFRvIII/shTRIM24 were lysed on ice using Western and IP cell lysates (P0013) produced by Biyun plus 1 Xprotease inhibitor (cocktail, Roche, 17938100) for ten minutes, followed by centrifugation at 12000rmp/min for 10 minutes at 4 ℃. And (3) collecting the supernatant of the lysate into a new EP tube and marking, and after the protein samples are collected, in order to ensure that the loading amount of each protein sample is consistent, using a BCA protein concentration determination kit (Biyunyan, P0009) to determine the protein concentration of each protein sample according to the operation instruction of the BCA quantification kit.

2) Electrophoresis

a. SDS-PAGE gel formulation

The kit (P0012A) was prepared using SDS-PAGE gel produced in Byun. The kit provides all reagents except water and gel dispensing means and formulations for SDS-PAGE at various concentrations. The glass plate, clip, silica gel pad, etc. required for preparing the gel are washed clean and then dried at 37 ℃. The method comprises the steps of clamping a glass plate, adding deionized water for leak detection, mixing a proper amount of deionized water, 30% polyacrylamide, separation gel buffer solution, 10% APS and TEMED according to a preparation table of a specification to prepare separation gel with a required concentration, pouring the deionized water in the glass plate, carefully adding the separation gel into the glass plate to prevent bubbles from being generated, and adding the deionized water for sealing for 30min to wait for gel solidification. After the separation gel is solidified, the concentrated gel is prepared according to the preparation table of the instruction. Mixing a proper amount of deionized water, 30% polyacrylamide, a concentrated gel buffer solution, 10% APS and TEMED to prepare concentrated gel, pouring off water on the upper layer of the separated gel, adding the concentrated gel, and quickly and lightly inserting a comb to obtain the SDS-PAGE gel plate.

b. Sample processing

Concentrated 5 XSDS-PAGE protein loading buffer (Biyuntian SDS-PAGE protein loading buffer (5 XP 0015)) was added to the collected protein samples in proportion and heated in a boiling water bath for 5 minutes to fully denature the proteins.

c. Sample loading and electrophoresis

After the sample is cooled to room temperature, the prepared SDS-PAGE gel plate is taken down from the clamp and fixed on an electrophoresis device. SDS-PAGE electrophoresis (P0014A) produced in Biyun sky of 1X was added into the electrophoresis tank, and both sides of the comb were vertically and uniformly pulled out with force.

And directly loading the protein sample into the SDS-PAGE gel sample loading hole.

In order to facilitate the observation of the electrophoresis effect and the membrane transfer effect, the molecular weight of the protein was judged by using a prestained protein molecular weight standard (P0066).

The outer chamber used was 1xSDS-PAGE (P0014A) produced in Biyun.

During electrophoresis, a low voltage constant voltage electrophoresis was used for the upper gel, and a high voltage constant voltage electrophoresis was used for the bromophenol blue contained in the SDS-PAGE protein loading buffer (Biyutian SDS-PAGE protein loading buffer (5X, P0015)) into the lower gel.

When electrophoresis is carried out, the bromophenol blue reaches the position near the bottom end of the gel, and then the electrophoresis is stopped.

3) Rotary film

The PVDF membrane (FFP36/FFP39) is produced in Biyun sky.

Putting the cut PVDF membrane into a proper amount of methanol for soaking and activating, cutting off the concentrated glue, putting the soaked PVDF membrane and the separation glue into a sandwich structure of a membrane transferring clamp (filter paper-PVDF membrane-gel-filter paper), inserting the membrane transferring clamp into a membrane transferring groove, adding 1 xTris-glycine membrane transferring liquid (Kangji, CW0044), and transferring the membrane for about 90min at a constant 300 milliampere.

Note: the PVDF membrane is arranged at the positive pole of a power supply, and the gel is arranged at the negative pole of the power supply, so that the situation that the reverse releasing protein cannot be transferred to the membrane is prevented. The film transfer process has serious heating phenomenon, so the film transfer tank is placed in an ice bath for film transfer.

4) Sealing of

Immediately after the membrane transfer, the protein membrane was placed in a Western blot solution (Biyuntian, P0023C) prepared in advance, and rinsed for 2 minutes to wash off the membrane transfer solution on the membrane. In all the steps after the film is transferred, the moisture retention of the film is needed to be paid attention to so as to avoid the drying of the film, otherwise, a higher background is easily generated. The washing solution is aspirated up by a dropper, etc., and Western blocking solution (Biyunyan, P0023B) is added, and the mixture is slowly shaken on a shaking table and sealed for 1-2h at room temperature.

5) Primary antibody incubation

Primary antibodies were diluted with Western primary antibody diluent (petunia, P0023A) at appropriate ratios, according to the instructions for primary antibodies. EGFR antibody (Ab-1, Oncogene Science, 1: 1000), TRIM24 antibody (#14208-1-AP, protein Group, 1: 1000), and β -actin (I19, Santa Cruz Biotechnology, 1: 2000). The blocking solution was aspirated off with a dropper, diluted primary antibody was immediately added and incubated overnight at 4 ℃ on a side-shaking table with slow shaking. Recovering the primary antibody. Western-washing (Biyunyan, P0023C) was added and washed on a side-shaking table for 10 minutes with slow shaking. After the washing solution was sucked up, the washing solution was added again to wash for 10 minutes. The total number of washes was 3. If the result background is high, the washing time can be prolonged and the number of washing can be increased appropriately.

6) Incubation with secondary antibody

Referring to the specification of the secondary antibody-Biyunta horseradish peroxidase-labeled goat anti-mouse IgG (H + L (A0216) and goat anti-rabbit IgG (H + L) (A0217), a secondary antibody labeled with horseradish peroxidase (HRP) is diluted with a Western secondary antibody diluent (P0023D) according to the ratio of 1: 1000, a washing solution is aspirated up by a dropper, the diluted secondary antibody is immediately added, the incubation is performed for one hour at room temperature by slowly shaking on a side shaking table, the secondary antibody is recovered, the washing solution (P0023C) is added, the washing solution is slowly shaken on the side shaking table for 10 minutes, the washing solution is further added after the washing solution is aspirated up, and the washing is performed for 10 minutes, 3 times are performed, and the washing time can be properly prolonged and the washing times can be increased if the background is high.

7) Protein detection

Proteins were detected using the BeyoECL Plus (P0018) ECL reagent, with reference to the relevant instructions. And (4) developing by using an automatic X-ray film developing machine.

The results are shown in fig. 3a, where shTRIM24 was able to significantly reduce the expression level of TRIM24 in LN229 and U87 cells compared to the control lentiviral plasmid shC, indicating that we constructed cell lines successfully and efficiently. ShTRIM24 stimulation did not affect the expression levels of EGFR, β -actin in LN229 and U87 cells. This indicates that TRIM24 is located downstream of the EGFR pathway.

(2) Reducing TRIM24 in LN229 and U87 inhibits EGFRvIII-stimulated cell proliferation of LN229 and U87.

LN229 and U87, cancer cell lines, were tested for their ability to proliferate in vitro using the WST-1 kit (purchased from Roche, 05015944001) according to the instructions. The results are shown in fig. 3b that EGFRvIII stimulation can significantly improve the cell proliferation capacity of LN229 and U87. After using shT24 to reduce TRIM24 expression in LN229 and U87, EGFRvIII no longer stimulated cell proliferation of LN229 and U87.

(3) Reduction of TRIM24 in LN229 and U87 inhibited the formation of soft agar clones of LN229 and U87 stimulated by EGFRvIII.

1) Taking cells in logarithmic growth phase, digesting with 0.25% pancreatin, gently blowing to make them into single cells, counting the living cells, adjusting the cell density to 1 × 10 with DMEM medium containing 20% fetal calf serum⁶cell/L.

2) Two concentrations of 1.2% and 0.7% agar solution (BD, 214220) were prepared from distilled water, and were maintained at 40 deg.C without coagulation after autoclaving.

3) Mixing 1.2% agar solution and 2 × DMEM culture medium (containing 2 × antibiotic and 20% fetal calf serum) at a ratio of 1: 1, adding 3mL of the mixture into a dish with a diameter of 6cm, cooling, solidifying, and placing into a CO container as bottom layer₂And 4, keeping the temperature in the incubator for later use.

4) Mixing 0.7% agar solution and 2 × DMEM at a ratio of 1: 1After the media were mixed in a sterile tube, 0.2mL (cell number 5X 10) was added to the tube⁴/ml) was mixed well and poured into a dish with a 1.2% agar bottom layer to form a layer of diagar. After the upper agar is solidified, put in 5% CO at 37 DEG C₂Culturing in incubator for 10 days.

5) The plate was placed under an inverted microscope and the cell clone number was observed. The formation rate is calculated. The number of clones was scored after 2-3 weeks using an Olympus SZX12 stereomicroscope and the data was analyzed using GraphPad software.

The results are shown in fig. 3c, exogenous overexpression of EGFRvlII can significantly increase the cell clone formation rate of cell lines. And after the expression of TRIM24 is reduced on the basis of exogenous over-expression of EGFRvlII, the EGFRvIII cannot increase the cell clone formation rate of the cell strain.

(4) The reduction of TRIM24 in LN229 and U87 can inhibit LN229 and U87 migration caused by EGFRvIII stimulation. Cell migration analysis was performed using a corning transwell chamber. Each cell serum was starved for 24 hours, washed with PBS and resuspended in DMEM with 0.1% FBS. Then, the cells were placed in the top compartment of the chamber and the bottom compartment was added with 10% FBS in DMEM. Cells were allowed to migrate through a membrane of 8 μm pore size at 37 ℃ for 10 or 16 hours. Then, the film was fixed, stained with crystal violet, photographed at 8 spots randomly selected up, down, left, and right with an objective lens of 10-fold or 20-fold using an inverted microscope as a starting point, and analyzed. As shown in fig. 3d, Transwell chamber migration experiments confirmed that EGFRvIII can significantly induce local metastasis of glioma U87 and LN229 cells, while knockout of TRIM24 can significantly reduce cell metastasis caused by EGFRvlII.

(5) U87 cells exogenously overexpressing EGFRvIII (U87/vIII) constitutively activated EGFR independent of EGF ligand, and transplantation of such cells into nude mouse brain induced tumors. The expression of TRIM24 (U87/vIII/shT24#1 and U87/vIII/shT24#2) in U87/vIII is reduced, and the tumor forming capability of U87/vIII in the brain of a nude mouse can be inhibited.

5.1 nude mice intracerebral tumor formation experiment:

each group of 6 nude mice was anesthetized with 1% sodium pentobarbital, fixed in a brain stereotaxic apparatus,sterilizing skin, making a median incision on the top of head, exposing bregma, making a vertical needle insertion from the surface of brain by 2.8mm, and slowly injecting 5 μ l of cells (5 × 10 in total) into unilateral brain parenchyma with Hamilton microsyringe (701-N) at the position 1.5mm behind bregma and 0.8mm to the right of midline⁵Cells, resuspended in DPBS), injection time 5min, needle retention 2min, slow needle withdrawal. All procedures were performed under sterile conditions and the wounds were closed. And (4) putting the nude mice back to the SPF laminar flow frame for feeding, and observing and recording the survival period of the nude mice.

5.2 taking the nude mouse brain, OCT embedding and freezing section:

after 2-5 weeks, when the nude mice have brain tumor symptoms such as obvious emaciation and high back curvature, CO is used₂The nude mice were anesthetized. The neck is cut off rapidly. The skin at the top of the head was cut open and the skull and pia mater were peeled away, exposing the entire rat brain. Gently remove rat brain, excise olfactory bulb and cerebellum, embed in OCT (Sakura, 14-373-65), and place in-80 deg.C refrigerator quickly. The following day, the embedded blocks were sectioned in a freezing microtome to a thickness of 7 microns. The slices were stored in a-80 ℃ freezer.

5.3 cryosection HE staining:

the sections were taken out from a freezer at-80 ℃, equilibrated at room temperature until water drops were dried, and stained using HE staining kit produced in petunia.

The results are shown in FIG. 3e, where U87/P/shC represents control plasmid shC transfected with shTRIM24 in parental cells without exogenous EGFRvlII expression. U87/vIII/shC represents a control plasmid shC transfected shT24 in exogenous EGFRvlII over-expressed U87/vIII cells. U87/vIII/shT24 represents transfection shT24 in exogenous EGFRvIII over-expressed U87/vIII cells. The parent U87 control cell (U87/P/shC) formed very small tumors in the nude mouse brain (shown in black box), and after overexpression of EGFRvIII and transfection of shT24 control shC, U87/vIII/shC induced tumors significantly in the nude mouse brain (shown in black box), while reducing TRIM24 expression in U87/vIII (U87/vIII/shT24#1, U87/vIII/shT24#2), U87/vIII/shT24 hardly induced tumors in the nude mouse brain (shown in black box).

(6) Using Graphpad prism5.0 software, statistical differences between each index at U87/vIII/shT24#1, U87/vIII/shT24#2, and U87/vIII/shC and the control group U87/P/shC were compared by one-way anova, with the results shown in FIG. 3 f: the size of the tumor formation in the brain of the nude mice in the U87/vII/shC group was significantly increased compared to the U87 parental control cell (U87/P/shC). While TRIM24 expression of U87/vIII (U87/vIII/shT24#1, U87/vIII/shT24#2) was reduced, and U87/vIII failed to form tumors in the brains of nude mice.

Example 4: TRIM24 mediates EGFR-driven tumorigenesis by modulating proliferation-related pathway signaling expression

(1) mRNA-seq analysis shows that TRIM24 regulates the effect of a part of oncogene expression on mediating EGFR glioma growth promotion. Cells to be analyzed were seeded into 10cm culture dishes maintained in modified DMEM basal medium supplemented with 10% fetal bovine serum, all cell lines at 37 ℃ and 5% CO₂And (5) culturing. LN229/P/shC represents a control plasmid shC (viral plasmid, Kjeva gene, CONO77) transfected with shT24 in parental cell LN229 without exogenous EGFRvIII expression. LN229/vIII/shC represents a control plasmid shC (viral plasmid, Kjeldahl gene, CONO77) transfected with shT24 in exogenous EGFRvIII over-expressed LN229/vIII cells. LN229/vIII/shT24 represents the transfection of shT24(shT24-1 viral plasmid, Kjeldahl gene, 22927, shT24-2 viral plasmid, Kjeldahl gene, 22930) in LN229/vIII cells with exogenous EGFRvIII over-expressed, in the same way as in example 3, two shT24 plasmids were used for transfection in this experiment in order to better verify the effect of reduced expression of TRIM24 on the subsequent signaling pathway. Total RNA was extracted and purified using Qiagen RNeasy Mini reagent kit (Valencia, CA, USA) according to the manufacturer's instructions. The quality of the RNA was assessed by a bioanalyzer prior to sequencing. A poly (A) + RNA library was prepared according to the protocol of Illumina. The library was sequenced on the Illumina HiSeqX ten platform. The criteria for differentially expressed gene detection in this study were False Discovery Rate (FDR) < 0.05, fold change > 1.5 fold. The gene phenotype was integrated with Cluster 3.0 and viewed using Java Tree View 3.0. The results are shown in fig. 4a, TRIM24 regulates the expression of 35 genes, which include proliferation related genes such as ID1, ID3, FGFR, and the like, and these genes together mediate the development of EGFR glioblastoma.

(2) Gene Ontology (GO) annotation analyses the function of TRIM 24-regulated genes. The biological function of the gene regulated by EGFR-TRIM24 was analyzed on line by using the information analysis function of GO database (http:// genentology. org /), as shown in FIG. 4b, the gene regulated by TRIM24 was related to cell proliferation signals such as cell cycle regulation and metabolism.

(3) Analysis of clinically relevant data TRIM24 regulated gene was highly expressed in gliomas. Next, whether the gene regulated by TRIM24 is closely related to the development of clinical glioma was analyzed. The Expression condition of the gene regulated by TRIM24 in the pathological tissue and the normal brain tissue of glioma is analyzed by downloading a data set GSE4290(Expression data of gliomas samples from Henry for Hospital) through a GEO database (https:// www.ncbi.nlm.nih.gov/GEO /), the heatmap result is shown in figure 4c, most (22/35) genes regulated by TRIM24 are obviously up-regulated in glioma, and TRIM24 pathway related proteins can distinguish healthy volunteers from glioma adults.

Example 5: co-expression of TRIM24 with p-EGFRY in clinical glioma specimens¹¹⁷²Significantly reduce the life span of patients

A kit for diagnosing the malignancy of glioma or predicting the survival of a patient with glioma, comprising a reagent for detecting the expression levels of EGFR protein and TRIM24 protein, wherein the reagent for detecting the expression levels of EGFR and TRIM24 is p-EGFR^Y1172Antibody (Rabbit polyclonal to p-EGFR^Y1172Signalway Antibody) and TRIM24 Antibody (Rabbit polyclonal to TRIM24, proteintech group, 14208-1-AP).

(1) 132 WHO II-IV grade clinical glioma specimen sections were collected for immunohistochemical staining:

1.1 glioma tumor specimens were collected from 132 humans (including 31 WHO grade II, 23 WHO grade II, and 78 WHO grade glioma tumors) and 7 normal brain tissues without significant pathological lesions and history. Making paraffin sections by a conventional method.

Tissue paraffin embedding and sectioning steps:

1) material taking: glioma patients confirmed by hospitals with the syndrome of the pathological tissues of Laji, who have signed an informed consent

2) Fixing: the removed pathological tissues are immediately put into a fixing solution (10% formalin or 4% paraformaldehyde) for fixing overnight, and the purpose of fixing is to prevent the tissues from being metabolized and the like to destroy the structure of the tissues.

3) Washing: the fully fixed tissue is gently taken out, placed in an embedding small box, then placed in a beaker, and rinsed with a small flow of tap water for one hour to rinse the fixation solution clean.

4) And (3) dehydrating: since the tissue contains a large amount of water, which is not miscible with paraffin, paraffin fixation is performed by removing water from the tissue. Alcohol is a commonly used dehydrating agent. The washed tissue was dehydrated overnight in 70% alcohol. Taking out the sample from 70% sample, sequentially dehydrating with 80%, 90%, 95%, 100% alcohol, respectively dehydrating with 80%, 90%, 95% alcohol for 30min, and dehydrating with 100% alcohol for 1 h. The sample may not be excessively dehydrated or retained for long periods of time at subsequent concentrations that may cause tissue hardening.

5) And (3) transparency: after dehydration, the water in the sample was replaced by alcohol, but the alcohol was still immiscible with paraffin, so that subsequent clarification was performed using xylene, which is soluble in both alcohol and paraffin. The dehydrated tissue is soaked in xylene to make the xylene replace alcohol and enter the tissue, which is called as transparency. The process of clearing is completed by first passing a 1: 1 solution of xylene and alcohol for 30 minutes and then putting in pure xylene until clear. If the transparent time is too short, the transparency is not thorough, and the paraffin is difficult to be immersed in the tissues; if the time for transparency is too long, the tissue becomes hardened and brittle, and thus, it is difficult to cut a complete slice. If the tissue appears transparent and black, the transparency is successful, and if the tissue appears white, the dehydration is incomplete and needs to be dehydrated again).

6) Wax dipping: transparent complete tissue then can carry out the wax dipping operation, let paraffin get into inside the tissue, play the support fixed action, do benefit to the tissue slice. Respectively putting into molten paraffin I, II and III for treatment.

7) Embedding: and taking the tissues subjected to wax immersion to an embedding machine for embedding, adding molten clean paraffin into a preheated mold, quickly transferring the preheated tissues into the mold, covering the mold with an embedding box, cooling the mold on ice for 15 minutes, and slightly buckling off a wax block.

8) Slicing: and (4) slicing the completely solidified wax block to prepare a sliced specimen. Putting the wax block into a buckle of a paraffin slicer (LEICA, RM2235), adjusting the position of a cutter head, placing the wax block, slicing according to the operation specification of the slicer, slightly picking a complete and relatively flat tissue slice into hot water, slightly fishing out a well-laid slice at an angle of 45 degrees by using a glass slide, obliquely shaking the glass slide upwards to remove redundant water, firmly sticking the slice on the glass slide, and drying in an oven at 37 ℃ for later use.

1.2 immunohistochemical staining of paraffin sections (two-step method) was as follows:

reagent: 0.01M (pH7.4) Phosphate Buffered Saline (PBS), double distilled water, gradient alcohol, xylene, and citric acid antigen retrieval buffer (Mixin, MVS-0100); concentrated DAB kit (Dako, K340811), neutral gum, and p-EGFR^Y1172Antibody (Rabbit polyclonal to p-EGFR^Y1172Signalway Antibody), TRIM24 Antibody (Rabbit polyclonal to TRIM24, proteintech group), negative control (PBS without primary Antibody), anti-Rabbit non-biotin two-step immunohistochemical detection reagent (PV-6001, China fir bridge Biotechnology, Inc.).

The instrument comprises the following steps: a slicing frame; an incubation box; an oven; a pipettor; a small glass dyeing vat; water bath pot

The method comprises the following specific steps:

1) the paraffin sections were placed in an oven at 60 ℃ and the sections were baked for 30 minutes.

2) Dewaxing pure dimethylbenzene: I. II 20 minutes each.

3) Gradient alcohol dewaxing: 100% alcohol I, 100% alcohol II, 95% alcohol, 90% alcohol, 80% alcohol each 5 minutes, double-distilled water washing 5 minutes x2 times.

4) Antigen heat repair: placing the slices into a container containing citric acid antigen repairing buffer solution (Mixin, MVS-0100), and heating in a microwave oven to maintain the temperature of the liquid in the container at about 98 deg.C for 15 min. The vessel was removed and allowed to cool at room temperature for 30 minutes (slices could not be removed from the buffer and allowed to cool so that the protein could regain its original spatial configuration). PBS wash 5 minutes × 3 times.

5) The liquid around the tissue was blotted with filter paper, 1 drop of endogenous peroxidase blocking reagent (anti-rabbit non-biotin two-step immunohistochemical detection reagent 1, Zhonghuajin bridge biotechnology limited PV-6001) was added to each slice, which was placed in an incubation box, and a small amount of double distilled water was placed at the bottom of the box. The cassette was incubated in a 37 ℃ water bath for 15 minutes to block the activity of endogenous peroxidase. PBS wash 5 minutes × 3 times.

6) Sucking the liquid around the tissue with filter paper, adding 1 drop (30-50 ul) (pEGFR) per section^Y1172Antibody 1: 100, TRIM24 antibody 1: 200), incubated at 37 ℃ for 2 hours, washed 5 minutes in PBS x 3 times.

7) Dripping 100 μ L enzyme-labeled goat anti-rabbit IgG polymer (anti-rabbit non-biotin two-step immunohistochemical detection reagent 2, Zhonghua Jinqiao biotechnology Co., Ltd. PV-6001), and incubating at room temperature for 20 min; PBS buffer wash 3 minutes × 3 times.

8) Sucking the liquid around the tissue with filter paper, adding 1 drop of freshly prepared DAB liquid (adding 2.5 mu l B liquid per 500 mu l A liquid according to the instruction) into each section, developing for 5 minutes, grasping the developing degree under a microscope, showing yellow-brown stains, and placing in double distilled water to stop developing.

9) Hematoxylin counterstaining is carried out for 3 minutes, tap water washing is carried out for 30 seconds, hydrochloric acid alcohol (the volume ratio of the hydrochloric acid to the alcohol is 1: 100) is differentiated for 5 seconds, and tap water washing is carried out for 15 minutes.

10) Gradient alcohol dehydration: 80% alcohol, 90% alcohol, 95% alcohol, 100% alcohol I, and 100% alcohol II each for 5 minutes.

11) And (3) xylene transparency: I. II 10 minutes each.

12) And (5) sealing the neutral gum.

12) Oven drying in 60 deg.C oven, observing under microscope, and observing with TRIM24 antibody and p-EGFR^Y1172Glioma specimens that were positive for antibody staining are shown in FIG. 5 a.

(2) Kaplan-Meier survival analysis was performed on the score of immunohistochemical staining and patient survival using Graphpad prism 5.0. Scoring the specimen according to the percentage of signal molecule positive cells: -no signal detectable by all tumor cells, 0%; +/-, low expression or no signal, less than 1% positive cells; 1+, -5-25% positive cells; 2+, -25% positive cells; 3+, -50% positive cells. -or + -stained tumors are considered low expressing tumors, while 1+ to 3+ tumors are high expressing tumors. The results are shown in FIG. 5b, which simultaneously highly express TRIM24 and p-EGFR^Y1172(dotted line) survival of clinical glioma patients was significantly shortened. The research of the invention shows that the EGFR (p-EGFR) with high expression and activation simultaneously^Y1172) With the gliomas of TRIM24, the higher the WHO pathological grade (higher the degree of malignancy), the significantly shorter the patient survival.

<110> Shanghai university of traffic medical college affiliated renji hospital

<120> use of TRIM24 in glioma diagnosis

<160>4

<210> 1

<211> 22

<212> DNA

<213> human (Homo sapiens)

<400> 1

TGTGAAGGACACTACTGAGGTT 22

<210> 2

<211> 22

<212> DNA

<213> human (Homo sapiens)

<400>2

GCTCTGATACACGTCTTGCAG 22

<210> 3

<211>21

<212> DNA

<213> human (Homo sapiens)

<400> 3

CATGTACGTTGCTATCCAGGC 21

<210> 4

<211> 21

<212> DNA

<213> human (Homo sapiens)

<400> 4

CTCCTTAATGTCACGCACGAT 21

Claims

1. Use of a reagent for detecting the expression levels of an EGFR protein and a TRIM24 protein, or a TRIM24 protein and an EGFRVIII protein in the preparation of a survival prognosis reagent for glioma patients, wherein the reagent for detecting the expression levels of the EGFR protein and the EGFRVIII protein is p-EGFR^Y1172The reagent for detecting the expression level of the TRIM24 protein is TRIM24 antibody.