CN107988424B - Molecular marker, interval, primer and application related to methionine content of soybean seeds - Google Patents
Molecular marker, interval, primer and application related to methionine content of soybean seeds Download PDFInfo
- Publication number
- CN107988424B CN107988424B CN201810084417.9A CN201810084417A CN107988424B CN 107988424 B CN107988424 B CN 107988424B CN 201810084417 A CN201810084417 A CN 201810084417A CN 107988424 B CN107988424 B CN 107988424B
- Authority
- CN
- China
- Prior art keywords
- soybean
- methionine content
- molecular marker
- marker
- methionine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of soybean molecular biology, and particularly relates to a molecular marker, a region, a primer and application related to the methionine content of soybean seeds. The molecular marker is located at 38617472 th position of soybean chromosome 2, and the nucleotide of the molecular marker is T or G; the nucleotide sequence containing the marker sequence is shown as SEQ ID NO. 1; the marker interval is the interval from position 38517472 to position 38717472 of chromosome 2 of soybean. The molecular marker belongs to a co-dominant marker, is reliable and convenient to use, provides great convenience for breeding the strain with high methionine content in the soybean, and can be applied to molecular marker auxiliary selection in the improvement of the methionine content of soybean seeds and the application in the fine positioning and map cloning of genes related to the methionine content of the seeds, thereby accelerating the improvement process of the methionine content character of the soybean seeds.
Description
Technical Field
The invention belongs to the technical field of soybean molecular biology, and particularly relates to a molecular marker, a region, a primer and application related to the methionine content of soybean seeds.
Background
Soybean protein is one of the important nutrient sources of human beings and livestock, has similar amino acid composition with milk protein, is relatively complete protein, and only lacks methionine necessary for human body. The quality of soy protein affects the market competitiveness of soy products, and methionine content is the primary limiting factor. The methionine content in soybean is generally only 12mg/g protein, which is far away from 26mg/g recommended by the world health organization and Chinese academy of nutrition and meets the requirement of human nutrition and health. In order to meet the increasing nutritional requirements of people, increasing the methionine component of cultivated soybeans has become one of the important targets for improving the quality of soybeans. The conventional breeding means for improving the methionine component of the soybean has a plurality of problems, such as high analysis cost, low breeding efficiency and the like. Therefore, molecular-assisted breeding of high-methionine soybean varieties is one of the important topics for soybean quality breeding. The development and perfection of molecular biology and modern biological breeding technology provide necessary technical support and guarantee for molecular breeding of high-methionine soybeans.
In more than ten years, with the development of sequencing technology, researchers have more comprehensive knowledge of soybean genome. Genome re-sequencing research on 17 wild soybeans and 14 cultivated soybeans shows that more than 630 ten thousand SNPs are found, and analysis shows that the soybeans have high Linkage Disequilibrium (LD) and are beneficial to correlation analysis of target traits. In 1996, the LD was first used to locate the bipolar disorder-associated gene. Association analysis is one type of LD application that detects whether genetic variation of some markers or candidate genes within a population that are in the LD state are significantly associated with a particular phenotype more frequently than is desired. At present, the correlation analysis is widely applied to plant research, such as soybean seed protein content, rice amino acid components, triticale aluminum toxicity resistance and the like. In recent years, the development of functional markers for target traits by correlation analysis has become one of the hot spots in molecular biology research. The SNP marker assisted selection can obviously improve the genetic improvement process of the methionine content of the seeds.
Until now, Quantitative Trait Locus (QTL) location research on genes related to methionine content in soybean seeds by linkage analysis has been carried out, and it has been found that QTL related to methionine content in more than 10 soybean seeds are mainly distributed in linkage groups such as F, G, M, C2 and I, and related action mechanisms and application research thereof have not been fully carried out. However, SNP (Single nucleotide polymorphism) molecular markers related to the methionine content traits of soybean seeds are not found, and difficulty is brought to genetic improvement of the methionine content traits of the soybean seeds and molecular marker-assisted selective breeding.
Disclosure of Invention
The molecular marker, the interval, the primer and the application are closely related to the methionine content of the soybean seeds, can more effectively reflect the methionine content of the soybean seeds, can be used for auxiliary selection breeding and genetic improvement of the soybean molecular marker, and obviously improve the selection efficiency of materials with larger methionine content.
The first purpose of the invention is to provide a molecular marker related to the methionine content of soybean seeds, wherein the molecular marker is positioned at 38617472 of the No.2 chromosome of soybean, and the nucleotide of the molecular marker is T or G.
The second purpose of the invention is to provide a marker sequence containing the molecular marker related to the methionine content of soybean seeds, and the nucleotide sequence of the marker sequence is shown as SEQ ID NO. 1.
The third purpose of the invention is to provide a marker interval containing the molecular marker related to the content of the soybean seed methionine, wherein the marker interval is the interval from 38517472 to 38717472 of the soybean chromosome 2.
The fourth purpose of the invention is to provide a primer for amplifying the marker sequence, wherein the primer is:
M02-1F: 5'-TAGTTAGGTGGCGACGGTGAGG-3', as shown in SEQ ID NO.2,
M02-1R: 5'-AGGTGTCCCTCCAACAAAGG-3', as shown in SEQ ID NO. 3.
The fifth purpose of the invention is to provide the application of the molecular marker in the quality breeding of the content of the methionine in the soybean.
The sixth purpose of the invention is to provide the application of the marker sequence in the quality breeding of the content of the methionine in the soybean.
The seventh purpose of the invention is to provide the application of the marker interval in soybean methionine content quality breeding.
The eighth purpose of the invention is to provide the application of the primer in quality breeding of the content of the methionine in the soybean.
Compared with the prior art, the molecular marker related to the methionine content of the soybean seeds and the application thereof provided by the invention have the following beneficial effects:
(1) the molecular marker related to the methionine content of the soybean seeds provided by the invention is an SNP marker, belongs to a codominant marker, is reliable and convenient to use, and provides great convenience for breeding strains with high methionine content of soybean. The molecular marker provided by the invention can be applied to molecular marker auxiliary selection in the improvement of the methionine content of the soybean seeds and the application in the fine positioning and map cloning of the gene related to the methionine content of the seeds, thereby accelerating the improvement process of the methionine content of the soybean seeds.
The principle of the development method of the loci related to the methionine content of soybean seed protein is that soybean has higher linkage disequilibrium, so that important character correlation mapping can be carried out. The main characteristics of soybeans over other leguminosae are high protein content, balanced amino acid composition and methionine content. The methionine content of the soybean is regulated and controlled by multiple genes, and a natural group with rich variation of the methionine content is used as a key botanical sample for marking and developing the invention. On the premise of having a soybean natural population generating a large number of obvious genetic variations, the marker development obviously related to the variation of the methionine content can be effectively developed.
(2) The interval of 38617472 +/-100 Kb of the soybean chromosome 2 is an ideal marker interval of the methionine content of soybean seeds, wherein the contribution rate of 38617472 SNP is 48.12%, and the additive effect is 3.16. The SNP marker of the site is used for selection in advanced breeding groups, materials with methionine content higher than 19.83mg/g protein can be screened, the accuracy is about 70%, the selection cost is greatly reduced, and the quality improvement efficiency is improved.
Drawings
FIG. 1 is a graph of the methionine content profile of 280 soybean related population seeds;
FIG. 2 is a group structure diagram of related groups obtained by an Admixure software analysis based on SNPs;
FIG. 3 is a Manhattan chart showing the results of MLM association analysis of methionine content in soybean seeds.
Detailed Description
The invention is described in detail below with reference to the figures and the specific embodiments, but the invention should not be construed as being limited thereto. The technical means used in the following examples are conventional means well known to those skilled in the art, and materials, reagents and the like used in the following examples can be commercially available unless otherwise specified.
In the following embodiment, 3000 soybean germplasm resources are widely collected in north of 40 degrees N in China, the content of methionine in soybean seeds is determined by using high performance liquid chromatography, each distribution group is sampled according to the distribution condition of methionine in the resources, then the genetic diversity of the sampling group and the total group is compared, and when the genetic diversity is consistent, the number of the sampling samples is determined, and 280 germplasm resources are counted as a related group. The soybean germplasm resources are collected and evaluated by a soybean germplasm resource research team group cultivated by a soybean research institute of agricultural academy of sciences of Jilin province, and are stored in a germplasm resource library of agricultural academy of sciences of Jilin province. The 280 soybean germplasm resource sources cover most of the major producing areas of high-latitude soybeans in China, including Heilongjiang province, Jilin province, Liaoning province, inner Mongolia, Xinjiang and the like.
The molecular marker related to the methionine content of the soybean seeds is an SNP marker extremely remarkably related to the methionine content of the soybean, is positioned at 38617472 site of No.2 chromosome of the soybean (reference genome is Wm82.a2.v1), has a nucleotide genotype of T or G, belongs to a codominant marker, is reliable and convenient to use, and provides great convenience for breeding strains with high methionine content of the soybean; the nucleotide sequence of the marker sequence containing the molecular marker is shown as SEQ ID NO.1 and comprises:
TAGTTAGGTGGCGACGGTGACAAAGATTTATAGAATATAGGAAAGACTAGGTTTAGAATTAGGAA[T/G]ATTAAGAATTAATTGGATTAAAGAACTTTTTTAAAAACATTAAATAAAATTAAAATTAAAAAATATCAAATTTATAAAAAGATTCTTTGATTTTAATTATAAAAAATGAAAAAATTAAACTTAATCATGTGACGTTATAAGTCACGTTACACCGAAGCAACGGTTTTTCCTTAAAAGTAATAATAATATGTATTACTCCCTTTAGACTCATATATATATATAAATATTTTATATTTTGAATTTAAATATAAACAAATTTAACTAATTTTCTTTTCTTTATTTAATGATATCGTTCTTAAAACACCTTTTATTTAATTGAAAATTTATATTTAAGAACTTTATTTTATTTATAATATAAAGTTTCAATGAAGAACGATTTAAGAATGATTTTATTTTTTATTTGAGATTAATAAAATTAAATGATTTTAATTAATTTTCTTAATAAGTATAAAGTAGTTATTTTTGTTTATGAGTGCAGATAGAGTATTCATCATGTGTAAAGATAGATAATAGTACTTGGGATGGGAGCTAGCCAATTAATTGCAGAATTAACCATGCCCTTTGTTGGAGGGACACCT
contains the marker interval 38517472-38717472 (namely 38617472 +/-100 Kb) of the molecular marker related to the content of the methionine in the soybean seeds.
The molecular marker is obtained by the following method:
determination of methionine content in soybean related group
3000 soybean germplasm resources are widely collected in 40 degrees N in China in the north, 3000 resources are planted in fields, after the seeds are completely mature, the seeds are harvested, seed protein is extracted, amino acid is prepared through hydrolysis, the methionine content of the seeds is measured through high performance liquid chromatography, each distribution group is sampled according to the distribution condition of methionine in the resources, then the genetic diversity of the sampling group and the total group is compared, when the genetic diversity is consistent, the number of the sampling samples is determined, and 280 seeds in total are used as related groups.
The operation steps are as follows:
(1)10g of soybean seeds were baked in an oven at 80 ℃ for 12 hours to a constant weight.
(2) Pulverizing the seeds, sieving with 60 mesh sieve, weighing 0.3g bean powder, placing into 50ml centrifuge tube, adding protein extract, and placing on shaker at 200rpm for 16 hr.
(3) Standing for 2 min, collecting 1mL supernatant, heating hydrolase, and water-bathing at 37 deg.C for 1h to obtain amino acid.
(4) The methionine content was measured by Agilent1200 liquid chromatograph according to GB 5009.124-2016 method.
(5) The methionine content of the group is divided into 10 groups according to the average value (X) and the standard deviation (delta) of the methionine content of the group, wherein 1 group is less than X-2 delta, 10 groups are more than or equal to X +2 delta, and the difference of each group in the middle is 0.5 delta. Genetic diversity of each trait was evaluated using Shannon's informative index (H'), where H ═ Σ PilnPi, Pi indicates the frequency of occurrence of the ith variation, and the genetic diversity calculated by calculating the methionine content of 3000 resources was 2.11.
(6) 28 parts of resources are randomly extracted from each group, the genetic diversity index H 'of 280 parts of resources is calculated, when the genetic diversity index H' is equal to 2.11, the 280 parts of resources are determined to be related groups, the methionine content of the 280 parts of groups is in normal distribution and belongs to quantitative traits, the genetic diversity index is 2.11, as shown in figure 1, figure 1 is a distribution diagram of the methionine content of seeds of the 280 related groups of soybeans, the ordinate in figure 1 represents the number of samples, and the abscissa represents the methionine content of the soybean seeds.
Second, soybean seed methionine content whole genome correlation analysis
And (2) carrying out whole genome Sequencing on 280 germplasms by utilizing an SLAF-seq (Specific-local Amplified Fragment Sequencing) technology, comparing Sequencing reads to a reference genome by utilizing BWA, developing SNP by utilizing two methods of GATK and Samtools, and taking the SNP marker intersection obtained by the two methods as a final reliable SNP marker data set. The method comprises the following specific steps:
1. extracting the DNA of the 280 seed individual leaf leaves by using a CTAB method, detecting the DNA concentration to be 100 ng/mu L by using Thermo nanodrop 2000, and detecting the purity and integrity of the DNA by using 1% agarose electrophoresis, wherein the DNA is required to be not degraded, and the DNA is not polluted by protein, polysaccharide and the like.
2. The method comprises the following steps of performing genome sequencing on 280 parts of single seed leaf DNA by utilizing an SLAF-seq technology independently developed by Beijing Baimaike Biotechnology Limited, wherein the genome sequencing method comprises the following specific steps:
(1) genome enzyme digestion: enzyme digestion prediction is carried out on the published soybean reference genome by using enzyme digestion prediction software, endonuclease RsaI and HaeIII are selected to carry out enzyme digestion on each sample genome qualified for detection, and then an SLAF fragment with the genome fragment range of 364-414 bp is selected.
(2) Gene sequencing: the obtained SLAF Fragment is treated by Klenow Fragment (3 ' → 5 ' exo-) (NEB) and dATP at the 3 ' end under the temperature of 37 ℃ and is connected with a Dual-index sequencing adaptor, then PCR amplification and purification of PCR amplification products, sample mixing and gel cutting are carried out to recover the target Fragment, the recovered target Fragment is subjected to cDNA library quality inspection, and the cDNA library quality inspection is qualified and then sequenced by Illumina HiSeqTM 2500. 713.59M reads were obtained with an average Q30 of 95.80% and an average GC content of 43.21%. To evaluate the accuracy of the library construction experiment, rice (Oryza sativa) was selected as a Control (Control) for the same treatment to participate in library construction and sequencing.
Wherein, the primers used for PCR amplification are F: 5'-AATGATACGGCGACCACCGA-3' (SEQ ID NO.4) and R: 5'-CAAGCAGAAGACGGCATACG-3' (SEQ ID NO. 5).
Wherein, the PCR amplification product is purified by utilizing Agencour AMPure XP beads (Beckman Coulter, High Wycombe, UK).
(3) SNP tagging and genotyping: according to the positioning result of sequencing Reads on a reference genome, performing Local alignment (Local alignment) and mutation detection by using GATK software, performing mutation detection by using samtools software, obtaining intersection mutation sites obtained by the GATK software and the samtools software, and the like, so as to ensure the accuracy of detected SNPs (single nucleotide polymorphisms), and finally screening 1819858 available SNP labels. Obtaining the SNP data set.
3. The phylogenetic tree is used to express the evolutionary relationship between species, and according to the distance of the relationship between various organisms, various organisms are arranged on a branched tree-shaped chart to express the evolutionary process and the relationship simply. Based on the 1819858 SNPs, a population evolutionary tree of the sample is constructed through MEGA5 software and neighbor-join algorithm.
4. Obtaining genetic structure data: the group genetic structure analysis can provide the ancestral source and the composition information of individuals, and is an important genetic relationship analysis tool. The population structure of the samples was analyzed by the admixture software based on 1819858 SNPs, and clustering was performed assuming that the number of clusters (K value) of the samples was 1 to 20, respectively, and the clustering results are shown in FIG. 2. FIG. 2 is a group structure diagram of an associated group obtained by the analysis of the admixture software based on SNP, clustering is performed assuming that the group number (K value) of samples is 1-20, the clustering results are cross-verified, and the optimal group number is determined to be 12 according to the valley value of the cross-verification error rate.
5. Principal Component Analysis (PCA) analysis was performed by eigenfeft software based on 1819858 SNPs to obtain the Principal component clustering condition of the sample. Through PCA analysis, which samples are relatively close to each other and which samples are relatively distant from each other can be known, so that the evolution analysis can be assisted.
6. Obtaining Kinship matrix data of the genetic relationship: the SPAGeDi software can be used for estimating the genetic relationship (relative Kinship) between every two natural groups to obtain genetic relationship Kinship matrix data. The genetic relationship itself is a relative value defining the genetic similarity between two specific materials and the genetic similarity between arbitrary materials, and thus is directly defined as 0 when the result shows that the value of the genetic relationship between two materials is less than 0.
7. Based on related group SNP marker data, genetic structure data, genetic relationship Kinship matrix data and methionine content data, Genome wide association analysis (GWAS) is carried out by using a Mixed Linear Model (MLM) of the TASSEL5.0 software. X is genotype, Y is phenotype, and finally each SNP locus can obtain an association result, FIG. 3 is a Manhattan graph of MLM association analysis results of methionine content of soybean seeds, the ordinate is the negative logarithm of p-value, the abscissa is chromosome, and one point represents one SNP locus; the red dotted line (the lower dotted line in fig. 3) is the negative logarithm of 0.1/SNP number, the blue dotted line (the upper dotted line in fig. 3) is the negative logarithm of 0.01/SNP number, a point above the blue line, indicating that the corresponding SNP marker is significantly associated with methionine content, with the highest green point on chromosome 2 blue line corresponding to SNP position 38617472. With LOD ≥ 8 as the screening standard, SNP marker (T/G) significantly correlated with methionine content was obtained at position 38617472 of chromosome 2, and detailed information of the SNP marker is shown in Table 1.
TABLE 1 SNP marker information significantly associated with methionine content of soybean seeds
Application of molecular marker with obvious association of methionine content in seeds
The nucleotide sequence of the molecular marker closely linked with the methionine content of the soybean seeds is shown as SEQ ID NO.1 and named as M02-1, wherein the locus genotype with polymorphism is T/G (the 116 th site of the SEQ ID NO.1 sequence of the sequence table is represented by [ T/G ]), the genotype is located at the 38617472 th site of the No.2 soybean chromosome, and the genotype is a fragment obtained by performing PCR amplification by taking the genomic DNA of a material to be identified as a template and M02-1 primer.
Wherein, the amplification primers are as follows:
M02-1F:5’-TAGTTAGGTGGCGACGGTGAGG-3’(SEQ ID NO.2)
M02-1R:5’-AGGTGTCCCTCCAACAAAGG-3’(SEQ ID NO.3)
the specific steps for judging the content of the soybean methionine by using the molecular marker in an auxiliary way are as follows:
1. extraction of genomic DNA of material to be identified by CTAB method
1) Adding liquid nitrogen into fresh soybean leaves, grinding into powder, and placing a proper amount of the powder into a 1.5mL centrifuge tube.
2) Adding 0.6mL of preheated CTAB extract, mixing several times by inversion, water-bathing at 65 deg.C for one hour, mixing once every 15min, and centrifuging at 12000rpm for 15 min.
3) Add 0.6mL 24:1(V/V) chloroform: and (3) inverting the isoamyl alcohol solution, mixing uniformly for 5-10 times, and centrifuging at 10000rpm for 15 min.
4) The supernatant solution was transferred to another empty centrifuge tube and the tube was washed with 24:1(V/V) chloroform: the isoamyl alcohol solution was re-extracted once, and then 50. mu.L of RNase (10mg/mL) was added and left at room temperature for 30 min.
5) Adding equal volume of-20 deg.C pre-cooled isopropanol, centrifuging at-20 deg.C for 30min in a refrigerator at 5000rpm for 10min, and removing supernatant.
6) Washed twice with 70% ethanol. And (3) drying, dissolving with sterilized water to obtain genome template DNA, and storing the genome template DNA in a refrigerator at 4 ℃ for later use.
7) The DNA concentration was checked with 0.8% agarose and diluted to the working concentration for PCR amplification.
2. PCR amplification was performed using primers M02-1F/M02-1FR to obtain M02-1 amplification product.
1) PCR amplification System: the total volume was 20. mu.L, including 2. mu.L of 10ng genomic template DNA, 10. mu.L of 2 XSeTaq MasterMix, 2. mu.L of 10mM primers each, and ddH2O 4μL。
2) PCR amplification conditions: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 45s, and extension at 72 ℃ for 45 s; circulating for 35 times; final extension at 72 ℃ for 10 min.
3. Judging the salt tolerance according to the sequence comparison result
Sequencing analysis is carried out on the M02-1 amplification product, and the mean value of the methionine content of the strain subgroup with G at the 116 th site of the 5' end of the amplification product is obviously higher than the mean value of the strain subgroup with T at the site. The methionine content of G at position 116 of 68.81% of 280 samples was higher than 19.83mg/G protein, indicating that the molecular marker (SNP marker) was effective for auxiliary selection.
While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.
It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.
Sequence listing
<120> molecular marker, interval, primer and application related to content of methionine in soybean seeds
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 644
<212> DNA
<213> Soybean
<400> 1
tagttaggtg gcgacggtga caaagattta tagaatatag gaaagactag gtttagaatt 60
aggaa[t/g]atta agaattaatt ggattaaaga acttttttaa aaacattaaa taaaattaaa 120
attaaaaaat atcaaattta taaaaagatt ctttgatttt aattataaaa aatgaaaaaa 180
ttaaacttaa tcatgtgacg ttataagtca cgttacaccg aagcaacggt ttttccttaa 240
aagtaataat aatatgtatt actcccttta gactcatata tatatataaa tattttatat 300
tttgaattta aatataaaca aatttaacta attttctttt ctttatttaa tgatatcgtt 360
cttaaaacac cttttattta attgaaaatt tatatttaag aactttattt tatttataat 420
ataaagtttc aatgaagaac gatttaagaa tgattttatt ttttatttga gattaataaa 480
attaaatgat tttaattaat tttcttaata agtataaagt agttattttt gtttatgagt 540
gcagatagag tattcatcat gtgtaaagat agataatagt acttgggatg ggagctagcc 600
aattaattgc agaattaacc atgccctttg ttggagggac acct 644
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence
<400> 3
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence
<400> 4
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence
<400> 5
Claims (6)
1. A molecular marker related to the methionine content of soybean seeds, wherein the molecular marker is positioned at 38617472 th chromosome 2 of soybean Wm82.a2.v1 genome, and the nucleotide of the molecular marker is T or G.
2. The molecular marker related to the methionine content in soybean seeds as claimed in claim 1, wherein the nucleotide sequence of the molecular marker is as shown in SEQ ID number 1.
3. A primer for amplifying the molecular marker of claim 2, wherein the primer is:
M02-1F:5’- TAGTTAGGTGGCGACGGTGAGG-3’,
M02-1R:5’- AGGTGTCCCTCCAACAAAGG -3’。
4. the use of the molecular marker of claim 1 in soybean methionine content quality breeding.
5. The use of the molecular marker of claim 2 in soybean methionine content quality breeding.
6. The use of the primer according to claim 3 in quality breeding of soybean methionine content.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810084417.9A CN107988424B (en) | 2018-01-29 | 2018-01-29 | Molecular marker, interval, primer and application related to methionine content of soybean seeds |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810084417.9A CN107988424B (en) | 2018-01-29 | 2018-01-29 | Molecular marker, interval, primer and application related to methionine content of soybean seeds |
Publications (2)
Publication Number | Publication Date |
---|---|
CN107988424A CN107988424A (en) | 2018-05-04 |
CN107988424B true CN107988424B (en) | 2021-03-09 |
Family
ID=62041217
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201810084417.9A Expired - Fee Related CN107988424B (en) | 2018-01-29 | 2018-01-29 | Molecular marker, interval, primer and application related to methionine content of soybean seeds |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107988424B (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112430679B (en) * | 2019-08-26 | 2022-08-19 | 河北省农林科学院粮油作物研究所 | SNP (Single nucleotide polymorphism) marker related to amino acid content of soybean seeds and application thereof |
CN112877467B (en) * | 2021-04-21 | 2023-06-06 | 江苏省农业科学院 | Single nucleotide mutation site SNP (Single nucleotide polymorphism) and KASP (KASP) markers remarkably related to soybean protein content and application thereof |
CN113234120A (en) * | 2021-05-28 | 2021-08-10 | 吉林省农业科学院 | Method for efficiently extracting low-abundance protein from soybean seeds |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AR080021A1 (en) * | 2010-01-26 | 2012-03-07 | Pioneer Hi Bred Int | TOLERANCE TO HPPD INHIBITING HERBICIDES (HYDROPHENYL PIRUVATO DIOXYGENASE) |
CN106755561B (en) * | 2017-03-30 | 2020-09-04 | 吉林省农业科学院 | QTL (quantitative trait locus), SNP (single nucleotide polymorphism) molecular marker related to soybean root dry weight and application |
-
2018
- 2018-01-29 CN CN201810084417.9A patent/CN107988424B/en not_active Expired - Fee Related
Also Published As
Publication number | Publication date |
---|---|
CN107988424A (en) | 2018-05-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107988421B (en) | Molecular marker, interval, primer and application related to oil content of soybean seeds | |
CN108060260B (en) | SNP (Single nucleotide polymorphism) marker related to methionine content of soybean seeds, interval, primer and application | |
CN107988422B (en) | SNP (Single nucleotide polymorphism) marker related to oil content of soybean seeds, interval, primer and application | |
CN107988424B (en) | Molecular marker, interval, primer and application related to methionine content of soybean seeds | |
CN111910008A (en) | Molecular marker related to chicken growth and development and application thereof | |
CN110894542A (en) | Primer for identifying types of GS5 gene and GLW7 gene of rice and application of primer | |
CN116926234B (en) | SNP molecular marker related to soybean kernel oil content and application thereof | |
CN106498048B (en) | One kind QTL relevant to soybean nodulation number, SNP marker and application | |
CN113046467B (en) | SNP locus obviously associated with wheat stripe rust resistance and application thereof in genetic breeding | |
CN113684300A (en) | SNP loci obviously associated with wheat ear number and application thereof in wheat genetic breeding | |
CN117737279A (en) | Cadmium low-accumulation hybrid rice molecular marker, rice mutant OsNramp5 gene, and identification method, application and primer thereof | |
CN110527739B (en) | Major QTL (quantitative trait locus) site of glucosinolate content of brassica napus seeds, SNP (Single nucleotide polymorphism) molecular marker and application thereof | |
CN114107545B (en) | CAPS molecular marker of wax gourd fruit and flour wax powder gene and application thereof | |
CN116479164B (en) | SNP locus, molecular marker, amplification primer and application of SNP locus and molecular marker related to soybean hundred-grain weight and size | |
CN117265176B (en) | SNP locus related to soybean kernel oil content, molecular marker and application | |
CN117965778A (en) | InDel locus related to soybean seed oil content, molecular marker, primer and application thereof | |
CN116287421A (en) | SNP locus related to soybean hundred-grain weight, molecular marker, amplification primer and application thereof | |
CN113046465B (en) | SNP locus obviously associated with cold resistance of wheat and application of SNP locus in genetic breeding | |
CN116162714B (en) | Haplotype molecular marker related to intramuscular fat traits of pigs in SYK gene and application | |
CN117230240A (en) | InDel locus related to soybean seed oil content, molecular marker, primer and application thereof | |
CN117051127B (en) | SNP locus related to yak growth traits and application thereof | |
CN114736979B (en) | Molecular marker closely linked with watermelon complete leaf shape gene ClLL and application thereof | |
Zhang et al. | Population Structure of 93 Varieties of Rice (Oryza Sativa L. subsp. Hsien Ting) in Qinba, China | |
CN117248061A (en) | InDel locus related to soybean seed oil content, molecular marker, primer and application thereof | |
CN109161601B (en) | Method for auxiliary rapid detection of cattle growth traits by using SNP marker of PLAGL1 gene and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20210309 Termination date: 20220129 |
|
CF01 | Termination of patent right due to non-payment of annual fee |