CN107988252B - Application of bHLH73 protein in regulation of plant height - Google Patents

Application of bHLH73 protein in regulation of plant height Download PDF

Info

Publication number
CN107988252B
CN107988252B CN201810059520.8A CN201810059520A CN107988252B CN 107988252 B CN107988252 B CN 107988252B CN 201810059520 A CN201810059520 A CN 201810059520A CN 107988252 B CN107988252 B CN 107988252B
Authority
CN
China
Prior art keywords
bhlh73
plant
sequence
gene
rice
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201810059520.8A
Other languages
Chinese (zh)
Other versions
CN107988252A (en
Inventor
周奕华
张保才
王少干
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Genetics and Developmental Biology of CAS
Original Assignee
Institute of Genetics and Developmental Biology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Genetics and Developmental Biology of CAS filed Critical Institute of Genetics and Developmental Biology of CAS
Priority to CN201810059520.8A priority Critical patent/CN107988252B/en
Publication of CN107988252A publication Critical patent/CN107988252A/en
Application granted granted Critical
Publication of CN107988252B publication Critical patent/CN107988252B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Botany (AREA)
  • Virology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses a method for cultivating a plant with reduced plant height, which comprises the following steps: inhibiting the expression of bHLH73 gene in the original plant, thereby reducing the plant height of the plant; the bHLH73 gene is a nucleic acid encoding a bHLH73 protein; the bHLH73 protein is a protein shown in a sequence 1 in a sequence table. According to the invention, the plant height of the adult rice plant is obviously reduced after the partial section of the bHLH73 gene is knocked out by the CRISPR/Cas9 technology, so that the method can be used for increasing the lodging resistance of the rice, cultivating the dwarf rice variety, playing an important role in rice breeding, contributing to improving the yield and quality of the rice and having important economic value.

Description

Application of bHLH73 protein in regulation of plant height
Technical Field
The invention belongs to the technical field of biology, and relates to application of bHLH73 protein in regulation and control of plant height.
Background
The plant height is one of the important agronomic traits of rice. The proper reduction of the plant height of the rice is beneficial to density resistance, fertilizer resistance, enhancement of lodging resistance and improvement of harvest index. In the 60 s of the 20 th century, the plant height of rice is greatly reduced by breeding experts through the application of semi-short-stalk and short-stalk genes, and the first green revolution, namely rice dwarf breeding, is started. The successful application of a large number of rice dwarf varieties in agricultural production obviously improves the yield of rice and ensures the grain safety.
The stalk is an important organ of the rice, connects the root and the ear, not only communicates the overground part with the underground part, and the leaves with the ear, but also supports the vertical growth of the rice plant, and plays an important role in the formation of the plant height of the rice. The generation of the stalks originates from the apical meristem, and when the development of the apical meristem is shifted from the vegetative growth stage to the reproductive growth stage, the stalks initially develop and gradually elongate, and with the progress of development, the stalks continue to extend until they are mature. The intercalary meristem plays a unique role in the development of rice stalks. The fourth or fifth internode at the uppermost end of the rice stem in the mature period is originally consistent with the internode at the bottom end which is not extended in terms of cell structure, when the development of the apical meristem is converted to the reproductive growth stage, the intermediate meristem synchronously responds to the development conversion signal, so that cells in different internodes of the stem begin to generate differential differentiation and extend at different rates, and finally the morphogenesis of the rice stem is completed and the plant height character of the rice is determined.
A great deal of research has identified a plurality of genes for regulating the plant height character of rice by influencing the normal elongation and development of rice stalks, and relevant functional research is carried out on protein products coded by the genes. Although a large number of dwarf or semi-dwarf genes are registered at present, mutants of most genes often cause other problems of growth, development and production due to over-dwarfing, and have obvious limitation in the practical application of agricultural production. Therefore, further exploring and utilizing more dwarf or semi-dwarf gene resources with ideal agronomic characters has important theoretical and practical production significance for genetic improvement of rice plant height characters and cultivation of more rice dwarf varieties which can be widely applied to agricultural production.
Disclosure of Invention
The invention aims to provide application of bHLH73 protein in regulating plant height.
The invention provides a method for cultivating a plant with reduced plant height, which comprises the following steps: inhibiting the expression of bHLH73 gene in the original plant, thereby reducing the plant height of the plant;
the bHLH73 gene is a nucleic acid encoding a bHLH73 protein;
the bHLH73 protein is (a1) or (a2) or (a3) as follows:
(a1) protein shown in a sequence 1 in a sequence table;
(a2) a protein obtained by substituting and/or deleting and/or adding one or more amino acid residues in (a1) and having the same function;
(a3) a protein derived from rice, having a homology of 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more with (a1) and having the same function.
The bHLH73 gene is (b1) or (b2) or (b3) or (b4) as follows:
(b1) the coding region is a DNA molecule shown as a sequence 2 in a sequence table;
(b2) a DNA molecule shown in a sequence 3 of a sequence table;
(b3) a DNA molecule that hybridizes under stringent conditions to the DNA molecule defined in (b1) or (b2) and encodes the bHLH73 protein;
(b4) a DNA molecule which is derived from rice, has 99% or more, 95% or more, 90% or more, 85% or more or 80% or more homology with (b1) or (b2), and encodes the bHLH73 protein.
The stringent conditions may be hybridization with a solution of 6 XSSC, 0.5% SDS at 65 ℃ followed by washing the membrane once with each of 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.
"inhibiting the expression of the bHLH73 gene in the starting plant" is achieved by knocking out the full-length bHLH73 gene or knocking out a partial segment of the bHLH73 gene. The partial segment can be specifically shown as a sequence 8 in a sequence table.
The expression of bHLH73 gene in starting plants is inhibited by CRISPR/Cas9 technology. Two sgrnas, namely OsU3-sgRNA and OsU6a-sgRNA, are specifically adopted in the CRISPR/Cas9 technology; OsU3-sgRNA target sequence is shown as sequence 4 in the sequence table; OsU6 the target sequence of 6a-sgRNA is shown as sequence 5 in the sequence table. OsU3-sgRNA is shown as sequence 9 in the sequence table. OsU 6-6 a-sgRNA is shown as a sequence 10 in the sequence table.
"inhibiting the expression of the bHLH73 gene in the starting plant" is achieved by introducing an interference vector; the interference vector expresses CAS9mRNA, OsU3-sgRNA and OsU6 a-sgRNA; OsU3-sgRNA target sequence is shown as sequence 4 in the sequence table; OsU6 the target sequence of 6a-sgRNA is shown as sequence 5 in the sequence table. OsU3-sgRNA is shown as sequence 9 in the sequence table. OsU 6-6 a-sgRNA is shown as a sequence 10 in the sequence table. The interference vector can be specifically a recombinant plasmid obtained by inserting a double-stranded DNA molecule shown as a sequence 6 in a sequence table into a multiple cloning site (such as Mlu I enzyme cutting site) of a pYLCRISPR/Cas9Pubi-H plasmid.
The invention also protects the application of the bHLH73 gene as a silenced target in cultivating plants with reduced plant height.
The invention also protects a substance for inhibiting the expression of the bHLH73 gene, and the application of the substance in cultivating plants with reduced plant height. The substance inhibiting the expression of the bHLH73 gene may be a substance inhibiting the expression of the bHLH73 gene by CRISPR/Cas9 technology. Two sgrnas, namely OsU3-sgRNA and OsU6a-sgRNA, are specifically adopted in the CRISPR/Cas9 technology; OsU3-sgRNA target sequence is shown as sequence 4 in the sequence table; OsU6 the target sequence of 6a-sgRNA is shown as sequence 5 in the sequence table. OsU3-sgRNA is shown as sequence 9 in the sequence table. OsU 6-6 a-sgRNA is shown as a sequence 10 in the sequence table. The agent that inhibits the expression of the bHLH73 gene can be an interference vector. The interference vector expresses CAS9mRNA, OsU3-sgRNA and OsU6 a-sgRNA; OsU3-sgRNA target sequence is shown as sequence 4 in the sequence table; OsU6 the target sequence of 6a-sgRNA is shown as sequence 5 in the sequence table. OsU3-sgRNA is shown as sequence 9 in the sequence table. OsU 6-6 a-sgRNA is shown as a sequence 10 in the sequence table. The interference vector can be specifically a recombinant plasmid obtained by inserting a double-stranded DNA molecule shown as a sequence 6 in a sequence table into a multiple cloning site (such as Mlu I enzyme cutting site) of a pYLCRISPR/Cas9Pubi-H plasmid.
The invention also provides a method for cultivating the plant with reduced plant height, which comprises the following steps: reducing the content of the bHLH73 protein in the plant and/or inhibiting the activity of the bHLH73 protein in the plant, thereby reducing the plant height of the plant.
The invention also protects the application of the bHLH73 protein, which is (c1) or (c2) or (c 3):
(c1) regulating and controlling the plant height of the plant;
(c2) promoting the plant height of the plant;
(c3) and (3) cultivating the plant with reduced plant height as the inhibited target.
The invention also protects the application of a substance for reducing the content of the bHLH73 protein in plants and/or inhibiting the activity of the bHLH73 protein in plants in breeding plants with reduced plant height.
The reduction of plant height is beneficial to lodging resistance, so the invention can be used for cultivating lodging-resistant materials.
Any of the above plants may be a monocotyledonous plant or a dicotyledonous plant. Further, the monocotyledon may be a gramineous plant. More specifically, the gramineous plant is rice. More specifically, the rice is japonica rice, such as Nipponbare.
According to the invention, the plant height of the adult rice plant is obviously reduced after the partial section of the bHLH73 gene is knocked out by the CRISPR/Cas9 technology, so that the method can be used for increasing the lodging resistance of the rice, cultivating the dwarf rice variety, playing an important role in rice breeding, contributing to improving the yield and quality of the rice and having important economic value.
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.
A new protein is found from rice (Oryza sativa L.), and is named bHLH73 protein, and is shown as a sequence 1 in a sequence table. The gene encoding the bHLH73 protein is named as bHLH73 gene, the open reading frame in cDNA is shown as sequence 2 in a sequence table, and the gene sequence in a genome is shown as sequence 3 in the sequence table (in the sequence 3, the 1 st to 303 th nucleotides are 5'-UTR regions, and the 7085 th and 7704 th nucleotides are 3' -UTR regions).
pYLCRISPR/Cas9Pubi-H plasmid, described in "Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, QiuR, Wang B, YangZ, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, ZhaoX, Dong Z, Liu Y.A robust/CRISPR/Cas 9system for compatibility, high-efficiency plasmid DNA editing in monoclonal and dicot plants molecular Plant 2015,8: 1274-1284", is publicly available from the Applicant and can only be used in the heavy-copy invention experiments. The plasmid is also commercially available to the public.
Agrobacterium EHA 105: CAMIA corporation, australia.
Nipponbare (Nipponbare) is called rice Nipponbare and belongs to japonica rice varieties: china rice institute.
Example reduction of plant height by inhibition of bHLH73 Gene expression
Construction of CRISPR-Cas9 gene knockout vector
Target sequences were screened in the bHLH73 gene and two target sequences were determined by specific comparison: target sequence OsU3 and target sequence OsU6 a.
Target sequence OsU3 (seq id No. 4 of the sequence listing): 5'-GGAGAATTCCAGAGCTCCC-3' are provided.
Target sequence OsU6a (sequence 5 of sequence listing): 5'-CGGCCATGAGAGCAGCATGC-3' are provided.
Inserting the double-stranded DNA molecule shown as the sequence 6 in the sequence table into the Mlu I enzyme cutting site of the pYLCRISPR/Cas9Pubi-H plasmid to obtain the recombinant plasmid pYLCRISPR/Cas9Pubi-H-bHLH73。
In sequence 6 of the sequence listing: the 1-383 th nucleotide is a promoter, the 384-483 th nucleotide is a coding sequence of OsU3-sgRNA (OsU3-sgRNA is shown as a sequence 9 in a sequence table), the 535-981 th nucleotide is a promoter, and the 982-1082 th nucleotide is a coding sequence of OsU6a-sgRNA (OsU6a-sgRNA is shown as a sequence 10 in the sequence table).
Secondly, the bhlh73 mutant is created
1. The recombinant plasmid pYLCISPR/Cas9Pubi-H-bHLH73 is introduced into Agrobacterium EHA105 to obtain recombinant Agrobacterium.
2. And (3) adopting the recombinant agrobacterium obtained in the step (1) and taking the immature embryo callus of the Nippon nipponica as a transformation receptor to carry out genetic transformation to obtain a regeneration plant.
3. And (3) screening the rice bhlh73 mutant from the regenerated plant obtained in the step (2) by molecular identification.
(1) Taking leaves and extracting genome DNA.
(2) And (2) taking the genomic DNA obtained in the step (1) as a template, carrying out PCR amplification by using a primer pair consisting of bHLH73-CAS9-F and bHLH73-CAS9-R, carrying out electrophoresis on PCR amplification products, and then recovering and sequencing specific bands. Genomic DNA from Nipponbare was used as a control.
bHLH73-CAS9-F：5’-TTTAAGATTGACCTGAGATTT-3’；
bHLH73-CAS9-R：5’-ATAGTTTAATTTACATGGATGTG-3’。
Only one PCR amplification product of the Nipponbare genome DNA is 654bp, and is shown as 127 th-780 th nucleotide of a sequence 3 in a sequence table.
Only one PCR amplification product of the genome DNA of a regeneration plant is 374bp, and the plant is named as a bhlh73 mutant as shown in a sequence 7 of a sequence table. Through whole genome sequencing, compared with the whole genome of Nipponbare, the whole genome of the bhlh73 mutant is different only in that a DNA molecule shown in a sequence 8 in a sequence table is homozygously deleted. This deletion occurs in the bHLH73 gene and causes a frame shift, premature termination of translation, and failure to form the full-length bHLH73 protein.
Selfing the bhlh73 mutant to obtain a progeny which is a T1 generation plant, and selfing the T1 generation plant to obtain a progeny which is a T2 generation plant.
Third, creating a control of transformed empty vector
Substitution of pYLCRISPR/Cas9Pubi-H plasmid for recombinant plasmid pYLCRISPR/Cas9PubiAnd (4) H-bHLH73, operating according to the step two, and obtaining a transgenic empty vector plant.
Height phenotype of four, plant
Plants of Nipponbare (10 plants), T2 generation (10 plants) of the empty vector-transferred plant and T2 generation (10 plants) of the bhlh73 mutant were grown under parallel conditions and the phenotype was continuously observed. The time for the plants to develop to the adult plant stage has no obvious difference, the average adult plant height of Nipponbare is 98.77cm, the average adult plant height of T2 generation plants of the empty carrier transferring plants is 98.21cm, and the average adult plant height of T2 generation plants of the bhlh73 mutant is 75.26 cm. The results show that the bhlh73 mutant plant is dwarfed compared with the wild plant and the empty vector-transferred plant, and the dwarfing degree is proper and the over dwarfing does not occur.
And repeating the steps II, III and IV for multiple times to obtain multiple homozygous deletion mutants, wherein the plant heights of the T2 generation plants are not obviously different from those of the T2 generation plants of the bhlh73 mutant.
SEQUENCE LISTING
<110> institute of genetics and developmental biology of Chinese academy of sciences
Application of <120> bHLH73 protein in regulation and control of plant strain height
<130>GNCYX180259
<160>10
<170>PatentIn version 3.5
<210>1
<211>415
<212>PRT
<213>Oryza sativa L.
<400>1
Met Asn Arg Gly Glu Phe Gln Ser Ser Leu Val Gln Gln Met Ile Trp
1 5 10 15
Ser Gly Ser Ser Thr Gly Thr Ala Thr Gly Val Gly Ser Gly Gly Gly
20 25 30
Ala Gly Ser Leu Met Gly Ser Leu Lys Pro Cys His Glu Asp Gln Glu
35 40 45
Ala Ser Pro Asn Met Pro Ser Leu Ser Ser Pro Ser Leu Ile Phe Ser
50 55 60
Gln Gln Phe Gln His Ser Ser Pro Gly Leu Val Pro Met Asn Gly Thr
65 70 75 80
Ala Gly Ala Ala Ala Ser Leu Pro Ser Leu His Asp Gly Gly Gly Gly
85 90 95
Gly His Glu Ser Ser Met Pro Glu Ser Trp Ser Gln Leu Leu Leu Gly
100 105 110
Gly Leu Ala Gly Asp Gln Glu Arg Tyr SerAla Thr Ala Ala Leu Leu
115 120 125
Ser Lys Gly Leu Glu Asn Trp Gly Asp His Ala Ala Ala Ala Ala Ala
130 135 140
Ser Ala Cys Met Val Gly Gly Met Lys Glu Glu Gly Ser Met Ala Gln
145 150 155 160
Ala Ala Ala Thr Ala Ala Ala Ala Ala Tyr Ser Phe Tyr Gly Ser His
165 170 175
Leu Ala Gly Asp His Gln His Glu Ile Gln Ala Ala Ala Ala Gly Gly
180 185 190
Gly Ala Ser Asn Lys Ser Gln Leu Ser Gln Met Leu Met Ala Ser Ser
195 200 205
Pro Arg Ser Cys Ile Thr Thr Ser Leu Gly Ser Asn Met Leu Asp Phe
210 215 220
Ser Asn Thr Ala Ala Pro Pro Glu Leu Arg Ser His His His Asn Ser
225 230 235 240
Asp Asn Ser Ser Glu Cys Asn Ser Thr Ala Thr Gly Ser Ala Leu Lys
245 250 255
Lys Ala Arg Val Gln Ala Ser Ser Ser Ala Gln Ser Thr Leu Lys Val
260 265 270
Arg Lys Glu Arg Leu Gly Asp Arg Ile Thr Ala LeuHis Gln Ile Val
275 280 285
Ser Pro Phe Gly Lys Thr Asp Thr Ala Ser Val Leu Gln Glu Thr Ile
290 295 300
Gly Tyr Ile Arg Phe Leu Leu Ser Gln Ile Glu Ala Leu Ser Tyr Pro
305 310 315 320
Tyr Met Gly Asp Ala Asn Gly Thr Gly Pro Met Gln Asn Gly Pro Val
325 330 335
Gly Glu Arg Asn Pro Gly Leu Phe Pro Glu Tyr Pro Gly Gln Leu Leu
340 345 350
Asn His Asn Gly Asn Thr Gly Ala Gln Gln Pro Ala Ala Gln Pro Glu
355 360 365
Gln Gln Gly Ala Asn Asp Asp Gly Lys Lys Asp Leu Arg Ser Arg Gly
370 375 380
Leu Cys Leu Val Pro Val Ser Cys Thr Ser His Phe Gly Gly Asp Asn
385 390 395 400
Ala Ala Asp Tyr Trp Ala Pro Ala Pro Leu Gly Gly Ile Leu Arg
405 410 415
<210>2
<211>1248
<212>DNA
<213>Oryza sativa L.
<400>2
atgaatagag gagaattcca gagctccctg gtgcagcaga tgatctggag cggcagtagt 60
acaggcacgg ctaccggcgt cggcagcggc ggcggcgccg gcagtttgat gggcagcttg 120
aagccatgcc atgaggatca agaggcctct cctaacatgc cctccttgtc ttctccatcg 180
ttgatcttct cgcagcagtt tcagcacagc tctccaggtc tagttccgat gaacggcacc 240
gccggcgccg ccgcttctct tccgagcttg cacgacggcg gcggcggcgg ccatgagagc 300
agcatgccgg agtcatggag ccaactgctt cttgggggat tagctggaga tcaggagagg 360
tacagcgcca ctgcggctct cctgtcaaag ggattagaga attggggaga tcacgctgct 420
gcagctgcag ccagtgcatg catggttggt ggcatgaagg aggagggctc catggctcaa 480
gctgcagcca ctgctgctgc tgctgcttac agcttctatg ggagccacct tgctggtgat 540
catcagcatg agatccaagc agcagcagca ggaggaggtg ctagcaacaa gtctcagctg 600
agccagatgc tcatggcttc ctctcctagg tcatgcatca ccaccagcct cggcagcaac 660
atgctcgact tctccaacac cgcggcgccg ccggagctcc ggagccacca ccacaactcc 720
gataattcat cagagtgtaa cagcacagcg actggttcgg ccctcaagaa ggctagggtt 780
caggcctcct cttcagcaca atctactcta aaggtgagga aggagaggct aggggataga 840
ataactgcac ttcatcagat tgtatcccca tttggcaaga ctgacacagc gtctgtactg 900
caagagacca ttggctatat cagattcctc ctgagtcaaa ttgaggctct gagctaccct 960
tacatgggcg acgccaacgg gaccggtcct atgcaaaatg gaccagttgg agaaaggaac 1020
cctggcctct tcccggaata ccctggccag ttgctaaacc ataatggcaa cactggagca 1080
cagcagcctg cagcccaacc tgagcagcag ggagcaaacg acgatggaaa gaaggacctg 1140
aggagccggg ggctgtgcct cgttccagtg tcgtgcacgt cgcactttgg aggggacaat 1200
gccgctgact actgggcccc ggcgccgctc ggcgggatcc tacggtag 1248
<210>3
<211>7704
<212>DNA
<213>Oryza sativa L.
<400>3
aggccctatg ctttttcttc ttcttcttct tcttctccat ctctcctctc ctgtttcttt 60
cttctctcct tgttgttgca gctgtcctct ctctctcctc aaagagaaaa ttaagccact 120
ggccccttta agattgacct gagatttcca gtacacaagt tgtgtgcatg caaagagagg 180
ccaaagctaa gctagcaaaa cacacattcc tttcccacag ctagcttagc ttgaagcaag 240
caagaactca tcatctttgt ttctacatat cctttaatac tctcctctct gtcactagca 300
gtgatgaata gaggagaatt ccagagctcc ctggtgcagc agatgatctg gagcggcagt 360
agtacaggca cggctaccgg cgtcggcagc ggcggcggcg ccggcagttt gatgggcagc 420
ttgaagccat gccatgagga tcaagaggcc tctcctaaca tgccctcctt gtcttctcca 480
tcgttgatct tctcgcagca gtttcagcac agctctccag gtctagttcc gatgaacggc 540
accgccggcg ccgccgcttc tcttccgagc ttgcacgacg gcggcggcgg cggccatgag 600
agcagcatgc cggagtcatg gagccaactg cttctgtaaa cacctctctc cttctcttct 660
ctccttatct atctctattt tctatattca gttcatggcc tcctgatcat gttcaagcag 720
ggagagagag attcaaataa gaaacaagcc agccatgcac atccatgtaa attaaactat 780
agttaaacag catacttaag tgtagctcta gggagaagga ataaagtggt taacccactt 840
tgtcctatag tagatcaagc ctttcctaat gttcttctcc ttttctgcta acccatcatc 900
agagagatat atacaagcat gtgttcatgc tactaactct gctgcagttg tttccatctc 960
catggactca tgttcttgtg ctcatctgtg tgtgtgctcc ttgtgcaaac aaagctaatt 1020
aactgcactt ttttttgcat gcaatcaaaa cagtggggga ttagctggag atcaggagag 1080
gtacagcgcc actgcggctc tcctgtcaaa gggattagag aattggggag atcacgctgc 1140
tgcagctgca gccagtgcat gcatggttgg tggcatgaag gaggagggct ccatggctca 1200
agctgcagcc actgctgctg ctgctgctta cagcttctat gggagccacc ttgctggtga 1260
tcatcagcat gagatccaag cagcagcagc aggaggaggt gctagcaaca agtctcagct 1320
gagccagatg ctcatggctt cctctcctag gtcatgcatc accaccagcc tcggcagcaa 1380
catgctcgac ttctccaaca ccgcggcgcc gccggagctc cggagccacc accacaactc 1440
cgataattca tcagaggtaa gattgtaatt tgatcttggt gtgtgtagat cattagctct 1500
caagtagtat tggtcttgca tcttgttctc ttttgctttg tcattttcca aaattttttt 1560
tagataaatg tttggcattt tttatggctt gtttcaatta tacatgcata tgcatacata 1620
aggcaggatg cactgtaggt ctagaggcca gagatatgta ttcttcatat tctattttct 1680
tttaaaaaaa atagctacat ggaatgcaat ggattaccag gtgtatccaa aatgagaatt 1740
ttacgtgttt gacagatctt taggtttttc atcgagtata taagctatgt tcatcccctc 1800
tttgaaaagt tgcagtttcc aaagcatact tctcttcctc atactgctac acatgtttgg 1860
tggaaaagtt ataagtttga tcatgttctc cctaatgatc ctctaggcca aggcttttac 1920
gggctgtcaa tactcaatta atacaatctc ttggcaatgg tgcattctgt cctccatagt 1980
tccacgaatt gaaagtgtgc tattattatt atttatttcc atgaaaaagg tacatgtttt 2040
catgtcccat gggaaatcca ctctggtcaa agttaccact tgatgttttg catagcatgt 2100
tcttttcatg atatcttggt aagagtgttg gtcatgtata cagtatccat tgacagagct 2160
agcttaacat gagatcttta atttggtcat actcttagcc ttgttcttct ttatggctaa 2220
ctgctgtagt agtacatgag aggtcagtga atgtttagat gtagaatcac tggggagaga 2280
attcacttta gagagggtag agagatgtgt gtttttttct tcttcttctt ctcgggacaa 2340
gatgaaattg gggtcatgat tattcacgct ttgcctttct ttgtctttct ctagtgtaac 2400
agcacagcga ctggttcggc cctcaagaag gctagggttc aggcctcctc ttcagcacaa 2460
tctactctaa aggtttcttc ctcatcatcc tccctgcttt ccatggcaca caagccccat 2520
ccctctctct ctctctctct gcacgcacgc ataaagtgtg cttactttgg aagttcgtgc 2580
acagaaaatc acaacatttg gcagtagttt ccatttggaa tatcttggat tatgtagtat 2640
atatgttaac ataatcctta cattaggagg tttcttaggt gtgataattt gttttcaggt 2700
gaggaaggag aggctagggg atagaataac tgcacttcat cagattgtat ccccatttgg 2760
caaggtaaca aaaagacatg aaacttcagt taaccgcttt catggttaat tttagagatt 2820
agtaataagc tagcaacaat cagttgcatt atatatatat aagtatagag ggagatggat 2880
tacatcaaga tctgaatgtg ttgtcatgca cagtatgcaa ataggctatg gatgacttag 2940
aatagtttta ttcatatgtt gatgatgtta catgcaatta tctatagttt gtgccatgcc 3000
atgcatcgag ccagtagcaa ggtaagagta gctcctttat ttctttgttg ctggttttca 3060
ctcgaggggt tgtgtccaag taaagtaaat ctctgacaca cgtgcctcct tttacagact 3120
gacacagcgt ctgtactgca agagaccatt ggctatatca gattcctcct gagtcaaatt 3180
gaggtccaat ctctctctct cactttctat agctctgtct gcgtgtgtgc gtgtgtgttt 3240
aatttagagg gtgaaaaaaa atacttcccg ttatttttat caagttccta attataaata 3300
gatatattct aaaatggaga gagtgtgatc aatcttcttt gtaatgggca tatatattgc 3360
ataccccatc cgtccaagaa aaaactcaat tctagctacg aatctggata tatgtgggtt 3420
tgtctttttt tttaagacag aagagtagta tatgtatggg acattgagat ggaataagta 3480
tgggtgaaca gggaatattt gcactgcagg cagttgcagc attgtgccag tctcttcagc 3540
tactctagct gtttcagcca cagtaacatt tttccaagga aaaaaagaaa agaaacttct 3600
gcctctgcaa agtggggccc acagaggagt gtccccacaa gtaagggaca gtagtcgtag 3660
aggaggtaca tgtgatactg gcacacagtg cgggcgggaa acgaaaagat gggagagaat 3720
atgcatgcaa aatgggggcg gggccgggct aggtctgagc gggagcgcac gctgttaaag 3780
ttagctgcac ggcgagagat ggctcatggt catggctgtg cgtgcatggg cttcagcagc 3840
tgcatctgca tctgcatctg cggctgcagc gagatcgatt gatggagatg tcgttttagc 3900
caagtgcaat gtcgttgtta tctagttctt cgtctcgtag tgatgggaga ccggttaaat 3960
aggtattggt tttaaataaa tcgacaccta taagtcgata cctattaggt gttttgtact 4020
ccctctgttt tttaatagat gacgctgttg actttttctc acatgtttga ctattcgtct 4080
tactaaaaaa aattacgtaa ttgtaattta ttttgttatg agttatttta tcactcatag 4140
tactttaagt gtgatttatt aaaaaacgga ggtagtagta gtgttctatg tctcaaaatt 4200
tatagtattt gaatgtgtca catccggtat tagattgatt ttttataaaa tagagtagtt 4260
gttttatgtg tttcagagac cagtagagga ttgactctct ctctctctct gctcttctag 4320
ctttctacat ctcttgccct cttttttcta actaaaatgt aggttttacc tcggtatccg 4380
tctgaatgtt tttaaaattg ctaaaccgtg tatttcgtgt gaacaatttt tataaataag 4440
ttgctttaaa atattagata aatcttttct ttttttcaaa attgtaatga ttaaaactca 4500
attaaccgct aataattttc tagttgttca tgccctagct ctatatttat cttcttaaaa 4560
aaacaaacat atgtctctct tgatgaccat aggatgttgt ttcttgtgtg tgcaggctct 4620
gagctaccct tacatgggcg acgccaacgg gaccggtcct atgcaaaatg taagttcgtt 4680
gttgcatctc tctctctctc tctctctctc tttctctcat atttacgcac gtagtataag 4740
gctatatatg agcacaaaga ggaaaggagt atctatatac gagcgagaag atgccctaca 4800
cacgtgcagg ggtgccgtgc aacgcgaact taggctagct ttgccttggc tttgtagatc 4860
catactatca taggtgaaca aaactcttta tcaaaggcat tctaaaaaaa accctttcat 4920
caaaggttag gctgagtagg atcatccttt tggtgacctt tggggccaaa ggctttagat 4980
cttttataaa tctttatact acgtgcatga cggcaagctc tgttctgaaa acaaatatat 5040
ataacctcca tgaatttatg tgcgaatcca gaaaatattt tcatgtttgc aaatccatgc 5100
atagttgcacgtgttttttt ttcatggaat ggaagaaaaa tttccttaaa aattggggca 5160
tttgattaga tatatataag aaatagtaac tcaaaaaatt taaaacaagt gagtatgtcc 5220
tgatgattta tatgtttaga ataatagatc tgaataacct cccaaattaa ttaattttgt 5280
atatgccact gaataactac atgtccttta tacatgcatg aaactcctgc catcaatggc 5340
atattgttca gacaatgagg gttactactg catatataca atatgtatag ctatgatata 5400
tataattttt ttaaagctta gcatgcttaa ggcatcaaat cgactagaac atattagccg 5460
ctaaaaacca attaatataa atgcactctt gtagatgtat aaattttgtg tttctaaagc 5520
aaagaaaagt ttaacatgcc aattttttct gtctgtaaat ctatttttgt atagtataac 5580
tatattataa tttattttct gtgttaaatt tttattctgc acataaaatg ttcatatcta 5640
tttgcgtaaa actatatcgg ttatatatta tacattttta ttacccgtgg agaagggaca 5700
taaaccagta gttttcaatt tttttaaagc atggaataaa ttatcgatga aaagtctaca 5760
atgttggata tcaagaaaat taagacccta cttaagagtt taaatttctc ataaactgat 5820
tgaaaaatat tcaagaaaaa ttataccttg tgtccatatt tattttcaaa aaaaaattta 5880
tagctactaa atccacttta ctatctcata tattaaatta atcataggtt tatataaaaa 5940
agtattcctg tacaaaaagg tttcacgcaa tatatcacct cgcaagattt caacttaaaa 6000
tataacttat ataaggagaa taaaaaaaga ggaatgccat ttgcaattaa gtaaagtgtc 6060
ttagttcagt agttcaagtg aagcagcaaa atagttcatc gtagtaaaat tgacttctcc 6120
attttaaaac tttcaaacag cttagtacaa gattaattgt gtcatcatca catgagagaa 6180
aaaaaaaacc catgcaaagt acacagacat ggataagata gatattacca ccataacgtt 6240
cttagtttag ttgacattgg ccatatgcat ctgagacaac catgggccag tacaactcat 6300
gggttcaatc attttaccac acccaaaaaa atattctccc ctcagctttt ttgcacgctt 6360
gtacgtgcaa cgttgacatg tgacacagtt actttccttt tgattttata gggaccagtt 6420
ggagaaagga accctggcct cttcccggaa taccctggcc aggttagtgt agatctgtac 6480
atgcacatga ttattaattc ttatagatat aagaatataa tctatctata tagatattcc 6540
tttccagctc caagccactt ttttccttat atcttttttg tttgtgtgtg gttccttgtg 6600
cagttgctaa accataatgg caacactgga gcacagcagc ctgcagccca acctgagcag 6660
caggtatgta tgctctttgc ttagcttcaa agccattttc acaatgatgt atatacatga 6720
gtactgtgtc gactagagtg catggcatgt tgttatatat aagttttcaa gggcaaaatt 6780
aataccatac tcatatgttt ctttttccct ttttttcact aaaagcacct acatatagtt 6840
actatatata ctgataatag ttgcgaaaat taacatgcat gttactagct cctatatgta 6900
tttttttctg tataataatt tcatggcatt tgataattgt tattagggag caaacgacga 6960
tggaaagaag gacctgagga gccgggggct gtgcctcgtt ccagtgtcgt gcacgtcgca 7020
ctttggaggg gacaatgccg ctgactactg ggccccggcg ccgctcggcg ggatcctacg 7080
gtagaatgca tcgttgagat tcgtgcatac aaagcgtggc ggcacagcga gtactatatg 7140
ttgatgcatg aggaggctac agacgaaata ggtctcttaa gaatggagaa cagagtgtgc 7200
attgggtgca ggagtaacgt cgtcataaca tcatgagcag tcattctctg gtaagaaaaa 7260
aaattacctg taaggttgat tgctcttgat gctatgggag tgagaggtag ctagctatag 7320
tataattaat taagcttctg gatctgcaaa ttaagaagct tcagttcaag aaggagacct 7380
tgcaaaagtt gatgccccct ttgatatgta tatgtaaaat ctagcaagtc agtgaacact 7440
ttgctcatac taccgtgctt tgatttatca tcagaagcag aaaagcttgc gcggtagtgt 7500
caatattccg tcagttgctc ggctggtgta tgtaggaaat taaagttgat atcccatatc 7560
acatatatgt atattgacag ttaatttgta tcagttattt actgagttaa gtcagcaata 7620
ttatttgtct tcgatgttgc tgaattattt gtgtgcatct atatatggat tttctgtatg 7680
tcaatcgaca ggaaattagg ggac 7704
<210>4
<211>19
<212>DNA
<213>Oryza sativa L.
<400>4
ggagaattcc agagctccc 19
<210>5
<211>20
<212>DNA
<213>Oryza sativa L.
<400>5
cggccatgag agcagcatgc 20
<210>6
<211>1104
<212>DNA
<213>Artificial sequence
<400>6
aaggaatctt taaacatacg aacagatcac ttaaagttct tctgaagcaa cttaaagtta 60
tcaggcatgc atggatcttg gaggaatcag atgtgcagtc agggaccata gcacaagaca 120
ggcgtcttct actggtgcta ccagcaaatg ctggaagccg ggaacactgg gtacgttgga 180
aaccacgtgt gatgtgaagg agtaagataa actgtaggag aaaagcattt cgtagtgggc 240
catgaagcct ttcaggacat gtattgcagt atgggccggc ccattacgca attggacgac 300
aacaaagact agtattagta ccacctcggc tatccacata gatcaaagct ggtttaaaag 360
agttgtgcag atgatccgtg gcaggagaat tccagagctc ccgttttaga gctagaaata 420
gcaagttaaa ataaggctag tccgttatca acttgaaaaa gtggcaccga gtcggtgctt 480
tttttcaaga gcttggagtg gatggaccct gacactggaa tcggcagcaa aggatttttt 540
cctgtagttt tcccacaacc attttttacc atccgaatga taggatagga aaaatatcca 600
agtgaacagt attcctataa aattcccgta aaaagcctgc aatccgaatg agccctgaag 660
tctgaactag ccggtcacct gtacaggcta tcgagatgcc atacaagaga cggtagtagg 720
aactaggaag acgatggttg attcgtcagg cgaaatcgtc gtcctgcagt cgcatctatg 780
ggcctggacg gaatagggga aaaagttggc cggataggag ggaaaggccc aggtgcttac 840
gtgcgaggta ggcctgggct ctcagcactt cgattcgttg gcaccggggt aggatgcaat 900
agagagcaac gtttagtacc acctcgctta gctagagcaa actggactgc cttatatgcg 960
cgggtgctgg cttggctgcc gcggccatga gagcagcatg cgttttagag ctagaaatag 1020
caagttaaaa taaggctagt ccgttatcaa cttgaaaaag tggcaccgag tcggtgcttt 1080
ttttcaagag cttggagtgg atgg 1104
<210>7
<211>374
<212>DNA
<213>Artificial sequence
<400>7
tttaagattg acctgagatt tccagtacac aagttgtgtg catgcaaaga gaggccaaag 60
ctaagctagc aaaacacaca ttcctttccc acagctagct tagcttgaag caagcaagaa 120
ctcatcatct ttgtttctac atatccttta atactctcct ctctgtcact agcagtgatg 180
aatagaggag aattccagag ctgccggagt catggagcca actgcttctg taaacacctc 240
tctccttctc ttctctcctt atctatctct attttctata ttcagttcat ggcctcctga 300
tcatgttcaa gcagggagag agagattcaa ataagaaaca agccagccat gcacatccat 360
gtaaattaaa ctat 374
<210>8
<211>280
<212>DNA
<213>Artificial sequence
<400>8
tccctggtgc agcagatgat ctggagcggc agtagtacag gcacggctac cggcgtcggc 60
agcggcggcg gcgccggcag tttgatgggc agcttgaagc catgccatga ggatcaagag 120
gcctctccta acatgccctc cttgtcttct ccatcgttga tcttctcgca gcagtttcag 180
cacagctctc caggtctagt tccgatgaac ggcaccgccg gcgccgccgc ttctcttccg 240
agcttgcacg acggcggcgg cggcggccat gagagcagca 280
<210>9
<211>100
<212>RNA
<213>Artificial sequence
<400>9
ggagaauucc agagcucccg uuuuagagcu agaaauagca aguuaaaaua aggcuagucc 60
guuaucaacu ugaaaaagug gcaccgaguc ggugcuuuuu 100
<210>10
<211>101
<212>RNA
<213>Artificial sequence
<400>10
cggccaugag agcagcaugc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu u 101

Claims (10)

1. A method of growing plants having reduced plant height comprising the steps of: inhibiting the expression of bHLH73 gene in the original plant, thereby reducing the plant height of the plant; the plant is rice;
the bHLH73 gene is a nucleic acid encoding a bHLH73 protein;
the bHLH73 protein is a protein shown in a sequence 1 in a sequence table.
2. The method of claim 1, wherein: the bHLH73 gene is (b1) or (b2) as follows:
(b1) the coding region is a DNA molecule shown as a sequence 2 in a sequence table;
(b2) a DNA molecule shown in a sequence 3 of a sequence table.
3. The method of claim 1 or 2, wherein: "inhibiting the expression of the bHLH73 gene in the starting plant" is achieved by knocking out the full-length bHLH73 gene or knocking out a partial segment of the bHLH73 gene.
4. The method of claim 1 or 2, wherein: the expression of bHLH73 gene in starting plants is inhibited by CRISPR/Cas9 technology.
5. The method of claim 4, wherein: "inhibiting the expression of the bHLH73 gene in the starting plant" is achieved by introducing an interference vector; the interference vector expresses CAS9mRNA, OsU3-sgRNA and OsU6 a-sgRNA; OsU3-sgRNA target sequence is shown as sequence 4 in the sequence table; OsU6 the target sequence of 6a-sgRNA is shown as sequence 5 in the sequence table.
6. Use of the bHLH73 gene of claim 1 or 2 as a silenced target for breeding plants with reduced plant height; the plant is rice.
7. Use of a substance for inhibiting the expression of the bHLH73 gene according to claim 1 or 2 in breeding plants having a reduced plant height; the plant is rice.
8. A method of growing plants having reduced plant height comprising the steps of: reducing the content of a bHLH73 protein according to claim 1 in a plant and/or inhibiting the activity of a bHLH73 protein according to claim 1 in a plant, thereby reducing the plant height of the plant; the plant is rice.
9. Use of the bHLH73 protein of claim 1 to cultivate plants with reduced plant height as a target to be inhibited; the plant is rice.
10. Use of a substance for reducing the content of a bHLH73 protein according to claim 1 in a plant and/or inhibiting the activity of a bHLH73 protein according to claim 1 in a plant for growing plants with reduced plant height; the plant is rice.
CN201810059520.8A 2018-01-22 2018-01-22 Application of bHLH73 protein in regulation of plant height Active CN107988252B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810059520.8A CN107988252B (en) 2018-01-22 2018-01-22 Application of bHLH73 protein in regulation of plant height

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810059520.8A CN107988252B (en) 2018-01-22 2018-01-22 Application of bHLH73 protein in regulation of plant height

Publications (2)

Publication Number Publication Date
CN107988252A CN107988252A (en) 2018-05-04
CN107988252B true CN107988252B (en) 2020-05-26

Family

ID=62039832

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810059520.8A Active CN107988252B (en) 2018-01-22 2018-01-22 Application of bHLH73 protein in regulation of plant height

Country Status (1)

Country Link
CN (1) CN107988252B (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109810182B (en) * 2019-01-30 2022-06-10 扬州大学 BnLAX1.c gene, protein and application thereof in controlling cabbage type rape plant type
CN111518181B (en) * 2019-02-02 2022-05-03 湖南杂交水稻研究中心 Method for increasing rice yield and protein used by same
CN112390865B (en) * 2019-08-13 2022-09-20 中国农业科学院生物技术研究所 Application of Zm5008 gene in regulating and controlling plant height and internode distance of corn
CN112442115B (en) * 2020-12-08 2022-03-04 中国农业科学院作物科学研究所 Application of wheat TaPRR95-B protein or coding gene thereof in regulating and controlling plant height

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005001050A2 (en) * 2003-06-06 2005-01-06 Arborgen, Llc. Transcription factors
CN1772764A (en) * 2005-10-10 2006-05-17 中国科学院植物研究所 Rice DREB transcription factor and its coding gene and application
WO2008153927A2 (en) * 2007-06-06 2008-12-18 Monsanto Technology, Llc Genes and uses for plant enhancement
CN101503693A (en) * 2009-03-03 2009-08-12 中国农业科学院生物技术研究所 Halimodendron halodendron ERF transcription factor cDNA sequence, expression vector and use thereof
CN103525856A (en) * 2012-07-02 2014-01-22 华中农业大学 Ethylene responsive factor gene OsERF3 and application of promoter thereof in regulating and controlling development of rice roots
CN105755036A (en) * 2009-10-22 2016-07-13 巴斯夫植物科学有限公司 Plants Having Enhanced Yield-related Traits And Method For Making The Same

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140230092A1 (en) * 2013-01-21 2014-08-14 Rutgers, The State University Of New Jersey miRNA169 Compositions and Methods for the Regulation of Carbohydrate Metabolism and Flowering in Plants

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005001050A2 (en) * 2003-06-06 2005-01-06 Arborgen, Llc. Transcription factors
CN1772764A (en) * 2005-10-10 2006-05-17 中国科学院植物研究所 Rice DREB transcription factor and its coding gene and application
WO2008153927A2 (en) * 2007-06-06 2008-12-18 Monsanto Technology, Llc Genes and uses for plant enhancement
CN101503693A (en) * 2009-03-03 2009-08-12 中国农业科学院生物技术研究所 Halimodendron halodendron ERF transcription factor cDNA sequence, expression vector and use thereof
CN105755036A (en) * 2009-10-22 2016-07-13 巴斯夫植物科学有限公司 Plants Having Enhanced Yield-related Traits And Method For Making The Same
CN103525856A (en) * 2012-07-02 2014-01-22 华中农业大学 Ethylene responsive factor gene OsERF3 and application of promoter thereof in regulating and controlling development of rice roots

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ethylene-responsive protein related，putative，expressed，LOC_Os05g14010;Funded by the NSF;《Rice Genome Annotation Project》;20130206;LOC_Os05g14010序列信息 *
Identification of arsenic-stress responsive miRNAs and their targets from rice (Oryza sativa L.);Deepika Sharma等;《11th International Symposium on Rice Functional Genomics (ISRFG11) Conference Paper》;20131130;图"Expression profiles of up- and down-regulated miRNA targets in different developmental stages and tissues" *
植物bHLH转录因子的结构特点及其生物学功能;张全琪等;《热带亚热带植物学报》;20111231;第19卷(第1期);第84-90页 *
水稻矮秆突变体htr的表型分析及基因克隆;董邦宁等;《南京农业大学学报》;20171231;第40卷(第4期);摘要，第574页第2段 *

Also Published As

Publication number Publication date
CN107988252A (en) 2018-05-04

Similar Documents

Publication Publication Date Title
CN108239647B (en) Gene and molecular marker for controlling rape plant type and application
CN107988252B (en) Application of bHLH73 protein in regulation of plant height
US9309527B2 (en) Protein IPA1 related to plant architecture, its coding genes and uses
CN108948170B (en) Plant type growth and development related protein and coding gene and application thereof
CN108291234A (en) Multiple sporinite forms gene
CN109705202B (en) Method for cultivating plant resisting gray leaf spot
CN109112146B (en) Cloning and breeding application of gene qSLWA9 for controlling pod length and grain weight traits of brassica napus
CN110628808A (en) Arabidopsis AtTCP5 gene and application thereof in regulating plant height
CN112250741B (en) Use of protein derived from rice
CN108864266A (en) One kind Protein S SH1 relevant to rice seed holding and grain shape and its encoding gene and application
CN109721649B (en) Rice plant type regulation related gene, protein and application
CN113004383B (en) Application of corn gene ZmEREB102 in improving corn yield
CN114369147A (en) Application of BFNE gene in tomato plant type improvement and biological yield improvement
JP4015911B2 (en) Method for controlling the characteristics of monocotyledons by modification and / or overexpression of cytochrome P450 monooxygenase gene involved in brassinosteroid biosynthesis, and monocotyledons modified using this gene
CN110655561B (en) Corn bract length regulating protein ARR8, and coding gene and application thereof
CN110484555B (en) Construction method of transgenic rice with multi-seed cluster character
CN114230648B (en) Application of rice gene PANDA in improving plant yield
CN111499709B (en) RGN1 protein related to grain number per ear of rice as well as encoding gene and application thereof
CN101560251A (en) Associated protein for plant root growth and encoding gene and application thereof
CN110484545B (en) Anti-mosaic virus GsCAD1 gene separated from wild soybean, encoding protein and application thereof
CN109182350B (en) Application of corn Zm675 gene in plant quality improvement
JP7023979B2 (en) Application of protein nog1 to the regulation of plant yield and number of ears
CN106349353B (en) Plant starch synthesis related protein OsFSE (OsFSE) regulation and control, and coding gene and application thereof
CN112080481B (en) Spike-type related gene OsFRS5 and application and phenotype recovery method thereof
CN112521473B (en) Wheat male sterility related protein TaMYB97, and coding gene and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant