CN108034726B

CN108034726B - Application of reagent for detecting MLH1 expression level in preparation of tumor targeted drug sensitivity detection kit

Info

Publication number: CN108034726B
Application number: CN201810050349.4A
Authority: CN
Inventors: 彭星辰; 何金兰; 李平
Original assignee: West China Hospital of Sichuan University
Current assignee: West China Hospital of Sichuan University
Priority date: 2018-01-18
Filing date: 2018-01-18
Publication date: 2021-07-30
Anticipated expiration: 2038-01-18
Also published as: CN108034726A

Abstract

The invention discloses a tumor targeted drug sensitivity detection kit, which comprises an optional reagent for detecting the expression level of MLH 1. The invention also discloses application of the reagent for detecting the MLH1 expression level in preparing a tumor targeted drug sensitivity detection kit. The kit can judge the sensitivity of tumor patients to targeted drugs sorafenib and sunitinib by detecting the expression level of MLH1, is used for predicting the drug treatment effect of clinical tumor patients, provides basis for patients to take related treatment measures or decisions, and has good clinical application prospect.

Description

Application of reagent for detecting MLH1 expression level in preparation of tumor targeted drug sensitivity detection kit

Technical Field

The invention belongs to the field of tumor molecular biology, and particularly relates to an application of a reagent for detecting MLH1 expression level in preparation of a tumor targeted drug sensitivity detection kit.

Background

With the development of molecular biology technology, people have further knowledge on the tumor pathogenesis, and then begin to treat the cell receptor, the key gene and the regulatory molecule as targets, which is called targeted therapy, so that the tumor targeted drug also becomes an important drug for treating the tumor. Compared with the traditional chemotherapy drugs, the tumor targeting drug has the advantages of strong specificity, obvious curative effect, less normal tissue damage and the like, and the drugs mainly comprise two types, namely monoclonal antibodies and small molecular compounds. At present, sorafenib (marketed in 2005, sorafenib, BAY 43-9006), sunitinib (marketed in 2006, sunitinib, SU 11248) which are multi-target therapeutic drugs are marketed and a plurality of multi-target small molecule compounds are in clinical test.

The tumor-targeted small-molecule compound medicine shows broad-spectrum antitumor activity, particularly, the general survival of patients with advanced tumors such as liver cancer, kidney cancer and the like is remarkably prolonged and the life quality is improved since sorafenib and sunitinib are marketed, and most of the medicines have the characteristics of low toxicity, convenience in use, long-term use and the like, so that the clinical application prospect is wide. However, some patients develop primary or secondary resistance to such drugs, resulting in treatment failure. For example, the median disease progression-free survival (PFS) of a patient with advanced renal cancer who receives sunitinib treatment at the first line is only 8-10 months; the median PFS of sorafenib for treating late-stage renal cancer is only 5.8 months, the drug resistance mechanism is clarified, and the discovery of drug resistance related prediction molecules has important significance for improving the tumor curative effect.

In addition, the price of the medicine is expensive, and the accurate medication can greatly reduce the economic burden of the family of the patient. However, no effective biomarker is available at present to screen out a subgroup of people who may be effective on targeted drugs such as sorafenib and sunitinib. At the same time, there are no effective hematologic markers to monitor when such drugs develop resistance in order to take timely other therapeutic measures to inhibit tumor progression.

The mismatch repair protein 1 (MLH 1) is 1 main gene of a DNA mismatch repair system, and researches show that MLH1 is closely related to the occurrence of tumors, and the reduction or deletion of the expression of MLH1 can cause the reduction of the mismatch repair function, so that the spontaneous mutation rate is increased, the instability of a genome is increased, and the abnormal proliferation of cells and the cancer are caused. However, reports related to the expression of MLH1 and the treatment of liver cancer and kidney cancer by tumor targeting drugs sorafenib or sunitinib are not found at present.

Disclosure of Invention

The inventor conducts detailed research on the detection of the drug sensitivity of the tumor multi-target small molecule inhibitor, and finds that MLH1 can be used as a molecular marker of the tumor multi-target small molecule inhibitor. Wherein, the expression level of MLH1 is related to the drug sensitivity of tumor targeting drugs sorafenib and sunitinib to the treatment of liver cancer and kidney cancer. Therefore, the effect of the drug therapy of a patient to be examined for a tumor can be predicted by detecting the expression level of MLH 1.

Accordingly, the invention provides a tumor targeted drug sensitivity detection kit and application of a reagent for detecting the expression level of MLH1 in preparation of the tumor targeted drug sensitivity detection kit, and provides a drug for regulating tumor targeted drug sensitivity on the basis.

The invention provides a tumor targeted drug sensitivity detection kit, which comprises an optional reagent for detecting the expression level of MLH 1.

Wherein the tumor targeting agent is sorafenib and/or sunitinib;

and/or the tumor is liver cancer and kidney cancer.

Wherein the reagent for detecting the expression level of MLH1 comprises a reagent for detecting the expression level of MLH1 protein and/or a PCR primer for specifically amplifying MLH1 gene mRNA.

The invention also provides application of the reagent for detecting the MLH1 expression level in preparing a tumor targeted drug sensitivity detection kit.

Wherein the tumor targeting agent is sorafenib and/or sunitinib;

and/or the tumor is liver cancer and kidney cancer.

The invention also provides application of the reagent for improving the expression level of MicroRNA-31-5p in preparing a medicament for enhancing tumor targeted medicament sensitivity.

Wherein the drug is a drug for reversing the drug resistance of the tumor targeting drug.

Wherein the tumor targeting drug is sorafenib and/or sunitinib.

The invention also provides a medicine for enhancing tumor targeted drug sensitivity, which is characterized by comprising the following components in part by weight: it can increase the protein expression level of MLH1 and/or increase the content of mRNA transcribed from the gene encoding MLH 1;

wherein the tumor targeting agent is sorafenib and/or sunitinib; the tumor is liver cancer and kidney cancer.

The kit can judge the sensitivity of different tumor patients to the tumor targeting drugs by detecting the expression level of MLH1, and further judge whether the kit is suitable for treating specific tumor targeting drugs: if the expression level of MLH1 is low, the patient is resistant to tumor targeting drugs sorafenib and sunitinib, and if the expression level of MLH1 is high, the tumor targeting drugs sorafenib and sunitinib are high in sensitivity, so that the method can be used for predicting the drug treatment effect of clinical tumor patients, provides basis for the patients to take relevant treatment measures or decisions, and has good clinical application prospect.

Obviously, many modifications, substitutions, and variations are possible in light of the above teachings of the invention, without departing from the basic technical spirit of the invention, as defined by the following claims.

The present invention will be described in further detail with reference to the following examples. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.

Drawings

FIG. 1 shows that MLH1 is a target gene of MicroRNA-31-5p, which is a key drug resistance targeting molecule, and overexpression of the target gene can down-regulate the level of MLH1 mRNA, so as to down-regulate the protein expression of MLH1, and further cause the drug resistance of cells to targeting drugs.

(A) Searching a target gene for the MicroRNA-31-5p to play a role by using a MicroRNA database, and primarily determining the binding site of the MicroRNA-31-5p at the MLH-13' end of the target gene;

(B) the fluorescein experiment shows that the target gene of MicroRNA-31-5p is MLH-1;

(C) MicroRNA-31-5p mimics can reduce the mRNA level of MLH-1, and MicroRNA-31-5p inhibitors can up-regulate the mRNA level of MLH-1;

(D) western blot shows that MicroRNA-31-5p mimics can down-regulate the protein level of MLH-1;

(E) western blot shows that the MLH1 protein is reduced in the drug-resistant cell strain compared with the drug-sensitive cell strain corresponding to the drug-resistant cell strain;

(F) the clone formation experiment shows that the overexpression of MLH-1 can make drug-resistant cells sensitive to targeted drugs, and the expression shows that the clone formation is inhibited;

(G) scratch experiments show that the overexpression of MLH-1 can make drug-resistant cells sensitive to targeted drugs, and show that scratch repair is inhibited.

FIG. 2 RT-PCR shows the difference in MLH1 expression in drug-resistant and sensitive cell lines.

Detailed Description

The following examples are further illustrative, but the present invention is not limited to these examples.

The raw materials and equipment used in the embodiment of the present invention are known products and obtained by purchasing commercially available products.

Example 1 correlation of MLH1 expression with tumor-targeted drug sensitivity

1. Establishment of tumor targeted drug resistant cell strain

5 cell lines were selected: 786-0 parts of kidney cancer cell lines and ACHN; liver cancer cell line: HepG2, PLC/PRF/5; human umbilical vein endothelial cell lines: HUVEC, cultured in DMEM or 1640 medium, and IC50 of sorafenib and sunitinib drugs detected by MTT method.

And then inducing the generation of sorafenib or sunitinib drug-resistant liver cancer cell strains, kidney cancer cell strains and human umbilical vein endothelial cell strains by adopting a concentration gradient increasing continuous induction method (firstly treating the cells by using IC50 of each cell, gradually increasing the drug concentration by 10-20% after the cells die and removing floating dead cells after liquid exchange, and finishing the induction of the drug-resistant cells after 3-6 months).

Specific results are shown in tables 1 and 2 below:

table 1 IC50 of parent and established Sorafenib resistant cell line

Cell lines	786- 0	786-0- SorR	ACH N	ACHN- SorR	HepG	2	HepG2- SorR	PLC/ PRF/5	PLC/PRF/5- SorR	HUVE C	HUVEC- SorR
												Sorafenib IC50 (μM)	8.5	24.5	1.9 5	10.48	2.42	17.47	7.98	23.48	4.27	13.56

SorR: resistant to Sorafenib. Renal cancer cell line: 786-0, ACHN; liver cancer cell line: HepG2, PLC/PRF/5; human umbilical vein endothelial cell lines: HUVEC.

TABLE 2 parent and IC50 of the established Sunitinib drug-resistant cell line

Cell lines	786-0	786-0-SunR	ACHN	ACHN-SunR	HepG2	HepG2-SunR	HUVEC	HUVEC-SunR
									Sunitinib IC50(μM)	4.74	18.87	0.76	9.57	4.58	14.21	3.31	10.27

SunR: resistance to Sunitinib. Renal cancer cell line: 786-0, ACHN; liver cancer cell line: HepG 2; human umbilical vein endothelial cell lines: HUVEC.

2. Western blot detection of expression level of MLH-1 in target drug sensitive and resistant cell strain

RIPA buffer is used for extracting proteins of target drug resistant and sensitive cells, and Western blot is used for detecting the expression levels of MLH-1 proteins (antibodies: purchased from Abcam ab 92312) in drug resistant cell lines (786-0-SorR and ACHN-SorR) and corresponding drug sensitive cell strains.

As shown in FIG. 1E, the expression of MLH1 protein in the drug-resistant cell line was significantly reduced compared to the sorafenib and sunitinib sensitive cell lines.

In addition, through lentivirus overexpression of MLH-1, a clone formation experiment and a scratch experiment are carried out according to a conventional method, and the result shows that the overexpression of MLH-1 can enable the drug-resistant cells of the target drugs to be sensitive to the target drugs again, and the target drugs are shown to be reduced in clone formation capacity and reduced in scratch repair capacity (FIGS. 1-F and G), which can be related to the restoration of the sensitivity of the tumor cells.

3. Study on regulatory molecular mechanism of MLH-1

(1) First, a MicroRNA database (e.g., MiRanda, TargetScan, RNAhybrid, PicTar, etc.) is used to search for a target gene where MicroRNA-31-5p functions, and the binding site of MicroRNA-31-5p at the MLH-13' end of the target gene is primarily defined (FIG. 1-A).

(2) Secondly, luciferase reporter gene experiments show that the MicroRNA-31-5p analogue can reduce the luciferase activity of the target gene MLH-13 'UTR wild-type vector, and the MicroRNA-31-5p inhibitor can up-regulate the luciferase activity of the target gene MLH-13' UTR wild-type vector. In the case of MLH-13' UTR mutant vectors for the target gene, the MicroRNA-31-5p analogs or inhibitors did not significantly regulate the target gene (FIG. 1-B).

(3) Then, the cells were treated with MicroRNA-31-5p analogs or inhibitors (selected from those commonly used in the art, so long as their expression can be regulated)), and RT-PCR was performed to detect the change in the MLH-1 mRNA level of the target gene.

MLH-1 detection primer:

Forward primer：TATTCATAGGCAAGATGCTGGC；

Reverse primer：TATGGTTGTTCTCGTCTCCTTCTC。

the results are shown in FIG. 1-C, and the results of RT-PCR show that MicroRNA-31-5p analogs can down-regulate MLH1 mRNA levels, and inhibitors thereof can up-regulate MLH1 mRNA levels.

(4) Western blot was used to detect changes in MLH-1 protein levels of the target gene (MLH 1 antibody purchased from Abcam ab 92312) by treating cells with MicroRNA-31-5p analogs or inhibitors.

The results are shown in FIG. 1-D, and it can be seen that the MicroRNA-31-5p analog can down-regulate the MLH1 protein level.

The target gene of MicroRNA-31-5p is MLH1, and the overexpression of MicroRNA-31-5p can down-regulate the level of MLH1 mRNA, thereby down-regulating the protein expression of MLH1 and further leading the cell to be resistant to Sorafenib (figure 2).

Example 3 clinical examination of the expression level of MLH1 in patients with sensitive and resistant tumors

Tumor pathological specimens of clinically-resistant and sensitive sorafenib or sunitinib patients with renal clear cell carcinoma (28 sorafenib-sensitive patients, 33-year-median-age patients, 30 sorafenib-resistant patients, 38-year-median-age patients, 35-year-sensitive and 37-year-median-age patients, 29-year-median-age patients and 42-year-median-age patients) were collected, and the mRNA level of MLH1 in the tissue pathological specimens of the sorafenib or sunitinib-resistant and drug-sensitive patients with tumor was detected by RT-PCR.

The MLH-1 detection primers used were as follows:

Forward primer：TATTCATAGGCAAGATGCTGGC；

Reverse primer：TATGGTTGTTCTCGTCTCCTTCTC。

the results are shown in figure 2, wherein the expression level of the tumor pathology specimen MLH1 of the Sorafenib sensitive patient is 21.2 +/-3.4, and the expression level of the tumor pathology specimen MLH1 of the Sorafenib resistant patient is 4.34 +/-2.8;

the expression level of the tumor pathological specimen MLH1 of the Sunitiib sensitive patient is 34.7 +/-4.1, and the expression level of the tumor pathological specimen MLH1 of the Sunitiib drug-resistant patient is 3.2 +/-0.9.

As can be seen, compared with the sorafenib and sunitinib sensitive groups (before drug resistance), the MLH1 expression level of the patients in the drug resistant group is obviously reduced, and the difference has statistical significance. The treatment sensitivity of the two tumor targeting drugs is related to the expression level of MLH1, and the high expression of MLH1 can obviously improve the sensitivity of tumor patients to the targeting drugs. Thus, detection of the expression level of MLH1 can predict whether a patient will respond to two tumor-targeted drugs, thereby guiding the patient's clinical drug selection.

In conclusion, the kit can judge the sensitivity of different tumor patients to the tumor targeting drugs by detecting the expression level of MLH1, and further judge whether the kit is applicable to the treatment of specific tumor targeting drugs: if the expression level of MLH1 is low, the patient is resistant to tumor targeting drugs sorafenib and sunitinib, and if the expression level of MLH1 is high, the tumor targeting drugs sorafenib and sunitinib are high in sensitivity, so that the method can be used for predicting the drug treatment effect of clinical tumor patients, provides basis for the patients to take relevant treatment measures or decisions, and has good clinical application prospect.

Claims

1. The application of the reagent for improving the expression level of MLH1 in preparing the medicine for enhancing the sensitivity of cancer to the tumor-targeted medicine is characterized in that the cancer is the kidney cancer resistant to the tumor-targeted medicine, and the tumor-targeted medicine is sorafenib.