CN107937501A - A kind of method of fast and convenient screening CRISPR/Cas gene editing positive objects - Google Patents
A kind of method of fast and convenient screening CRISPR/Cas gene editing positive objects Download PDFInfo
- Publication number
- CN107937501A CN107937501A CN201711194211.3A CN201711194211A CN107937501A CN 107937501 A CN107937501 A CN 107937501A CN 201711194211 A CN201711194211 A CN 201711194211A CN 107937501 A CN107937501 A CN 107937501A
- Authority
- CN
- China
- Prior art keywords
- primer
- pcr
- screening
- sample
- hole
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of method of fast and convenient screening CRISPR/Cas gene editing positive objects, compared with prior art, the present invention uses a PCR primer of the Oligo DNA fragmentations of structure knockout carrier as screening target sample, need to match completely with template in PCR reactions using the sequence that primer 3 ' is held, the characteristics of efficiently PCR could being triggered to react, be detected possible mutation on DNA.Method using the present invention reduces experimental procedure, and not design extra PCR primer, suitable for nearly all experimental design, it is not necessary to buys special DNA restriction endonucleases, false positive hardly occurs.The sample for being used to be sequenced obtained at the same time has higher qualification rate, and hardly omits the sample of qualification.
Description
Technical field
The invention belongs to biological field, and in particular to a kind of fast and convenient screening CRISPR/Cas gene editing positives are right
The method of elephant.
Background technology
With the continuous development of science and technology, gene editing technology also achieves significant progress, three main at present big technologies
For ZFN, TANLEN and CRIPSR technologies.For CRISPR technologies because its method is simple, cost is low etc. increasingly becomes mainstream technology, and
And be successfully applied in different types of species, include but not limited to animal, in plant and microorganism.
CRISPR/Cas systems (CRISPR related systems), CRISPR (clustered regulatory
Interspaced short palindromic repeat) i.e. cluster, regular intervals short palindrome repetitive sequence is gene
A site for containing multiple short tandem repeats in group, this site plays one in bacterium and archeobacteria (archaea) intracellular
The effect of kind acquired immunity (acquired immunity).CRISPR systems rely primarily on crRNA and tracrRNA and come externally
Source DNA carries out sequence-specific degradation.3 kinds of CRISPR/Cas systems are had now been found that, wherein in type 2 system (type II
Systems what is relied in) is Cas9 albumen.Under the mediation of RNA, Cas9 albumen can be to the target of crRNA-tracrRNA identifications
Cut between third and fourth base of tail of sequence, be broken DNA target sequence, form DSB, and then induced DSB and repair
Mechanism.The repair mechanism carries certain randomness, and the DNA sequence dna of the breaking part after repairing can be caused different from original series,
Situations such as base insertion, base replacement, base deletion can be produced.
Design knockout site and its corresponding structure knockout that is used for is needed to carry before CRISPR/Cas gene editings are carried out
The Oligo sequences of body, each site correspond to 1 pair of Oligo sequence;A pair is designed at the same time to be used for later stage screening and be sequenced what is used
Primer, is included with this region amplifiable to primer and knocks out site areas.CRISPR/Cas gene editing positive objects are screened, i.e.,
By technological means, detect in target group, if include the individual different from original series of the sequence at DNA break.Generally
In the case of, first pass through distinct methods and obtain the monoclonal sample after gene editing processing, and then obtain the gene of monoclonal sample
Group.Afterwards, designed for different previous experiments, there is different screening techniques.At present, crispr/cas9 gene editings are screened
The method of positive object can be divided into several major classes.The alternative method of this method has two major classes:The first kind needs design volume
Outer PCR primer, and this method is not suitable for all previous experiments designs;Second class needs to use a kind of DNA restriction endonucleases, the party
Easily there is false positive in method, and adds operating procedure.
Previous experiments are designed as cutting adjacent two positions farther out on same DNA, method A at the same time:Directly using sieve
Select primer to carry out PCR amplification, detected by agarose gel electrophoresis, choose amplified band substantially the sample short compared with theoretical length into
Advance a step sequence verification;Method B:One PCR primer between screening primer pair of additional designs, with screening in primer
One carries out PCR amplification together, is detected by agarose gel electrophoresis, and the sample for choosing no amplified band is further sequenced
Verification, sometimes to prevent false positive, also needs design to ensure the verification primer of experimentation zero defect.
Previous experiments are designed as cutting adjacent two nearer positions, method C on same DNA at the same time:With method B, but
Screening primer pair can be used directly as verification primer;Method D:PCR amplification directly is carried out by screening primer, all samples are straight
Sequence verification was connected, can be detected sometimes by agarose gel electrophoresis, choosing amplified band length and theoretical value has faint change
The sample of change carries out further sequence verification;Method E:PCR amplification directly is carried out by screening primer, by amplified production in proportion
Mixed in proportion with the amplified production of original DNA sequence, by one wheel denaturation-annealing, using mispairing enzyme (mainly CEL1 or
T7E1 enzymes) processing after, detected by agarose gel electrophoresis, choose DNA electrophoretic bands theoretical size strip lower section occur 1
The sample of bar or two smaller bands carries out further sequence verification.Previous experiments design a position only on cutting DNA, sieve
Choosing method application method D or method E.
Above method there are the problem of:Method A:Narrow application range, only when two cleavage sites are at a distance sufficiently large, leads to
Agarose gel electrophoresis result is crossed just to can determine whether;The sample of qualification can be omitted, such as, in 1 or 2 cleavage site DNA sequence dnas
The sample all to change.Method B, C:Need additional designs primer;The sample of qualification can be omitted, such as, cut in 1 or 2
Cut the sample that site DNA sequence dna all changes.Method D:Substantial amounts of sequencing expense can be produced;When needing certain due to sequencing
Between, in the case where non-targeted individual cannot be excluded, it is necessary to maintain all individual survivals, add the amount of labour and material into
This.Method E:Multiple operating procedures are added, make screening time elongated;Mispairing enzyme higher price, adds cost, and can produce
False positive and false negative.
The content of the invention
It is an object of the invention to provide a kind of side of fast and convenient screening CRISPR/Cas gene editing positive objects
Method, using the Oligo DNA fragmentations of structure knockout carrier as a PCR primer for screening target sample, not design extra
PCR primer, it is few suitable for nearly all experimental design, experimental procedure, it is not necessary to special DNA restriction endonucleases to be bought, for surveying
The sample of sequence has higher qualification rate, and does not omit the sample of qualification.
A kind of method of fast and convenient screening CRISPR/Cas gene editing positive objects provided by the invention, including with
Lower step:
1) sequencing primer pair is designed, chooses screening group primer pair;
2) annealing temperature of primer pair is designed;
3) genome extracts;
4) primer pair designed using step 1) carries out PCR amplification respectively;
5) laggard row agarose gel electrophoresis are expanded, in the case where the PCR of control group has electrophoretic band, if screening
Group does not occur the electrophoretic band predicted, then corresponding sample is the target of preliminary screening;
6) selecting step 5) sample that screens, carry out PCR amplification to the genome of the sample using sequencing primer, TA grams
DNA sequencing is carried out after grand, sequencing result is analyzed, verifies whether the sample meets experimental design.
The primer pair of sequencing primer described in step 1) as a control group, is designed according to conventional methods.
Further, the selection of the primer pair of screening group described in step 1) includes 2 kinds of situations, but used as primer
Oligo DNA fragmentations are all that of forward direction, i.e. the Oligo DNA fragmentations comprising recognition site sequence.Situation 1, early period are real
Test two sites for being designed as editing at the same time on same DNA, and the two sites are apart from moderate, at the same this at 2 containing identification
Site sequence is opposite, i.e., can be normally carried out PCR amplification as primer using this positive Oligo DNA fragmentation at two.Its
Remaining situation is situation 2.
Situation 1:During screening, the change in 2 sites is detected at the same time with 1 pair of screening primer, screening primer pair is two forward directions
Oligo DNA fragmentations.
Situation 2:During screening, the change in 1 site is only detected with 1 pair of screening primer, screening primer pair for the site just
To Oligo DNA fragmentations, and wherein one sequencing primer for being capable of progress PCR in combination.
Further, step 2) is specially:By annealing temperature software for calculation, determine that the optimal annealing of theory of primer pair is warm
Degree.On this basis, centered on this temperature, 4-5 gradient is set, temperature difference is 1.5-2.0 DEG C between each gradient.According to
Agarose gel electrophoresis after PCR reactions is as a result, determine the usable range of actual annealing temperature.
Further, step 2) be preferably, control the actual annealing temperature of group selection be in the range of temperature;Screening group is selected
Select the maximum temperature in the usable range of actual annealing temperature.
Step 3) specifically includes following steps:
3-1) material preliminary treatment:
Tissue:It is cut into 1mm3Size, takes 1-2 blocks to be put into 96 hole PCR plates, and carries out mark;
Cell:Under cell normally passage state, 100-150uL cell suspensions are drawn into 96 hole PCR plates, and carry out mark
Note, with Microplate centrifuge, room temperature, 1000-1500rpm, centrifuges 10min, after centrifugation, absorbs part supernatant, retains
10uL liquid and cell precipitation;
3-2) add extracts reagent:
Tissue samples:15-20uL micro-example nucleic acid rapid extraction reagents are added per hole;
Cell sample:10-15uL micro-example nucleic acid rapid extraction reagents are added per hole;
96 hole PCR plates are subjected to brief centrifugation with Microplate centrifuge, reagent and material are all gathered in the bottom in every hole;
3-3) obtain genome:
In PCR instrument, carry out 65 DEG C incubation 10min, 98 DEG C incubation 5min, be placed on it is spare on ice.
Step 3-2) in the micro-example nucleic acid rapid extraction reagent that uses purchased from the Nanjing essence easily limited public affairs of intelligence biotechnology
Department.
Step 4) is:
Screening group primer pair is prepared into primer premix system A, the sequencing primer of control group is to preparing primer premix system B, and 2
Kind premix system presses 8 by PCR water, sense primer (10umol/L), sense primer (10umol/L):1:1 prepares, and prepares 2 pieces
96 hole PCR plates A, B, are placed on ice, 2 × Taq Master Mix are first added per hole to PCR plate A, B, then add per hole to PCR plate A
Enter primer premix system A, add primer premix system B per hole to PCR plate B, finally added respectively to the every hole of PCR plate A, B different
The genome of numbering.After mixing, by all liq brief centrifugation to bottom of the tube, annealing temperature is set according to the result of step 2),
35-40 circulation of amplification, remaining condition are set according to reagent specification, carry out PCR reactions.
Step 4) is specially:
Screening group primer pair is prepared into primer premix system A, the sequencing primer of control group is to preparing primer premix system B, and 2
Kind premix system presses 8 by PCR water, sense primer (10umol/L), sense primer (10umol/L):1:1 prepares, and prepares 2 pieces
96 hole PCR plates A, B, are placed on ice, first add 2 × Taq Master Mix of 10uL per hole to PCR plate A, B, then to PCR plate A
The primer premix system A of 8uL is added per hole, the primer for adding 8uL per hole to PCR plate B premixes system B, finally respectively to PCR plate
A, B adds the genome of the different numberings of 2uL per hole, after mixing, by all liq brief centrifugation to bottom of the tube, annealing temperature according to
The result setting of step 2), expands 35-40 circulation, remaining condition is set according to reagent specification, carries out PCR reactions.
2 × Taq Master Mix are bought from Nanjing Vazyme Biotechnology Co., Ltd..
Further, in step 4), by taking 2 times of body individuals as an example:If its PCR reactions have used 1 forward direction Oligo
DNA, then 2 DNA sequence dnas for representing allele all change;Be not in that simply wherein 1 DNA sequence dna changes
Situation, avoids the interference of a large amount of heterozygosis samples.If having used 2 forward direction Oligo DNA, then 2 of allele are represented
In DNA, at least there are change at 1 for the sequence of every 1.One step of this method can detect all samples met the requirements,
Avoid cumbersome interpretation of result at the same time.
The present invention uses a PCR primer of the Oligo DNA fragmentations of structure knockout carrier as screening target sample, profit
The characteristics of needing to match completely with template, efficiently PCR could be triggered to react in PCR reactions with the sequence that primer 3 ' is held, to DNA
Upper possible mutation is detected.Method using the present invention reduces experimental procedure, and not design extra PCR primer,
Suitable for nearly all experimental design, it is not necessary to buy special DNA restriction endonucleases, false positive hardly occur.Obtain at the same time
The sample for being used to be sequenced there is higher qualification rate, and hardly omit qualified sample.
Brief description of the drawings
Fig. 1 is situation of the experimental design for only one site of editor, when positive Oligo DNA are situation A, screening group primer
To for:Positive Oligo DNA, downstream sequencing primer;When positive Oligo DNA are situation B, screening group primer pair is:Upstream is surveyed
Sequence primer, forward direction Oligo DNA;
Fig. 2 is that experimental design is while edits the situation in two sites, has two forward direction Oligo DNA (A and B), often
The method when selection of a screening primer pair is with reference to the only situation in one site of editor, if 2 sites of previous experiments design
At a distance of different 5 ' single-stranded ends that are moderate, and being located at same DNA double chain respectively, screening primer pair at this time can be become by two
One, selected as:A forward directions Oligo DNA, B forward direction Oligo DNA;
Positions of knockout the site KO1 and upstream and downstream sequencing primer of Fig. 3 embodiment 1Hnrnpa2b1 genes on DNA sequence dna
Put, according to the position relationship of three, choose the positive Oligo DNA of KO1 and downstream sequencing primer is used as screening primer pair;
After the success of 1 gene editing of Fig. 4 embodiments, the situation of change of 2 DNA sequence dnas of allele, knocks out situation 1 in original
The sequence (only listing part) that blank space has more in beginning sequence is the sequence of insertion, knocks out " * " representative missing in situation 1 and 2
Sequence;
Positions of knockout site KO1, the KO2 and upstream and downstream sequencing primer of Fig. 5 embodiment 2period1 genes on DNA sequence dna
Put, according to this position relationship, choose the positive Oligo DNA of positive Oligo DNA and KO2 of KO1 as screening primer
It is right;
The situation that Fig. 6 embodiments 2 specifically knock out, knocks out position and all occurs knocking out at the KO2 of site, situation is knocked out in figure
Black portions represent sequence it is consistent with original series, white positions represent at this relative to original series for lack.
Embodiment
Embodiment 1
A kind of method of fast and convenient screening CRISPR/Cas gene editing positive objects, comprises the following steps:
MHnrnpa2b1 Gene units point knocks out screening specifically in CHO-K1 cells
On NCBI, Hnrnpa2b1 (NCBI Gene ID are inquired about:NM_016806.3 genomic information).Design one
Site KO1 and its corresponding Oligo DNA sequence dnas KO1-F, KO1-R are knocked out, while designs the sequencing primer F and R of upstream and downstream
(Fig. 3).
KO1-F:caccgAGCGACTGAGTCCGCGATGG
KO1-R:aaacCCATCGCGGACTCAGTCGCTc
F:GTGGGGTTAATAGCTCAGCT
R:AGAAGGAACAGGCTAAGGTG
1) after knocking out the corresponding Oligo DNA hybridizations of site KO1, it is connected to pSpCas9-2A-puro knockout carriers BbsI
In site, plasmid pKO1 is built into.
2) Top10Competent Cell, screening positive recombinant and sequence verification are converted.
3) plasmid carries greatly, goes endotoxin to be used to transfect;
4) cell transfecting;
A) take exponential phase CHO-K1 cell suspensions trypan blue in good condition to count, determine cell number and cell viability
(cell viability>95%);
B) 5 × 10 are taken6Cell spreads six orifice plates.
C) every other day, with the plasmid transfection target cell of 2ug, transfection reagent lipo2000, ratio 1:2.5.
5) cell limiting dilution, monoclonal growth, genome extraction.
A) after transfecting 48hr, pool cells trypan blue counts.
B) monoclonal is divided pool cells into 96 orifice plates using limiting dilution assay;
C) after 2-3 weeks, by the cell dissociation of single clone in 96 orifice plates, terminated and digested with 200uL culture mediums, each sample
Draw 100uL and genome acquisition is carried out using micro-example Rapid nucleic acid extraction kit, remaining continues to cultivate.
The cell suspension for obtaining genome is transferred in 96 hole PCR plates, and carries out mark, centrifuged with microwell plate
Machine, room temperature, 1500rpm, centrifuges 10min, after centrifugation, absorbs 90uL supernatants;It is fast that 10uL micro-example nucleic acid is added per hole
Fast extracts reagent, it is careful to mix;96 hole PCR plates are subjected to brief centrifugation with Microplate centrifuge, reagent and material are all assembled
In the bottom in every hole;In PCR instrument, carry out 65 DEG C incubation 10min, 98 DEG C incubation 5min, be placed on it is spare on ice.
6) monoclonal screens, and control group is by the use of F, R as primer, and experimental group is by the use of KO1-F, R as primer, with the gene of acquisition
Group is template, carries out PCR amplification and agarose gel electrophoresis.It is real in the case where control group obtains the target stripe of about 460bp
Then it is potential positive colony when testing purpose band of the group without about 180bp.
PCR amplification sets PCR programs (table 1) with reference to following table in step 6), and wherein 59 DEG C of optimum annealing temperature comes from first
Step gropes to screen the optimum condition that the condition of PCR obtains.
Table 1PCR response procedures
7) PCR product of the control group of potential positive colony is subjected to TA clones, through DNA sequencing, is specifically struck
Situation about removing.By comparing, it is found that 2 DNA sequence dnas of the allele of potential positive colony are all mutated and changed not
Together, wherein one inserts one section of other DNA sequence dna while lacking one section again;Another DNA sequence dna has lacked a base
(Fig. 4).
Embodiment 2
A kind of method of fast and convenient screening CRISPR/Cas gene editing positive objects, comprises the following steps:
Specially:Period1 genes double site knocks out screening in MEF cells
On NCBI, Period1 (NCBI Gene ID are inquired about:18626) genomic information.Two knockout sites of design
KO1 and KO2 and its corresponding Oligo DNA sequence dnas KO1-F, KO1-R, KO2-F, KO2-R, while design the sequencing of upstream and downstream
Primer CXF and CXR (Fig. 5).
KO1-F:caccgATTAGTCAGCCCTCAGAGAC
KO1-R:aaacGTCTCTGAGGGCTGACTAATc
KO2-F:caccgCCCCCATCGGCCCCTTCTAG
KO2-R:aaacCTAGAAGGGGCCGATGGGGGc
CXF:GTGGGGTTAATAGCTCAGCT
CXR:AGAAGGAACAGGCTAAGGTG
1) after the corresponding Oligo DNA of two knockouts site KO1 and KO2 hybridize respectively, and it is connected respectively to pSpCas9-
In 2A-puro knockout carrier BbsI sites, plasmid pKO-1, plasmid pKO-2 are built into.
2) Top10Competent Cell, screening positive recombinant and sequence verification are converted.
3) plasmid carries greatly, goes endotoxin to be used to transfect.
4) cell transfecting
A) take exponential phase MEF cell suspensions trypan blue in good condition to count, determine that cell number and cell viability are (thin
Born of the same parents' vigor>95%)
B) 5 × 10 are taken6Cell spreads six orifice plates.
C) every other day, cell transfecting, the plasmid pKO-2 cotransfection target cells of the plasmid pKO-1 and 2ug of 2ug, transfection examination are carried out
Agent is lipo2000, ratio 1:2.5.
5) cell limiting dilution, monoclonal growth, genome extraction.
A) after transfecting 48hr, pool cells trypan blue counts.
B) monoclonal is divided pool cells into 96 orifice plates using limiting dilution assay;
C) after 2-3 weeks, by the cell dissociation of single clone in 96 orifice plates, terminated and digested with 200uL culture mediums, each sample
Draw 100uL and genome acquisition is carried out using micro-example Rapid nucleic acid extraction kit, remaining continues to cultivate.
The cell suspension for obtaining genome is transferred in 96 hole PCR plates, and carries out mark, centrifuged with microwell plate
Machine, room temperature, 1500rpm, centrifuges 10min, after centrifugation, absorbs 90uL supernatants;It is fast that 10uL micro-example nucleic acid is added per hole
Fast extracts reagent, it is careful to mix;96 hole PCR plates are subjected to brief centrifugation with Microplate centrifuge, reagent and material are all assembled
In the bottom in every hole;In PCR instrument, carry out 65 DEG C incubation 10min, 98 DEG C incubation 5min, be placed on it is spare on ice.
6) monoclonal screens, and Nanjing Jing Yizhi bio tech ltd photograph is organized by the use of CXF, CXR and is used as primer, experimental group
By the use of KO1-F and KO2-F as primer, using the genome of extraction as template, PCR amplification and agarose gel electrophoresis are carried out.Right
Then it is potential positive during purpose band of the screening group without about 150bp according in the case of the target stripe for group obtaining about 545bp
Clone.
PCR amplification sets PCR programs (table 2) with reference to following table in step 6), and wherein 58 DEG C of optimum annealing temperature comes from first
Step gropes to screen the optimum condition that the condition of PCR obtains.
Table 2PCR response procedures
7) PCR product of the control group of potential positive colony is subjected to TA clones, rear sequencing detection, is specifically struck
The situation (Fig. 6) removed.By comparing, it is found that 2 DNA sequence dnas of the allele of potential positive colony are all mutated, its
In a missing it is a bit of (28bp);Other one has lacked a large fragment (203bp).
Claims (6)
- A kind of 1. method of fast and convenient screening CRISPR/Cas gene editing positive objects, it is characterised in that the method Comprise the following steps:1) sequencing primer pair is designed, chooses screening group primer pair;2) annealing temperature of primer pair is designed;3) genome extracts;4) primer pair designed using step 1) carries out PCR amplification respectively;5) laggard row agarose gel electrophoresis are expanded, in the case where the PCR of control group has electrophoretic band, if screening group is not There is the electrophoretic band predicted, then corresponding sample is the target of preliminary screening;6) selecting step 5) sample that screens, PCR amplification is carried out to the genome of the sample using sequencing primer, after TA clones DNA sequencing is carried out, sequencing result is analyzed, verifies whether the sample meets experimental design.
- 2. method according to claim 1, it is characterised in that during step 1) screening group primer pair, used as primer Oligo DNA fragmentations are all that of forward direction, i.e. the Oligo DNA fragmentations comprising recognition site sequence.
- 3. method according to claim 1 or claim 2, it is characterised in that when step 1) is screened, 2 are detected at the same time with 1 pair of screening primer The change in a site, screening primer pair are two forward direction Oligo DNA fragmentations.
- 4. method according to claim 1 or claim 2, it is characterised in that when step 1) is screened, 1 is only detected with 1 pair of screening primer The change in site, screens the positive Oligo DNA fragmentations that primer pair is the site, and wherein one in combination can carry out The sequencing primer of PCR.
- 5. method according to claim 1 or claim 2, it is characterised in that step 3) specifically includes following steps:3-1) material preliminary treatment:Tissue:It is cut into 1mm3Size, takes 1-2 blocks to be put into 96 hole PCR plates, and carries out mark;Cell:Under cell normally passage state, 100-150uL cell suspensions are drawn into 96 hole PCR plates, and carry out mark, With Microplate centrifuge, room temperature, 1000-1500rpm, centrifuges 10min, after centrifugation, absorbs part supernatant, retains 10uL liquid Body and cell precipitation;3-2) add extracts reagent:Tissue samples:15-20uL micro-example nucleic acid rapid extraction reagents are added per hole;Cell sample:10-15uL micro-example nucleic acid rapid extraction reagents are added per hole;96 hole PCR plates are subjected to brief centrifugation with Microplate centrifuge, reagent and material are all gathered in the bottom in every hole;3-3) obtain genome:In PCR instrument, carry out 65 DEG C incubation 10min, 98 DEG C incubation 5min, be placed on it is spare on ice.
- 6. method according to claim 1, it is characterised in that step 4) is specially:Screening group primer pair is prepared into primer premix system A, for the sequencing primer of control group to preparing primer premix system B, 2 kinds pre- Mixed system presses 8 by PCR water, sense primer 10umol/L, sense primer 10umol/L:1:1 prepares, and prepares 2 piece of 96 hole PCR plate A, B, is placed on ice, 2 × Taq Master Mix is first added per hole to PCR plate A, B, then add primer premix per hole to PCR plate A System A, primer premix system B is added to PCR plate B per hole, finally adds the gene of different numberings per hole to PCR plate A, B respectively Group, after mixing, by all liq brief centrifugation to bottom of the tube, annealing temperature is set according to the result of step 2), amplification 35-40 Circulation, remaining condition are set according to reagent specification, carry out PCR reactions.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201711194211.3A CN107937501A (en) | 2017-11-24 | 2017-11-24 | A kind of method of fast and convenient screening CRISPR/Cas gene editing positive objects |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201711194211.3A CN107937501A (en) | 2017-11-24 | 2017-11-24 | A kind of method of fast and convenient screening CRISPR/Cas gene editing positive objects |
Publications (1)
Publication Number | Publication Date |
---|---|
CN107937501A true CN107937501A (en) | 2018-04-20 |
Family
ID=61948815
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201711194211.3A Pending CN107937501A (en) | 2017-11-24 | 2017-11-24 | A kind of method of fast and convenient screening CRISPR/Cas gene editing positive objects |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107937501A (en) |
Cited By (24)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
CN113249456A (en) * | 2021-05-21 | 2021-08-13 | 云南农业大学 | Method for rapidly screening gene editing pig positive cell line |
US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104560864A (en) * | 2014-12-22 | 2015-04-29 | 中国科学院微生物研究所 | IFN-beta gene knocked out 293T cell line built by utilizing CRISPR-Ca9 system |
CN106222204A (en) * | 2016-08-10 | 2016-12-14 | 中国科学院水生生物研究所 | A kind of method of Monopterus albus (Zuiew) gene editing |
WO2017147555A1 (en) * | 2016-02-26 | 2017-08-31 | Lanzatech New Zealand Limited | Crispr/cas systems for c-1 fixing bacteria |
-
2017
- 2017-11-24 CN CN201711194211.3A patent/CN107937501A/en active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104560864A (en) * | 2014-12-22 | 2015-04-29 | 中国科学院微生物研究所 | IFN-beta gene knocked out 293T cell line built by utilizing CRISPR-Ca9 system |
WO2017147555A1 (en) * | 2016-02-26 | 2017-08-31 | Lanzatech New Zealand Limited | Crispr/cas systems for c-1 fixing bacteria |
CN106222204A (en) * | 2016-08-10 | 2016-12-14 | 中国科学院水生生物研究所 | A kind of method of Monopterus albus (Zuiew) gene editing |
Non-Patent Citations (2)
Title |
---|
CHUAN YU ET AL.: "A PCR based protocol for detecting indel mutations induced by TALENs and CRISPRCas9 in zebrafish", 《PLOS ONE》 * |
胡文韬: "大豆NAC4和NAC27基因的克隆及其对拟南芥和水稻的遗传转化", 《中国优秀硕士学位论文全文数据库 基础科学辑》 * |
Cited By (37)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
CN113249456A (en) * | 2021-05-21 | 2021-08-13 | 云南农业大学 | Method for rapidly screening gene editing pig positive cell line |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107937501A (en) | A kind of method of fast and convenient screening CRISPR/Cas gene editing positive objects | |
Au et al. | CRISPR/Cas9 methodology for the generation of knockout deletions in Caenorhabditis elegans | |
US11155814B2 (en) | Methods for using DNA repair for cell engineering | |
Tai et al. | Engineering microdeletions and microduplications by targeting segmental duplications with CRISPR | |
US20220064633A1 (en) | Compositions and methods for highly efficient genetic screening using barcoded guide rna constructs | |
Gratz et al. | Precise genome editing of Drosophila with CRISPR RNA-guided Cas9 | |
Bush et al. | iTILLING: a personalized approach to the identification of induced mutations in Arabidopsis | |
Nadakuduti et al. | Evaluation of methods to assess in vivo activity of engineered genome-editing nucleases in protoplasts | |
AU2003201974B2 (en) | Method and test kit for demonstrating genetic identity | |
US20220136041A1 (en) | Off-Target Single Nucleotide Variants Caused by Single-Base Editing and High-Specificity Off-Target-Free Single-Base Gene Editing Tool | |
Pan et al. | Rapid identification and recovery of ENU-induced mutations with next-generation sequencing and Paired-End Low-Error analysis | |
D’Agostino et al. | A rapid and cheap methodology for CRISPR/Cas9 zebrafish mutant screening | |
AU2003201974A1 (en) | Method and test kit for demonstrating genetic identity | |
Yi et al. | Transient cotransformation of CRISPR/Cas9 and oligonucleotide templates enables efficient editing of target loci in Physcomitrella patens | |
Christie et al. | Mutation-independent allele-specific editing by CRISPR-Cas9, a novel approach to treat autosomal dominant disease | |
CN103898100B (en) | CccDNA standard items and preparation method thereof, quantitatively detection hepatitis B cccDNA method and kit | |
US9518293B2 (en) | High throughput genome-wide translocation sequencing | |
US20190241981A1 (en) | Plant breeding using next generation sequencing | |
CN115807037A (en) | Genetic controllable tetraploid fish breeding method and triploid fish preparation method | |
CN108794610A (en) | Corn hybridization is not affine GAP-associated protein GAP ZmGa1S and its encoding gene and application | |
Gratz et al. | Generating CRISPR alleles in Drosophila | |
Seagrist et al. | Recombination between T-DNA insertions to cause chromosomal deletions in Arabidopsis is a rare phenomenon | |
Au et al. | Optimizing guide RNA selection and CRISPR/Cas9 methodology for efficient generation of deletions in C. elegans | |
US20230407377A1 (en) | Crispr/cas screening system materials and methods | |
CN116043336A (en) | Method for constructing gene chip detection library |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180420 |