CN107988243B

CN107988243B - Hylocereus griseus histidine kinase gene RcHK and encoding protein and application thereof

Info

Publication number: CN107988243B
Application number: CN201711375221.7A
Authority: CN
Inventors: 张梅娟; 沙伟; 马天意; 任巍巍; 秦瑞峰; 钱朋智
Original assignee: Qiqihar University
Current assignee: Qiqihar University
Priority date: 2017-12-19
Filing date: 2017-12-19
Publication date: 2020-01-14
Anticipated expiration: 2037-12-19
Also published as: CN107988243A

Abstract

A sphagnum histidine kinase gene RcHK and a coding protein and application thereof relate to the sphagnum histidine kinase gene RcHK and the coding protein and application thereof. The aim is to provide a sphagnum histidine kinase gene RcHK and a coding protein and application thereof. The nucleotide sequence of the griseum histidine kinase gene RcHK is shown in a sequence table Seq ID No: 1, the amino acid sequence is shown in a sequence table Seq ID No: 2, the gene is applied to improving the drought resistance of plants. The invention transfers the sphagnum histidine kinase gene RcHK into plants, improves the drought resistance of the plants, lays a foundation for cultivating new drought-resistant plant varieties and enhancing the stress resistance of the plants, and has important significance. The invention is applied to the field of molecular breeding.

Description

Hylocereus griseus histidine kinase gene RcHK and encoding protein and application thereof

Technical Field

The invention relates to a gene and a coding protein and application thereof, in particular to a sphagnum histidine kinase gene RcHK.

Background

Abiotic stress factors include drought, salinity, extreme temperatures (cold and high), heavy metals, and the like. In a long evolution process, plants have evolved a regulatory mechanism capable of adapting to the environment, and after receiving a stress signal, the plants can initiate a series of signal pathways to trigger some protective reactions to ensure normal growth. Studies have shown that stress may lead to Reactive Oxygen Species (ROS), cytosolic Ca²⁺Concentrations and other compounds may act as second messengers regulating downstream protein phosphorylation and gene transcription, and the entire signaling pathway will lead to expression of stress response genes. It is proved that a plurality of genes are involved in the abiotic stress of plants, stress response genes are induced and expressed, a large amount of specific proteins are generated in the plants, and the physiological, biochemical and metabolic changes of the plants are synergistically regulated, so that the plants adapt to the external stress. Histidine kinases are among them.

Histidine kinases can constitute a two-component signal transduction system with downstream target proteins. The two-component system is classified into a simple two-component system and a complex two-component system. A simple two-component system consists of Histidine Protein Kinase (HPK) and response regulator protein (RR). The HPK has an input module capable of sensing external signals and is connected with a catalytic module (catalyticmodule) of protein kinase, and the structural characteristic enables the HPK to be sensitively sensed by external environment changes. In addition, each HPK molecule has a delivery module (Transmitter module) consisting of about 250 amino acid residues, which is the site of autophosphorylation, which is generally a conserved histidine residue. RR has a domain called the receiver module (receiver module) consisting of approximately 110 amino acids. Aspartic acid is a phosphorylation site, and there is also an output domain. Thus signal transduction consists of signal input, HPK autophosphorylation, RR phosphorylation and signal output. The RR family (ARR) in arabidopsis is divided into three groups, type a, B and C, depending on the structure of the protein. Type a contains a relatively small phosphorylatable aspartate receptive domain and a short C-terminal extension, and is involved in red light signaling, biological clock, lateral root formation, leaf senescence and cold stress, in addition to acting as a negative regulator of cytokinin signaling. The B-type ARR contains a receiving domain and an output domain with a longer C end, and the B-type ARR is used as a transcription factor and activates an A-type response regulatory factor to participate in the regulation and control of cytokinin; type C is similar to type a, and differs from type a in that it does not depend on cytokinin expression. In Arabidopsis, histidine kinases are involved in diverse biological functions including ethylene signaling pathways, osmotic sensing, cytokinin signaling pathways, large gametophyte development, cold sensing, modulating salt sensitivity, resistance to bacterial and fungal infections.

The bryophytes are widely distributed all over the world, and many varieties of the bryophytes have strong adaptability to adverse environments and can survive in extreme climates such as drought, high temperature, low temperature and the like. Sphagnum sativum (Racomitrium canascens) of the sphagnum genus (Racomitrium) of the family Hypophyceae is a plant growing in soil layers and sandy soil on the surface of rocks, has strong drought tolerance, and is vital when stored in an arid environment for several years. Therefore, the research on the function of the histidine kinase gene of the sphagnum plant can provide gene resources for drought-resistant molecular breeding of plants and lay a theoretical foundation, and has important scientific value, theoretical significance and practical significance.

Disclosure of Invention

The invention aims to provide a sphagnum histidine kinase gene RcHK and a coding protein and application thereof

The nucleotide sequence of the griseus histidine kinase gene RcHK is shown in a sequence table Seq ID No: 1 is shown.

The amino acid sequence of coding the griseus histidine kinase gene RcHK is shown in a sequence table Seq ID No: 2, respectively.

The application of the malus asiaticus histidine kinase gene RcHK is the application in improving the drought resistance of plants.

The invention has the beneficial effects that:

the complete cDNA sequence of histidine kinase gene RcHK is separated from grifola, connected to a plant expression vector, and transformed into model plant tobacco by utilizing an agrobacterium infection method to obtain a transgenic plant, and the transgenic plant is subjected to natural drought stress treatment for 15 days and then subjected to rehydration treatment, and the result shows that the drought resistance of the transgenic plant is higher than that of wild type tobacco, so that excellent gene resources can be provided for plant genetic engineering breeding, and a material basis is provided for improving the stress resistance of plants.

Drawings

FIG. 1 is an electrophoresis image of the full-length cDNA cloned to obtain the RcHK gene in example 1; wherein M is Marker 2000; 1 is a gene fragment;

FIG. 2 is a graph showing the results of the expression of the RcHK gene under rehydration conditions in example 1;

FIG. 3 is a graph showing the expression result of the RcHK gene under drought conditions in example 1;

FIG. 4 shows transgenic tobacco T of example 1₁Generating a PCR result graph; wherein M is Marker 2000; 1 is a transgenic plant; 2 is a non-transgenic plant;

FIG. 5 is a phenotype map of plants before drought stress of transgenic tobacco in example 1;

FIG. 6 is a plant phenotype plot of transgenic tobacco drought stress 15d in example 1;

FIG. 7 is a phenotype of the plant obtained after rehydration of transgenic tobacco in example 1.

Detailed Description

The first embodiment is as follows: the nucleotide sequence of the sphagnum histidine kinase gene RcHK of the embodiment is shown in a sequence table Seq ID No: 1 is shown.

The embodiment separates the complete cDNA sequence of the histidine kinase gene RcHK from the sphagnum, connects the complete cDNA sequence to a plant expression vector, transforms the model plant tobacco by utilizing an agrobacterium infection method to obtain a transgenic plant, carries out natural drought stress treatment on the transgenic plant for 15 days, and then carries out rehydration treatment.

The second embodiment is as follows: the amino acid sequence of the coded sphagnum histidine kinase gene RcHK is shown in a sequence table Seq ID No: 2, respectively.

The third concrete implementation mode: the application of the malus asiaticus histidine kinase gene RcHK in the embodiment refers to the application of improving the drought resistance of plants.

The fourth concrete implementation mode: the third difference between the present embodiment and the specific embodiment is that: the RcHK gene is introduced into plant cells, tissues or organs, and then the transformed plant cells, tissues or organs are cultured into plants, so that the RcHK gene is expressed in the plants, and the transgenic plants with improved stress resistance under drought stress are obtained. The rest is the same as the third embodiment.

The fifth concrete implementation mode: this embodiment is different from the third or fourth embodiment in that: the plant is tobacco. The others are the same as the third or fourth embodiment.

The effect of the invention was verified by the following experiments:

example 1:

cloning of RcHK Gene

1. Material treatment

The experimental material sphagnum is collected from the natural protection area of the Wudalianchi pool in Heilongjiang province. Selecting the material with vigorous growth, washing with sterile water, culturing at room temperature for 7 days, and collecting the stem tip part as experimental material for RNA extraction.

2. Extraction of total RNA from Malaria frondosa (modified SDS method).

(1) Putting 0.3g of sphagnum into a precooled mortar, adding a small amount of PVP and ascorbic acid, grinding in liquid nitrogen, transferring the ground powder into a 1.5mL centrifuge tube, adding 750 mu L of 2% SDS, adding 350 mu L of each of Tris phenol and chloroform, shaking for 10min, centrifuging at 4 ℃ at 12000 r/min for 10 min;

(2) collecting supernatant, adding 350 μ L of Tris phenol and chloroform respectively, shaking for 10min, and centrifuging at 4 deg.C 12000 r/min for 10 min;

(3) repeating the step (2) once;

(4) adding equal volume of chloroform into the supernatant, shaking vigorously for 10min, centrifuging at 12000 r/min at 4 deg.C for 10 min;

(5) adding 10mol/L LiCl in the volume of 1/2 and 75% ethanol in the volume of 1/2 into the supernatant, and placing the mixture into a refrigerator at the temperature of-80 ℃ for sedimentation for 1 h;

(6) centrifuging at 4 deg.C 12000 r/min for 20min, discarding supernatant, adding 75% ethanol, and centrifuging at 4 deg.C 12000 r/min for 10 min;

(7) and removing the supernatant, drying in an ice bath, adding a proper amount of 0.1% DEPC water, and detecting by 1% agarose gel electrophoresis.

3. First Strand cDNA Synthesis

cDNA is obtained by reverse transcription of total RNA of sphagnum griseum, and the synthesis process is carried out according to the instructions of M-MLV reverse transcriptase of Promega company.

4. Cloning of genes

Taking cDNA as a template, carrying out PCR amplification, wherein a reaction system and a reaction program are as follows:

upstream primer RcHKP 1: 5'-AGATTGCGAGTGGTGTTAGCC-3'

Downstream primer RcHKP 2: 5'-CCATCAATCCTGTGTTCTCGG-3'

And carrying out electrophoresis detection on the obtained PCR product, recovering a target fragment, and connecting the target fragment with a pMD-19simple T vector to obtain pMD 19T-RcHK. And transforming the connecting product into an escherichia coli competent cell, selecting a positive clone for plasmid extraction, and performing enzyme digestion detection and sequencing analysis to obtain a sequence with the length of 1067 bp, wherein the nucleotide sequence of the sequence is shown as SEQ ID No: 1, and the code has the sequence shown in SEQ ID NO: 2 in the presence of a protease. The PCR results are shown in FIG. 1.

Expression analysis of RcHK Gene

1. Material treatment for qPCR analysis

Naturally airing collected sphagnum moss, taking materials when carrying out rehydration treatment for 1d, 2d, 3d, 4d and 5d, respectively, carrying out rapid drying treatment on the normally growing materials by using silica gel for 10min, 20min, 30min, 1h, 4h, 8h, 1d and 2d, respectively, sampling the treated and stored samples for two years, and selecting the materials recovering normal growth as a control. Immediately placing the materials into liquid nitrogen for freezing after material taking treatment, and placing the materials into a refrigerator at the temperature of minus 80 ℃ for freezing and reserving for later use. RNA was extracted and reverse transcribed to cDNA as described in step one.

2. qPCR reaction system and program

The reaction is carried out on a CFX-96 quantitative PCR instrument, the RcHK gene of sphagnum is taken as a target gene, the 18s RNA gene of sphagnum is taken as an internal reference, a qPCR primer is designed, and SsoFast is adopted^TM

qPCR was performed by the Supermix fluorescent dye method.

18s rRNA-F：5^′-TTGACGGAAGGGCACCA-3^′

18s rRNA-R：5^′-ACCACCACCCATAGAATCAAGAA-3^′

RcHK-F：5^′-TCACTGCACGTCTTGGTAGC-3^′

RcHK-R：5^′-GCCTCCACTGCTAGTTGTCC-3^′

The reaction system is as follows: SsoFast EvaGreen supermix (2X) 10. mu.L, primers 1.0. mu.L each (10. mu. mol/L), template cDNA 1ng, ddH₂And O is supplemented to 20 mu L. The reaction program is 95 ℃ for 30 s; 95 ℃ for 5s, 58 ℃ for 10s, 72 ℃ for 30s, 35 cycles. Relative expression amount of the Gene 2^-ΔΔCtAnd (4) carrying out calculation analysis.

As a result, the gene expression level was found to be higher than that of the control at each time during rehydration (FIG. 2) and rapid drought (FIG. 3), indicating that RcHK participates in the drought stress response of sphagnum grisea.

Thirdly, construction of plant expression vector pRI-101AN-RcHK

Analysis of the cleavage sites of the plant expression vector pRI-101AN and RcHK sequences and design of a primer with a cleavage site (RcHK-Sal I: 5' -ACGC)GTCGACAGATTGCGAGTGGTGTTAGCC-3′；RcHK-Kpn I：5′-GGGGTACCCCATCAATCCTGTGTTCTCGG-3'), and performing PCR amplification using the pMD 19T-RcHK plasmid as a template, the reaction system and procedure being identical to those of step one. Performing double enzyme digestion on the PCR product and the pRI-101AN empty vector plasmid respectively, and connecting enzyme digestion products of the PCR product and the pRI-101AN empty vector plasmid, wherein a connecting system is as follows:

after mixing well, centrifugation was carried out and ligation was carried out overnight at 16 ℃.

And transforming the connecting product into AN escherichia coli competent cell, identifying positive clones by bacterial liquid PCR and enzyme digestion, and performing sequencing analysis, wherein the result shows that the pRI-101AN-RcHK vector is successfully constructed.

Fourth, obtaining transgenic RcHK tobacco

1. Freeze-thawing method for transforming agrobacterium

AN agrobacterium strain EHA105 is selected, and a freeze-thaw method is adopted to transfer the recombinant plasmid pRI-101AN-RcHK into agrobacterium, and the method comprises the following specific steps: (1) adding 10 μ L of recombinant plasmid into EHA105 competent cell, and ice-cooling for 30 min; (2) quick freezing with liquid nitrogen for 5min, and hot shocking at 37 deg.C for 5 min; (3) adding 800 μ L YEB liquid culture medium without antibiotic, and shake culturing at 28 deg.C for 4 hr at 180 r/min; (4) centrifuging at 5000 r/min for 5min, adding 100 μ L YEB liquid culture medium to resuspend thallus; (5) uniformly coating the bacterial liquid on YEB solid culture medium containing (50 mu g/mL each of Rif and Kana), and culturing at 28 ℃ for about 2-4 days; (6) and extracting plasmids, and performing PCR identification by using the bacterial liquid as a template and using a specific primer.

2. The agrobacterium-mediated method for transforming the tobacco comprises the following specific steps:

(1) tobacco seed disinfection: washing with 75% ethanol for 1min, washing with 2% hypochlorous acid for 8min, and washing with sterile water for 5-6 times;

(2) and (3) culturing sterile seedlings: inoculating the disinfected seeds on an MS culture medium for culture to obtain aseptic seedlings;

(3) the method comprises the steps of carrying out secondary activation on agrobacterium liquid containing target fragments before infection, adding the liquid into YEB liquid culture medium containing antibiotics (50 mu g/mL of each of Rif and Kana) according to a ratio of 1:100 during primary activation, carrying out shaking culture at 28 ℃ and 180r/min for about 16h, adding the liquid subjected to primary activation into YEB liquid culture medium containing the antibiotics (50 mu g/mL of each of Rif and Kana) according to a certain ratio during secondary activation, carrying out shaking culture at 28 ℃ and 180rpm until OD is OD₆₀₀Up to 0.5;

(4) centrifuging twice activated bacteria solution at 5000 r/min for 10min, collecting thallus, washing with MS liquid culture mediumWashing the bacterial cells and diluting to OD₆₀₀The bacterial liquid up to 0.1 can be used for infecting tobacco;

(5) tobacco transformation by leaf disc method: taking 12-15 tobacco leaf discs with the thickness of 8mm in a sterile operating platform, putting the tobacco leaf discs into a small conical flask, pouring the tobacco leaf discs into a staining solution, slightly shaking the tobacco leaf discs, taking out the tobacco leaf discs after 10min, putting the tobacco leaf discs on sterile filter paper, sucking off excessive bacteria liquid, putting the tobacco leaf discs into an MS (adding 2.0 mu g/mL 6-BA with the final concentration and 0.5 mu g/mL NAA with the final concentration) solid culture medium, carrying out dark culture for 2d, cleaning the tobacco leaf discs by using sterile water and the MS liquid culture medium, sucking off the excessive bacteria liquid, transferring the tobacco leaf discs to an MS (adding 2.0 mu g/mL 6-BA with the final concentration and 0.5 mu g/mL NAA with the final concentration) solid culture medium containing 500 mu g/mL cefalotin and 50 mu g/mL kanamycin with the final concentration and carrying out subculture once every 10d to obtain₀Replacing tobacco.

Fifth, drought resistance identification of transgenic RcHK tobacco

1、T₀Culture of tobacco-substitute seedling

Selecting T₀The transgenic tobacco and wild tobacco seeds are firstly sterilized by 75 percent alcohol for 5min, then sterilized by 10 percent NaClO for 10min, and then washed by sterile water for 5-7 times. The sterilized seeds were plated on 1/2MS (containing 50mg/L Kan) and 1/2MS media, respectively, for culture.

2、T₁Screening and identification of transgenic tobacco

Transformants that grew normally in kanamycin-containing medium were transformed plants, but the non-transformants died gradually. Selecting T with the same growth vigor of wild plants and transgenic plants₁And (3) plant generation, transferring the plant into soil for continuous culture, extracting leaf DNA after isometric stability, and carrying out PCR amplification. In the transgene T₁The expression of the RcHK gene could be detected in the plants of the generations but not in the wild type tobacco, and the results are shown in FIG. 4 (1: transgenic plants; 2: non-transgenic plants).

3. Drought resistance identification

Respectively taking the wild type and RcHK gene-transferred tobacco with consistent growth vigor, watering the tobacco once enough, then not watering the tobacco, carrying out natural drought stress treatment for 15 days, then carrying out rehydration treatment, and observing the phenotype change. FIGS. 5 and 6 are graphs showing the growth results of wild type and transgenic tobacco under normal growth and drought stress, and it is evident from FIG. 7 that the transgenic plants recovered normal growth after rehydration and the wild type did not recover.

Therefore, the malpighia hispida histidine kinase gene RcHK can improve the drought resistance of plants, lays a foundation for cultivating new drought-resistant plant varieties and enhancing the stress resistance of the plants, and has important significance.

Sequence listing

<110> university of ziqi hall

<120> Sandy moss histidine kinase gene RcHK and encoding protein and application thereof

<160>8

<210>1

<211>1067

<212>DNA

<213> Racomitrium caescens of sphagnum

<400>1

agattgcgag tggtgttagc cgaaagcccc ttcaacgtcg ccgacgaaaa cggtgataat 60

ggctttgtaa acatgatggc attagataca agcggcgagg acgaggtatt gaccgatgaa 120

gacagaggtc cttctcttct tcagggacag gctgagatta gcaatgatat agatccggat 180

ccacaaatgt ggttcgaggt tcgagtaaca gacacgggaa taggtcttac tcaagagcag 240

cagtccaggc tttttcaatc tttctcccag gcagacagca gcacaacaag gaaattcggt 300

ggcacagggt taggattagc gatctcgaaa ggtctggtgg aagtcatggg aggtaaaatt 360

tgggtggaaa gcgaattcgg gaaagaaagt accttcgcgt tctgtgtccc attacgagct 420

gctgtgaatt ttatcagttg ccttccggag cctggacctc catctccacc acaagctaaa 480

cctttcagac tgaaagagag atcactgcac gtcttggtag cggaggacaa ctcggtaaat 540

cagttattga tatcgaagat gctgaaacat tacggccacg aggttcaact agtaggaaat 600

ggacaactag cagtggaggc tgtacaaacc gggaagcacg acatgatttt gatggaccta 660

caaatgcccg tcctcgatgg cctgagtgcc accaaagcca ttcgtgctct tggcggtcgt 720

ggactagacg ttcccatata cgcactgaca gctgatgtac tgaccaagag ccacggatct 780

ctcgatgcta tgggcttaga cggatacttg acgaagccca tcaactggca atctctttct 840

caagtcattg agaacgtcgt cggtgggagg cgccgatcgc catgaagggc aacgtacatc 900

atggcacgag ttaaatgatc tctgtagact gcaggttttt cagtttctgt gatagaggct 960

ggatgccttt tgccaagctt ctgtgggggc tgtggttcct gttcctacac cttcttgaac 1020

agaccttctt gatctctatc agagaaccga gaacacagga ttgatgg 1067

<210>2

<211>270

<212>PRT

<213> Racomitrium caescens of sphagnum

<400>2

Met Met Ala Leu Asp Thr Ser Gly Glu Asp Glu Val Leu Thr Asp

1 5 10 15

Glu Asp Arg Gly Pro Ser Leu Leu Gln Gly Gln Ala Glu Ile Ser

20 25 30

Asn Asp Ile Asp Pro Asp Pro Gln Met Trp Phe Glu Val Arg Val

35 40 45

Thr Asp Thr Gly Ile Gly Leu Thr Gln Glu Gln Gln Ser Arg Leu

50 55 60

Phe Gln Ser Phe Ser Gln Ala Asp Ser Ser Thr Thr Arg Lys Phe

65 70 75

Gly Gly Thr Gly Leu Gly Leu Ala Ile Ser Lys Gly Leu Val Glu

80 85 90

Val Met Gly Gly Lys Ile Trp Val Glu Ser Glu Phe Gly Lys Glu

95 100 105

Ser Thr Phe Ala Phe Cys Val Pro Leu Arg Ala Ala Val Asn Phe

110 115 120

Ile Ser Cys Leu Pro Glu Pro Gly Pro Pro Ser Pro Pro Gln Ala

125 130 135

Lys Pro Phe Arg Leu Lys Glu Arg Ser Leu His Val Leu Val Ala

140 145 150

Glu Asp Asn Ser Val Asn Gln Leu Leu Ile Ser Lys Met Leu Lys

155 160 165

His Tyr Gly His Glu Val Gln Leu Val Gly Asn Gly Gln Leu Ala

170 175 180

Val Glu Ala Val Gln Thr Gly Lys His Asp Met Ile Leu Met Asp

185 190 195

Leu Gln Met Pro Val Leu Asp Gly Leu Ser Ala Thr Lys Ala Ile

200 205 210

Arg Ala Leu Gly Gly Arg Gly Leu Asp Val Pro Ile Tyr Ala Leu

215 220 225

Thr Ala Asp Val Leu Thr Lys Ser His Gly Ser Leu Asp Ala Met

230 235 240

Gly Leu Asp Gly Tyr Leu Thr Lys Pro Ile Asn Trp Gln Ser Leu

245 250 255

Ser Gln Val Ile Glu Asn Val Val Gly Gly Arg Arg Arg Ser Pro

260 265 270

<210>3

<211>17

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of PCR primer 18s rRNA-F.

<400>3

TTGACGGAAGGGCACCA 17

<210>4

<211>23

<212>DNA

<213> Artificial sequence

<220>

<223> PCR primer 18s rRNA-R nucleotide sequence.

<400>4

ACCACCACCCATAGAATCAAGAA 23

<210>5

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of PCR primer RcHK-F.

<400>5

TCACTGCACGTCTTGGTAGC 20

<210>6

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of PCR primer RcHK-R.

<400>6

GCCTCCACTGCTAGTTGTCC 20

<210>7

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of PCR primer RcHKP 1.

<400>7

AGATTGCGAGTGGTGTTAGCC 21

<210>8

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of PCR primer RcHKP 2.

<400>8

CCATCAATCCTGTGTTCTCGG 21

Claims

1. The gene RcHK is characterized in that the nucleotide sequence of the gene is shown as Seq ID No: 1 is shown.

2. The malpighia histidine kinase gene RcHK according to claim 1, characterized in that the amino acid sequence of the protein encoded by the gene is shown in the sequence table Seq ID No: 2, respectively.

3. The use of the histidine kinase gene RcHK of sphagnum as claimed in claim 1 for improving the drought resistance of plants to rehydration.

4. The use according to claim 3, wherein the RcHK gene is introduced into a plant cell, tissue or organ, and the transformed plant cell, tissue or organ is cultured into a plant, so that the RcHK gene is expressed in the plant, thereby obtaining a transgenic plant with improved stress tolerance under drought stress.

5. Use according to claim 3, characterized in that said plant is tobacco.