CN107937427A - A kind of homologous repair vector construction method based on CRISPR/Cas9 systems - Google Patents

A kind of homologous repair vector construction method based on CRISPR/Cas9 systems Download PDF

Info

Publication number
CN107937427A
CN107937427A CN201710981059.7A CN201710981059A CN107937427A CN 107937427 A CN107937427 A CN 107937427A CN 201710981059 A CN201710981059 A CN 201710981059A CN 107937427 A CN107937427 A CN 107937427A
Authority
CN
China
Prior art keywords
pcr
plasmid
phde
gel electrophoresis
agarose gel
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710981059.7A
Other languages
Chinese (zh)
Inventor
欧阳乐军
李莉梅
徐锡荣
刘雅丽
柳镜炬
梁裕华
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangdong University of Petrochemical Technology
Original Assignee
Guangdong University of Petrochemical Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangdong University of Petrochemical Technology filed Critical Guangdong University of Petrochemical Technology
Priority to CN201710981059.7A priority Critical patent/CN107937427A/en
Publication of CN107937427A publication Critical patent/CN107937427A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a kind of homologous repair vector construction method based on CRISPR/Cas9 systems, belong to gene engineering technology field；Its step is：Using plasmid PCBC and wildtype Arabidopsis thaliana genome as template, the homologous recovery template fragment of purpose band AS gRNA and AS of the sequence containing target practice, electrophoresis, gel extraction purpose band are expanded respectively by PCR；By plasmid PHDE mCH Bsa1 digestions；By the complete PHDE mCh carriers of digestion and ASgRNA through homologous recombination enzyme assembly and connection, form recombinant plasmid PHDE ASgRNA, conversion and sequencing identification, it will be connected after correct PHDE ASgRNA plasmids EcoR1 digestions will be sequenced again with the homologous recovery template fragment homologous recombination enzymes of AS, inverted and sequencing identification, build the homologous repair vectors of PHDE ASgRNA AS, the technology of the present invention can really realize the method for the CRISPR/Cas9 systems to the fixed point editting function of target organism genome, vector construction need to only pass through One_step PCR, it is simple and practicable, without being recycled to digestion carrier and PCR product purifying, packaging efficiency is high.

Description

A kind of homologous repair vector construction method based on CRISPR/Cas9 systems
Technical field
The present invention relates to a kind of homologous repair vector construction method based on CRISPR/Cas9 systems, and in particular to a kind of For the method for the plasmid vector of construction cDNA library construction screening, belong to gene engineering technology field.
Background technology
CRISPR/Cas9 genomes orientation editing technique is that being oriented to genome of growing up in recent years is accurately repaiied A kind of technology of decorations.By the way that the DNA of external source is imported on the specific site of recipient cell chromosome, so that specifically modifying gene Group, studies the function of gene.The operations such as the technology can lack the target site in genome, knock in, nucleotide amendment. 2013, CRISPR/Cas9 was applied in the mankind and mouse cell lines and gene is knocked out by scientist for the first time, with descendant Also have successfully been obtained application in model plant and other crops, the CRISPR/Cas9 systems by transformation are also promptly It is applied in the orientation editor research of the different Plant Genomes such as arabidopsis, tobacco, sorghum, rice, wheat, corn, and Obtain higher induced mutation rate and the genome editor plant of heredity can be stablized.Relative to transgenic technology, CRISPR/Cas9 System has trace easy to operate, quick, that huge fund input is not required, does not leave transgenosis afterwards in heredity editor, Foreign gene need not be quoted, thus biological safety is high, disputes on without transgenosis.
So far, the orientation editor for realizing genome using CRISPR/Cas9 systems can only be to the orientation of endogenous gene Knock out, can not also realize that fixed point introduces foreign gene, certain restriction effect is played to the function of research gene comprehensively.Therefore, Based on existing CRISPR/Cas9 carriers, foreign gene fixed point can be exchanged to endogenous gene position by structure one kind in fact, very The positive CRISPR/Cas9 systems realized to the fixed point editting function of target organism genome, for plant fixed point transgene improvement, newly Gene site-directed introducing etc. is of great significance.
The content of the invention
The object of the present invention is to provide one kind to exchange to endogenous gene position by foreign gene fixed point in fact, really realization pair The method of the CRISPR/Cas9 systems of the fixed point editting function of target organism genome, vector construction only need to by One_step PCR, Simple and practicable, without being recycled to digestion carrier and PCR product purifying, packaging efficiency is high.
To realize the purpose of foregoing invention, the technical solution that the present invention takes is as follows：
A kind of homologous repair vector construction method based on CRISPR/Cas9 systems, includes the following steps：
(1) target site designs
The selection of sgRNA target sites uses CRISPR Photographing On-line instruments (http://crispr.dbcls.jp/), to intend Southern mustard AS genes are target gene, the G-N19-NGG 23bp sequences close to 5' ends highest scoring are selected, wherein first G is small The initial signal site of rna transcription, NGG are the PAM sequences of the Cas9 assignments of genes gene mapping, it is necessary to which be inserted into gRNA carriers is that G-N19 is total to 20bp sequences, design the Target in two target practice sites altogether, realize that large fragment knocks out；Filled at the same time on the targeting vector of AS genes Enter the homologous reparation fragment of AS genes, realize that AS genes while CAS9 is knocked out, are done with the homology arm of the AS genes on carrier Template is repaired.
(2) design of primers
The primer is shown in Table 1.
1 research the primer information of table
Table 1Primersμsedinthis stμdy
Note：Underscore part represents homologous end sequence, and overstriking italicized item is target site sequence
Note,Μnderlinedis thehomologoμs arms ofPHDE andtheboldseqμence is the target locμs.
(3) structure of targeting vector PHDE-ASgRNA
1. PCR amplification purpose fragment：Totally 100 μ L, average mark are filled to 2 PCR tubules to PCR reactions cumulative volume；PCR reacts Condition is 98 DEG C of preheating 4min, and 40 circulations (98 DEG C of 45s, 55 DEG C of 10s, 72 DEG C of 30s), 72 DEG C keep the temperature；
Recycled 2. agarose gel electrophoresis is purified with purpose fragment：1.5% agarose gel electrophoresis PCR product, ultraviolet Purpose band is cut on transillumination platform, purpose band is loaded into 1.5mL EP pipes, -4 DEG C of freezing 20min, 15000rpm low-temperature centrifugations 20min, Aspirate supernatant is in PCR tubules, measured concentration, records OD260/OD280, -20 DEG C of preservations；
3. the digestion and identification of PHDE plasmids：20 μ L of digestion system cumulative volume, 50 DEG C of constant temperature are stayed overnight, then with digestion before PHDE plasmids compare, and the Ago-Gel for preparing 0.5% carries out electrophoretic analysis；
4. purpose fragment is recombinated with carrier：A PCR tubule is taken, successively adds 0.3 μ L linearisation PHDE carriers, 3 μ L weights Group enzyme and the AS genetic fragments of 1.2 μ L recycling, using restructuring zymotechnic, by the AS genetic fragments after recovery purifying and BsaI enzymes The carrier restructuring connection of tangent linearization, assembling condition is 50 DEG C of isothermal reaction 1h；
5. recon converts and identification：Recombinant products are utilized into thermal shock method conversion DH5a competence Escherichia coli, recovery training 12h is supported, chooses single bacterium colony 3~4h of shaking table culture, bacterium solution PCR identifications is done, is analyzed with 0.5% agarose gel electrophoresis, PCR reactions Condition is：94 DEG C of 3min, 30 circulations (94 DEG C of 30S, 55 DEG C of 30S, 72 DEG C of 45S), 72 DEG C of 2min；
6. the extraction and identification of recombinant plasmid：Alkaline lysis method of extracting plasmid is used after positive colony is incubated overnight, measure is dense Degree, records OD260/OD280, PCR analyses are carried out by template of the plasmid, are produced with the agarose gel electrophoresis PCR of 1.2% concentration Thing, the recombinant plasmid of the agarose gel electrophoresis extraction of 0.5% concentration；
7. recombinant plasmid sample presentation is sequenced：The plasmid that plasmid PCR is accredited as to the positive send to raw work Guangzhou Branch sequencing and tests Card, sequencing primer is Μ 626-IDF.
(4) structure of homologous recombination repair template vector PHDE-ASgRNA-AS
1. PCR amplification AS DNA homolog arm pieces sections：PCR reaction systems as hereinbefore, cumulative volume totally 100 μ L, after mixing Average mark is filled to 2 PCR tubules, and PCR reaction conditions are 98 DEG C of preheating 4min, and 40 circulations (98 DEG C of 45s, 55 DEG C of 10s, 72 DEG C 30s), 72 DEG C of insulations；
Recycled 2. agarose gel electrophoresis is purified with purpose fragment：By gel extraction mesh after 1.5% agarose gel electrophoresis Band, survey concentration, record OD260/OD280, -20 DEG C of preservations；
3. the digestion and identification of PHDE-ASgRNA plasmids：Digestion system cumulative volume 20 μ L, 37 DEG C of isothermal reaction 15min, are used 0.5% Ago-Gel carries out electrophoretic analysis；
4. purpose fragment is recombinated with carrier：PCR tubules are taken, successively add 0.3 μ L linearisation PHDE-ASgRNA carriers, 3 μ L Recombinase and the homology arm fragment of 1.2 μ L recycling, assembling condition is 50 DEG C of isothermal reaction 1h；
5. recon converts and identification：Recombinant products are utilized into thermal shock method conversion DH5a competence Escherichia coli, recovery training 12h is supported, chooses single bacterium colony 3~4h of shaking table culture, bacterium solution PCR identifications is done, is analyzed with 0.5% agarose gel electrophoresis；PCR reacts Condition is：94 DEG C of 3min, 30 circulations (94 DEG C of 30S, 55 DEG C of 30S, 72 DEG C of 45S), 72 DEG C of 2min；
6. the extraction and identification of recombinant plasmid：Plasmid, measured concentration, record are extracted after positive colony is incubated overnight OD260/OD280, PCR analyses, with the agarose gel electrophoresis PCR product of 1.2% concentration, 0.5% are carried out by template of the plasmid The recombinant plasmid of the agarose gel electrophoresis extraction of concentration；
7. recombinant plasmid sample presentation is sequenced：The plasmid sample presentation that plasmid PCR is accredited as to the positive is sequenced to raw work Guangzhou Branch, Sequencing primer is EcoR1-F.
The beneficial effects of the invention are as follows：
(1) PHDE-ASgRNA-AS recombinant plasmids are on the basis of PHDE-ASgRNA recombinant plasmids, are decorated in certain bits Enter with the homology arm of AS gene knockouts sequence homology but lack part base sequence (insertion of EcoR1 sites), as homologous recombination The template of reparation, achievees the purpose that fixed point introduces back mutation gene.
(2) homologous recombination technique is used, passes through PCR amplification purpose band, recycling, the linearization for enzyme restriction of carrier, assembling etc. Gene knockout target fragment and homologous recombination repair arm pieces section are successively cloned into identical carrier by process, can be in fact by foreign gene Fixed point exchanges to endogenous gene position, really realizes the CRISPR/Cas9 systems to the fixed point editting function of target organism genome The method of system, vector construction only need to be simple and practicable by One_step PCR, without being recycled to digestion carrier and PCR product purifying, group Fill efficient.
Embodiment
The present invention is described in further details below by example, these examples are only used for illustrating the present invention, and unlimited The scope of the present invention processed.
Eucalyptus pellita aseptic seedling hypocotyl is used to carry out tissue culture regeneration for explant, specific method is as follows：
The cultivation of 1 Arabidopsis thaliana Seedlings
50-80 seeds are taken slowly to rock 6min in 1.5mL centrifuge tubes, the alcohol for adding 1mL 75%, make seed abundant Disinfection, abandons alcohol, adds 1mL absolute ethyl alcohols, and more than 5min is stood after shaking up, with 1mL liquid-transfering guns gently by seed from centrifuge tube Sucking-off is beaten dry on aseptic filter paper.Dried seed is uniformly sprinkling upon in minimal medium (MS culture medium+7g/L agar+ 20g/L sucrose, pH5.8), wrap culture medium (preventing from seeing light) with newspaper and be placed in the processing overnight of 4 DEG C of refrigerator, make seed vernalization, with Promote flower_bud formation and floral organ development.Whole operation process need to be completed in superclean bench.Low temperature was stayed overnight into processing in second day Culture medium (removing newspaper) be placed in illumination box 23 DEG C and cultivate 7 days, seedling replanting to flowerpot, continues to be placed on illumination training Support 23 DEG C of cultures in case and supply subsequent experimental.
2 target sites design
The target site of sgRNA is to meet (N)20The sequence of NGG.Two target position are devised herein for arabidopsis AS1 genes Point.AS1 sequence informations are as follows, and 5 ' end underscore parts are that the end of target site 1,3 ' underlined sequences are target site 2.Lower stroke of wave of band Line is the sequence of PAM.
5’-GCGGGATCACTGGGTTAGGAGGCTGAACTTGTTGTTCAGAATGTAAAAACCCT CCATTCGAATTAGCCATCACAACCGTTGCAGCAGCGGCAGCAGCAGGGACAACG TTAGACCGCTCTTTGACAAGCTTCTCAGCGAAACTCTCGAGAATCCGATCGTACTT ACTCTCGTCAATAGGCTCAACTCTCTTGTTACTCTCTTTCTCTTCTCTCTGTTGCTT CTCCTTAAACACTTCCCACCACTTCCCTAACCGCTTTGCCGTCCTCCCGGGAACCT CAGCAGCAATCTTCTTCCACTTGTTGCCGTGTTTCTCCTGAAGACGGATCACAAGC CTCTGCTCTTCCTCTGTCAAAGACCCTTTCTTGATCCCTGGCTTAAGATAATTCTTC CATCTCTCTAAACAAGACTTGGCGTCACGGTTCAAAGGTTTGTTCATACGCTCAG ACACAAGATGCCATTCTCTCGGACCGAACTGTCTAACGTAAGCACGTAACAATGC ATCTTCTTCACCACTCCAACGTTGTCTCTCTTTCATCTCCTACTCCTCCTGACATCA CTTCTTCCCATCTCACCATCCTTCTTCATC-3’
3 design of primers
The structure of this experiment expression vector uses homologous recombination method, therefore different in design of primers.The primer of sgRNA Need additionally each to add the sequence homologous with both ends after carrier digestion of 20bp at the end of upstream and downstream primer 5 ' during design, as restructuring Connector, other primer normal designs.Primer used herein is shown in Table 2.
The PCR primer sequence used herein of table 2
Note：Underscore part represents homologous end sequence, and overstriking italicized item is target site sequence.
The structure of 4 expression vector PHDE-ASgRNA
4.1PCR amplifying target genes
PCR reaction systems (PrimeSTAR Max DNAPolymerase) are shown in Table 3.Cumulative volume totally 100 μ L, are confused after mixing Your centrifuge (making liquid on tube wall collect to tube bottom) 1 second, after gently being blown and beaten with liquid-transfering gun (tube bottom concentration is high after centrifugation) Average mark is filled to 2 PCR tubules.Whole operation process need to be operated on ice, be quickly completed.
PCR reaction conditions (PrimeSTARMax DNAPolymerase) are 98 DEG C of preheating 4min, and 40 circulate (98 DEG C 45s, 55 DEG C of 10s, 72 DEG C of 30s), 72 DEG C of insulations.
3 AS-gRNA gene PCR amplification reaction systems of table
4.2 agarose gel electrophoresis are purified to be recycled with purpose fragment
(1) Ago-Gel, which prepares (3 holes comb) and weighs 0.42g agaroses, is dissolved in 28mL 1 × TAE buffer solutions, i.e., and 1.5% Ago-Gel；
(2) PCR product is all added a glue hole by electrophoresis, and 100bp marker is compare, voltage 100V, electric current 50mA, power 50W, time 1h, electrophoresis liquid are 1 × TAE；
(3) photographed to record on gel imaging system, then cut purpose band on ultraviolet transillumination platform；
(4) purpose band is loaded into 1.5mL EP pipes, -4 DEG C freeze 20min, 15000rpm low-temperature centrifugation 20min, finally Aspirate supernatant is in PCR tubules, measured concentration, records OD260/OD280, -20 DEG C of preservations.
The digestion (linearisation) and identification of 4.3 PHDE-mCh plasmids
Digestion system is shown in Table 4, and 20 μ L of cumulative volume, 50 DEG C of constant temperature are stayed overnight；
Electrophoretic analysis：Compared with the PHDE-mCh plasmids before digestion, the Ago-Gel for preparing 0.5% carries out electrophoresis.
4 PHDE-mCh carrier digestion systems of table
4.4 purpose fragments are recombinated with carrier
A PCR tubule is taken, successively adds 0.3 μ L linearisation PHDE-mCh carriers, 3 μ L recombinases and 1.2 μ L recycling AS genetic fragments.Using restructuring zymotechnic, by the AS genetic fragments after recovery purifying and the carrier weight of BsaI linearization for enzyme restriction Group connection.Assembling condition is 50 DEG C of isothermal reaction 1h.
4.5 recons convert and identification
(1) convert：The DH5a competent cells that 1 pipe (100 μ L) prepares are taken out, is placed on and melts on ice；By recombinant products (about 4.5 μ L) is all added in pipe, is gently mixed, and is placed 30 minutes on ice；By centrifuge tube 42 DEG C of placement thermal shock 90 seconds, do not shake Dynamic centrifuge tube, is quickly transferred to ice bath more than 2 minutes by centrifuge tube；
(2) recover：Add the LB fluid nutrient mediums of 500 μ L antibiotic-frees, 150rpm shakes bacterium 40-60 minutes；
(3) cultivate：5000rpm centrifuges 1min, abandons supernatant, remaining about 100 μ L tube bottom bacterium apply tablet (add 50mg/L cards that The YEP solid mediums of mycin), positive control (the YEP solid plates for being not added with kanamycins are coated with a small amount of bacterium solution) and the moon are set Property control (add the YEP solid mediums of 50mg/L kanamycins, be coated with 100 μ L sterile waters), culture dish is inverted, in 37 DEG C of cultures 12h, observes bacterium colony；
(4) recon is screened：One single bacterium of picking drops down onto 1.5mL centrifuge tubes, adds 500 μ L kanamycins containing 50mg/L YEP fluid nutrient mediums (picking single bacterium colony number be no less than 10), 200rpm, 37 DEG C shake bacterium 3-4h；Being bacterium solution PCR, (system is shown in Table 3-4), PCR reaction conditions are：94 DEG C of 3min, 30 circulations (94 DEG C of 30S, 55 DEG C of 30S, 72 DEG C of 45S), 72 DEG C of 2min, and with 1.2% agarose gel electrophoresis identifies product.
5 bacterium solution PCR system of table
The extraction and identification of 4.6 recombinant plasmids
Prepare the 10mL centrifuge tubes of sterilizing, add the liquid YEP medium of 3mL kanamycins containing 50mg/L, choose positive Clone each 100 μ L and be separately added into each pipe, 37 DEG C, 200rpm incubator overnight cultures.Second day extraction plasmid, measured concentration, record OD260/OD280, PCR analyses are carried out by template of the plasmid, system is shown in Table 6.With the agarose gel electrophoresis PCR of 1.2% concentration Product, the recombinant plasmid of the agarose gel electrophoresis extraction of 0.5% concentration.
Plasmid extraction operating procedure：
(1) 1.5mL nutrient solutions are taken to pour into 1.5mLEppendorf pipes, 10000rmp centrifugation 1min, abandon supernatant, repeat to receive Once, pipe is inverted on filter paper flows to end remaining bacterium solution to collection；
(2) bacterial sediment be resuspended in 200 μ L solution I (need to acutely vibrate, can use be vortexed, make thalline disperse to mix, Place more than 2 minutes)；
(3) II 300 μ L of solution are added, cover tightly the mouth of pipe, quick gently reverse Eppendorf is managed for several times, to mix content (it must not vibrate, it is soft, do not exceed 2 minutes)；
(4) the III 300 μ L of solution of precooling are added, cover tightly the mouth of pipe, tube temperature is mixed for several times with reverse, sees that white flock sinks Form sediment.15000rmp centrifuges 10min；
(5) take 750 μ L of supernatant liquid to move into the Eppendorf pipes added with 750 μ L isopropanols, overturn even for several times, 15000rmp Centrifuge 10min；
(6) supernatant is abandoned, adds 75% ethanol of 1mL, is overturned for several times, then 15000rmp centrifuges 2min；
(7) pipe is inverted in filter paper flows to end liquid as far as possible, drying at room temperature 30 minutes；
(8) ddH of 30 μ L sterilizings is added2O dissolving precipitations, concentration mensuration, records OD260/OD280。
6 recombinant plasmid PCR of table analyzes reaction system
Note：10 μ L of cumulative volume, reaction condition for 98 DEG C preheating 4min, 40 circulation (98 DEG C of 45s, 55 DEG C of 10s, 72 DEG C 30s), 72 DEG C of insulations.
4.7 recombinant plasmid sample presentations are sequenced
The plasmid that plasmid PCR is accredited as to the positive is sent to raw work Guangzhou Branch sequence verification.Sequencing primer is Μ 626- IDF。
The structure of 5 homologous recombination repair expression vector PHDE-ASgRNA-AS
PHDE-ASgRNA-AS recombinant plasmids are on the basis of PHDE-ASgRNA-mCh recombinant plasmids, in specific site Load the homology arm (insertion of EcoR1 sites) with AS1 gene knockouts sequence homology but lack part base sequence, as homologous heavy The template that group is repaired, achievees the purpose that fixed point introduces back mutation gene.
5.1 PCR amplification homology arm fragments
PCR reaction systems (PrimeSTAR Max DNAPoLymerase) are shown in Table 7.Cumulative volume totally 100 μ L, put down after mixing Respectively it is filled to 2 PCR tubules.Whole operation process need to be operated on ice, be quickly completed.
PCR reaction conditions (PrimeSTAR Max DNAPoLymerase) are 98 DEG C of preheating 4min, and 40 circulate (98 DEG C 45s, 55 DEG C of 10s, 72 DEG C of 30s), 72 DEG C of insulations.
7 homology arm EcoR1PCR amplification reaction systems of table
5.2 agarose gel electrophoresis are purified to be recycled with purpose fragment
(1) Ago-Gel prepares (big comb) and weighs 0.42g agaroses and be dissolved in 28mL 1 × TAE buffer solutions, i.e., 1.5% Ago-Gel；
(2) PCR product is all added a glue hole by electrophoresis, and 100bp marker is compare, voltage 100V, electric current 50mA, power 50W, time 1h, electrophoresis liquid are 1 × TAE；
(3) photographed to record on gel imaging system, then cut purpose band on ultraviolet transillumination platform；
(4) purpose band is loaded into 1.5mL EP pipes, -4 DEG C of freezings 20min, 15000rpm low-temperature centrifugation 20min, draw Supernatant is in PCR tubules, measured concentration, records OD260/OD280, -20 DEG C of preservations.
The digestion (linearisation) and identification of 5.3 PHDE-ASgRNA-mCh plasmids
Digestion system is shown in Table 8, cumulative volume 20 μ L, 37 DEG C of isothermal reaction 15min；
Electrophoretic analysis：Compared with the PHDE-ASgRNA-mCh plasmids before digestion, prepare 0.5% Ago-Gel into Row electrophoretic analysis.
8 PHDE-ASgRNA-mCh carrier digestion systems of table
5.4 purpose fragments are recombinated with carrier
A PCR tubule is taken, successively adds 0.3 μ L linearisation PHDE-ASgRNA-mCh carriers, 3 μ L recombinases and 1.2 The homology arm fragment of μ L recycling.Assembling condition is 50 DEG C of isothermal reaction 1h.
5.5 recons convert and identification
Homology arm fragment and the recombinant products of the PHDE-ASgRNA-mCh carriers of linearisation are converted using thermal shock method DH5a competence Escherichia coli, recovery culture 12h, choose single bacterium colony 3~4h of shaking table culture, bacterium solution PCR identifications are done, with 0.5% fine jade Sepharose electrophoretic analysis.PCR reaction systems are shown in Table 9, PCR reaction conditions：94 DEG C of 3min, 30 circulation (94 DEG C of 30S, 55 DEG C 30S, 72 DEG C of 45S), 72 DEG C of 2min.
9 bacterium solution PCR system of table
The extraction and identification of 5.6 recombinant plasmids
The 10mL centrifuge tubes for preparing to sterilize are several, and often pipe adds the liquid YEP cultures of 3mL kanamycins containing 50mg/L Base, chooses each 100 μ L of positive colony and is separately added into each pipe, 37 DEG C, 200rpm incubator overnight cultures.Second day extraction plasmid (behaviour Work is shown in 3.3.6 plasmid extractions), measured concentration, records OD260/OD280, PCR analyses are carried out by template of the plasmid, system is shown in Table 10.With the agarose gel electrophoresis PCR product of 1.2% concentration, the restructuring matter of the agarose gel electrophoresis extraction of 0.5% concentration Grain.
10 recombinant plasmid PCR of table analyzes reaction system
Note：10 μ L of cumulative volume, reaction condition for 98 DEG C preheating 4min, 40 circulation (98 DEG C of 45s, 55 DEG C of 10s, 72 DEG C 30s), 72 DEG C.
5.7 recombinant plasmid sample presentations are sequenced
The plasmid sample presentation that plasmid PCR is accredited as to the positive is sequenced to raw work Guangzhou Branch, sequencing primer ECOR1-F.
Sequence table
<110>Guangdong University of Petrochemical Technology
<120>A kind of homologous repair vector construction method based on CRISPR/Cas9 systems
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2400
<212> DNA
<213>Unknown (Unknown)
<400> 1
ttctgtcttc tacttgaatt tacacatgta aagatataaa tcgattttat ttataaacca 60
aagtgttgca gctgactaaa tcaacatcaa gcttgagaaa acaaagccat ggataaactg 120
aagtgataaa tggaacacaa aggtaaaaga aacaaataca aagctgaggt aaggaaccca 180
aaagtctaag taaacattgg agacacccaa atgatcaaag acaaaaaaaa acaaaaaaaa 240
acaaaaaaaa aaccttacat tacattacaa gttacaacaa agagtttagg agacggtggg 300
gcggtctaat ctgcaaccca tttgttgttc aagaaacttg gtgagtctga tatgcctaga 360
ggtccattga tcagccagtt tctggtcttt ggcctctgcg tctcgcctca aaccaacgag 420
ctgttctctg tactctcctt cgatcttctc cattgcgttc ttctgctctt ccctaagagc 480
tttcatcttt gcctcaatct cctccatctt ctccctttgt ctacacgtct tctctgactc 540
tagctgcagc tccagccttc ttagcctcca tgcagcctct ttcttatggt ctgcccaagc 600
tcggtgccct tcctccaact ctctacaaca ctccacaagc tctgacaaga acacactctc 660
gctactccca ctacaagacg gcatcatact ccctaacaca agtccccctg gaccgttctc 720
tgctctctca ggctgttgct gctgcagcca cgggattggc ggttgaggcg cagctgcagc 780
cactgtggaa ggcgataatg tcaaagttac cgagggaggc cttgcaacaa cattgttccc 840
attgttagaa gtagctaacc aaggcgggat cactgggtta ggaggctgaa cttgttgttc 900
agaatgtaaa aaccctccat tcgaattagc catcacaacc gttgcagcag cggcagcagc 960
agggacaacg ttagaccgct ctttgacaag cttctcagcg aaactctcga gaatccgatc 1020
gtacttactc tcgtcaatag gctcaactct cttgttactc tctttctctt ctctctgttg 1080
cttctcctta aacacttccc accacttccc taaccgcttt gccgtcctcc cgggaacctc 1140
agcagcaatc ttcttccact tgttgccgtg tttctcctga agacggatca caagcctctg 1200
ctcttcctct gtcaaagacc ctttcttgat ccctggctta agataattct tccatctctc 1260
taaacaagac ttggcgtcac ggttcaaagg tttgttcata cgctcagaca caagatgcca 1320
ttctctcgga ccgaactgtc taacgtaagc acgtaacaat gcatcttctt caccactcca 1380
acgttgtctc tctttcatct cctactcctc ctgacatcac ttcttcccat ctcaccatcc 1440
ttcttcatct gtaccaaatt caaaatcaac ccgtttcata aatctctcca attcaaaact 1500
ctaaaagatc gaaacaaatc tacaagatct gtcgaatttt cgaattagaa attacaaagt 1560
ctgaaaaatt tccgtttcaa gaaatgaaaa tgacaaaaac tttgacaatg tttgaagcaa 1620
aacttggaat aatttgttat tatcacacta tacaacctat attctggaaa ccaaacaggg 1680
gaaattaatg ctgaccccaa aacactatta agcaaagact tattaagaag ataagagagt 1740
taaaattatt actataaaac aaaataaaaa tgcttaccaa atgatattga aaagataaat 1800
aatcccaaac tcaagagcaa cttccatcac acagatttgc tctctctctc actttttttt 1860
ttttatatag ttggagaaaa tggaagagag aaaacgaaaa gaccaaagtg agagaggctt 1920
ttaaaaccag acgacgtaca cgattagacc acagagacgg cataattaaa ataaaatctt 1980
taaaaaaaaa aagagagaaa aagtttaccg actgagacac agacgttttc ccctttttac 2040
atcacaagtg gggaaaaaaa aaactctgac agaggcgcgt ggaggtgaaa agttgaaatt 2100
ccataagttc gttgtttgtc attgacaata ttaaaccttt ttttatatat atttactaca 2160
ttgggatctc aaaattcatt tttctataac attatgagaa ataaaatgac aatctaatgt 2220
aggggatgct ttaaatttaa atgaaaaagt gttgtacttt agtggctgaa aagtcattta 2280
cttgtcaaaa tgatagaaga aaaactaacc attcaagaaa ataatgctcc atttataaac 2340
aactccttca ctcaaacaat agaattttat gtccaatttg agtaacatta atttccactt 2400
<210> 2
<211> 60
<212> DNA
<213>Unknown (Unknown)
<400> 2
ctagagtcga agtagtgatt ggcgggatca ctgggttagg gttttagagc tagaaatagc 60
<210> 3
<211> 60
<212> DNA
<213>Unknown (Unknown)
<400> 3
tgctatttct agctctaaaa ctctcaccat ccttcttcat caatctctta gtcgactcta 60
<210> 4
<211> 40
<212> DNA
<213>Unknown (Unknown)
<400> 4
taattgattg acaacgaatt gcgcagctgc agccactgtg 40
<210> 5
<211> 40
<212> DNA
<213>Unknown (Unknown)
<400> 5
acagctatga catgattacg gggaagaagt gatgtcagga 40
<210> 6
<211> 25
<212> DNA
<213>Unknown (Unknown)
<400> 6
tgtcccagga ttagaatgat taggc 25

Claims (1)

  1. A kind of 1. homologous repair vector construction method based on CRISPR/Cas9 systems, it is characterised in that：Include the following steps：
    (1) target site designs
    The selection of sgRNA target sites uses CRISPR Photographing On-line instruments, with arabidopsis AS genes：Sequence 1 is target gene, selection Close to the G-N19-NGG 23bp sequences of 5' ends highest scoring, wherein first G is the initial signal site of tiny RNA transcription, NGG It is the PAM sequences of the Cas9 assignments of genes gene mapping, it is necessary to be inserted into gRNA carriers is the common 20bp sequences of G-N19, designs two target practice positions altogether The Target of point, realizes that large fragment knocks out；Load the homologous reparation fragment of AS genes on the targeting vector of AS genes at the same time, it is real Existing AS genes do template with the homology arm of the AS genes on carrier and are repaired while CAS9 is knocked out；
    (2) design of primers is carried out
    As-gRNA-F sequences 2：
    CTAGAGTCGAAGTAGTGATTGGCGGGATCACTGGGTTAGGGTTTTAGAGCTAGAAATAGC
    As-gRNA-R sequences 3：
    TGCTATTTCTAGCTCTAAAACTCTCACCATCCTTCTTCATC
    AATCTCTTAGTCGACTCTA
    EcoR1-F sequences 4：
    TAATTGATTGACAACGAATTGCGCAGCTGCAGCCACTGTG
    EcoR1-R sequences 5：
    ACAGCTATGACATGATTACGGGGAAGAAGTGATGTCAGGA
    μ 626-IDF sequences 6：
    TGTCCCAGGATTAGAATGATTAGGC
    (3) structure of targeting vector PHDE-ASgRNA
    1. PCR amplification purpose fragment：Totally 100 μ L, average mark are filled to 2 PCR tubules to PCR reactions cumulative volume；PCR reaction conditions are 98 DEG C of preheatings 4min, 40 circulations 98 DEG C of 45s, 55 DEG C of 10s, 72 DEG C of 30s, 72 DEG C of insulations；
    Recycled 2. agarose gel electrophoresis is purified with purpose fragment：1.5% agarose gel electrophoresis PCR product, in ultraviolet transillumination Purpose band is cut on platform, purpose band is loaded into 1.5mL EP pipes, -4 DEG C of freezing 20min, 15000rpm low-temperature centrifugations 20min, Aspirate supernatant is in PCR tubules, measured concentration, records OD260/OD280, -20 DEG C of preservations；
    3. the digestion and identification of PHDE plasmids：20 μ L of digestion system cumulative volume, 50 DEG C of constant temperature are stayed overnight, then with the PHDE before digestion Plasmid compares, and the Ago-Gel for preparing 0.5% carries out electrophoretic analysis；
    4. purpose fragment is recombinated with carrier：A PCR tubule is taken, successively adds 0.3 μ L linearisation PHDE carriers, 3 μ L recombinases And 1.2 μ L recycling AS genetic fragments, using restructuring zymotechnic, by the AS genetic fragments after recovery purifying and BsaI digestion lines Property carrier restructuring connection, assembling condition is 50 DEG C of isothermal reaction 1h；
    5. recon converts and identification：Recombinant products are utilized into thermal shock method conversion DH5a competence Escherichia coli, recovery culture 12h, chooses single bacterium colony 3~4h of shaking table culture, does bacterium solution PCR identifications, is analyzed with 0.5% agarose gel electrophoresis, PCR reaction conditions For：94 DEG C of 3min, 30 circulations 94 DEG C of 30S, 55 DEG C of 30S, 72 DEG C of 45S, 72 DEG C of 2min；
    6. the extraction and identification of recombinant plasmid：Alkaline lysis method of extracting plasmid, measured concentration, note are used after positive colony is incubated overnight Record OD260/OD280, PCR analyses are carried out by template of the plasmid, with the agarose gel electrophoresis PCR product of 1.2% concentration, The recombinant plasmid of the agarose gel electrophoresis extraction of 0.5% concentration；
    7. recombinant plasmid sample presentation is sequenced：The plasmid that plasmid PCR is accredited as to the positive is sent to raw work Guangzhou Branch sequence verification, is surveyed Sequence primer is Μ 626-IDF；
    (4) structure of homologous recombination repair template vector PHDE-ASgRNA-AS
    1. PCR amplification AS DNA homolog arm pieces sections：As hereinbefore, cumulative volume totally 100 μ L are average after mixing for PCR reaction systems To 2 PCR tubules, PCR reaction conditions are 98 DEG C of preheatings 4min, 40 circulations 98 DEG C of 45s, 55 DEG C of 10s, 72 DEG C of 30s, 72 for packing DEG C insulation；
    Recycled 2. agarose gel electrophoresis is purified with purpose fragment：By gel extraction purpose bar after 1.5% agarose gel electrophoresis Band, surveys concentration, records OD260/OD280, -20 DEG C of preservations；
    3. the digestion and identification of PHDE-ASgRNA plasmids：Digestion system cumulative volume 20 μ L, 37 DEG C of isothermal reaction 15min, are used 0.5% Ago-Gel carries out electrophoretic analysis；
    4. purpose fragment is recombinated with carrier：PCR tubules are taken, successively add 0.3 μ L linearisation PHDE-ASgRNA carriers, 3 μ L restructuring Enzyme and the homology arm fragment of 1.2 μ L recycling, assembling condition is 50 DEG C of isothermal reaction 1h；
    5. recon converts and identification：Recombinant products are utilized into thermal shock method conversion DH5a competence Escherichia coli, recovery culture 12h, chooses single bacterium colony 3~4h of shaking table culture, does bacterium solution PCR identifications, is analyzed with 0.5% agarose gel electrophoresis；PCR reaction conditions For：94 DEG C of 3min, 30 circulations 94 DEG C of 30S, 55 DEG C of 30S, 72 DEG C of 45S, 72 DEG C of 2min；
    6. the extraction and identification of recombinant plasmid：Plasmid is extracted after positive colony is incubated overnight, measured concentration, records OD260/ OD280, PCR analyses, with the agarose gel electrophoresis PCR product of 1.2% concentration, 0.5% concentration are carried out by template of the plasmid The recombinant plasmid of agarose gel electrophoresis extraction；
    7. recombinant plasmid sample presentation is sequenced：The plasmid sample presentation that plasmid PCR is accredited as the positive is sequenced to raw work Guangzhou Branch sequencing Primer is EcoR1-F.
CN201710981059.7A 2017-10-20 2017-10-20 A kind of homologous repair vector construction method based on CRISPR/Cas9 systems Pending CN107937427A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710981059.7A CN107937427A (en) 2017-10-20 2017-10-20 A kind of homologous repair vector construction method based on CRISPR/Cas9 systems

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710981059.7A CN107937427A (en) 2017-10-20 2017-10-20 A kind of homologous repair vector construction method based on CRISPR/Cas9 systems

Publications (1)

Publication Number Publication Date
CN107937427A true CN107937427A (en) 2018-04-20

Family

ID=61936290

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710981059.7A Pending CN107937427A (en) 2017-10-20 2017-10-20 A kind of homologous repair vector construction method based on CRISPR/Cas9 systems

Country Status (1)

Country Link
CN (1) CN107937427A (en)

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
CN108841845A (en) * 2018-06-21 2018-11-20 广东石油化工学院 A kind of CRISPR/Cas9 carrier and its construction method with selection markers
CN109880851A (en) * 2019-03-28 2019-06-14 西北农林科技大学 For being enriched with the screening report carrier and screening technique of the homologous recombination repair cell of CRISPR/Cas9 mediation
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
CN112210573A (en) * 2020-10-14 2021-01-12 浙江大学 DNA template for modifying primary cells by using gene editing and fixed-point insertion method
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US11999947B2 (en) 2023-02-24 2024-06-04 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014186686A3 (en) * 2013-05-17 2015-01-08 Two Blades Foundation Targeted mutagenesis and genome engineering in plants using rna-guided cas nucleases
CN105112435A (en) * 2015-08-09 2015-12-02 中国水稻研究所 Establishment and application of plant multi-gene knockout vector
US20160145631A1 (en) * 2013-06-14 2016-05-26 Cellectis Methods for non-transgenic genome editing in plants
CN106222197A (en) * 2013-07-16 2016-12-14 中国科学院上海生命科学研究院 Plant Genome pointed decoration method
CN107034229A (en) * 2017-04-07 2017-08-11 江苏贝瑞利生物科技有限公司 High frequency zone CRISPR/CAS9 gene editings system candidate sgRNA systems and application in a kind of plant
CN107236737A (en) * 2017-05-19 2017-10-10 上海交通大学 The sgRNA sequences of special target arabidopsis ILK2 genes and its application

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014186686A3 (en) * 2013-05-17 2015-01-08 Two Blades Foundation Targeted mutagenesis and genome engineering in plants using rna-guided cas nucleases
US20160145631A1 (en) * 2013-06-14 2016-05-26 Cellectis Methods for non-transgenic genome editing in plants
CN106222197A (en) * 2013-07-16 2016-12-14 中国科学院上海生命科学研究院 Plant Genome pointed decoration method
CN105112435A (en) * 2015-08-09 2015-12-02 中国水稻研究所 Establishment and application of plant multi-gene knockout vector
CN107034229A (en) * 2017-04-07 2017-08-11 江苏贝瑞利生物科技有限公司 High frequency zone CRISPR/CAS9 gene editings system candidate sgRNA systems and application in a kind of plant
CN107236737A (en) * 2017-05-19 2017-10-10 上海交通大学 The sgRNA sequences of special target arabidopsis ILK2 genes and its application

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DANIEL G. GIBSON ET AL: "Complete Chemical Synthesis，Assembly，and Cloning of a Mycoplasma genitalium Genome", 《SCIENCE》 *
LIN，X. ET AL: "ACCESSION NO.NM_129319，Arabidopsis thaliana myb-like HTH transcriptional regulator family protein （AS1），mRNA", 《GENBANK》 *
XIUHUA GAO ET AL: "An Effective Strategy for Reliably Isolating Heritable and Cas9-Free Arabidopsis Mutants Generated by CRISPR/Cas9-Mediated Genome Editing", 《PLANT PHYSIOLOGY》 *
ZHENGYAN FENG ET AL: "Mutigeneration analysis reveals the inheritance specificity，and patterns of CRISPR/Cas-induced gene modifications in Arabiposis", 《PNAS》 *

Cited By (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
CN108841845A (en) * 2018-06-21 2018-11-20 广东石油化工学院 A kind of CRISPR/Cas9 carrier and its construction method with selection markers
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
CN109880851A (en) * 2019-03-28 2019-06-14 西北农林科技大学 For being enriched with the screening report carrier and screening technique of the homologous recombination repair cell of CRISPR/Cas9 mediation
US12006520B2 (en) 2019-06-14 2024-06-11 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
CN112210573A (en) * 2020-10-14 2021-01-12 浙江大学 DNA template for modifying primary cells by using gene editing and fixed-point insertion method
US11999947B2 (en) 2023-02-24 2024-06-04 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof

Similar Documents

Publication Publication Date Title
CN107937427A (en) A kind of homologous repair vector construction method based on CRISPR/Cas9 systems
Li et al. Targeted plant genome editing via the CRISPR/Cas9 technology
CN106367435A (en) Method for directionally knocking out miRNA (micro Ribonucleic Acid) of paddy rice
CN107326042A (en) The fixed point of paddy rice TMS10 genes knocks out system and its application
CN108034671B (en) Plasmid vector and method for establishing plant population by using same
CN109642235A (en) Method and composition for the genomic modification in plant
BRPI0922922A2 (en) methods for regenerating jatropha curcas plants for agrobacterium-mediated transformation of jatropha curcas plants
Cody et al. Direct delivery and fast-treated Agrobacterium co-culture (Fast-TrACC) plant transformation methods for Nicotiana benthamiana
Semiarti et al. Application of CRISPR/Cas9 genome editing system for molecular breeding of orchids
CN108841826A (en) Application of the arabidopsis long-chain non-coding RNA AtHAL6 in regulation plant high temperature stress patience
CN104593380B (en) For the gene ZmHKT1 for the coding corn HKT transport proteins for improving plant salt endurance;1a and its application
CN103739686A (en) Protein related to plant yield improvement and quality improvement, and encoding gene and application thereof
CN106868036A (en) A kind of method of rite-directed mutagenesis initiative corn compact plant germplasm and its application
CN108795978A (en) A kind of method and its application for formulating male sterility crop new germ plasm by gene editing
CN105018521B (en) Cultivate the method and its relevant biological material of the genetically modified plants of fluorescin mCherry label tubulin
CN103172717B (en) Plant low potassium stress resistant related protein GmWRKY50 as well as encoding gene and application thereof
CN102021199A (en) Method for regulating lily florescence
Cody et al. BiBAC Modification and Stable Transfer into Maize (Zea mays) Hi‐II Immature Embryos via Agrobacterium‐Mediated Transformation
CN113913440B (en) Application of GhD1119 gene in regulating and controlling cotton flowering of upland cotton
CN112980876B (en) Application of GhGPAT12 protein and GhGPAT25 protein in regulation and control of cotton male reproductive development
CN109371059A (en) A kind of gene editing method of cotton
CN110106171A (en) Long-chain non-coding RNA and its application in regulation plant frigostabile
CN106244595B (en) China fir phytosulfokine-α CLPSK1 gene and its application
CN107022566B (en) A kind of expression vector and its application in plant gene function research
CN108715853A (en) NtHAK11 genes and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination